Subjects
Ten healthy newborn tricolor guinea pigs (provided by the animal experimental center of the First Affiliated Hospital of the University of Science and Technology of China) were randomly selected at about 7 days of age, weighing 100–140 g. All animal experiments and procedures were performed in accordance with the Association for Research in Vision and Ophthalmology (ARVO) Statement for the Use of Animals in Ophthalmic and Vision research. The study was examined and approved by the Experimental Animal Ethics Committee of Anhui Medical University.
Main reagents: Dulbecco's Modified Eagle Medium (DMEM) culture medium, fetal bovine serum (GIBCO, Carlsbad, CA, USA); TGF-β1 (Sigma, St. Louis, MO, USA); TGF-β1 inhibitor (SB-431542), Sp1 inhibitor (Plicamycin; MedChemExpress, Monmouth Junction, NJ, USA); Sp1 antibody (1: 150; 21962-1-AP), collagen I antibody (1: 150; 14695-1-AP; a polyclonal antibody.Wuhan Sanying Biotechnology Co., Ltd., Wuhan, China); immunohistochemical secondary antibody universal PV6000 (Beijing Zhongshan golden bridge Co., Ltd., Beijing, China);vimentin (Wuhan Sanying Biotechnology Co., Ltd., Wuhan, China).
Guinea pig scleral fibroblasts culture
First, the eyes of guinea pigs were removed under strict aseptic conditions and operation. The eyes were rinsed with D-Hank solution at 4°C. The cornea was removed along the incision of the corneal margin and the lens, and the vitreous, retina, and pigment epithelium-choroid tissues were also removed. The posterior sclera tissue was separated and cut into 1 mm3 tissue blocks and inoculated on the wall of a 25-cm culture bottle. The tissue blocks were placed with a spacing of 0.3–0.5 cm in a 37°C and 5% CO2 incubator. After 2 h, DMEM containing 15% fetal bovine serum and double resistance solution was added. Contact the medium with the tissue mass. The medium was replaced every 3–5 days. When the cells reached 80% confluence and showed fusion, they were digested with 0.25% trypsin. Depending on the number of primary cells, 2–3 times of the culture medium volume was added. The cell suspension was placed in two or three bottles for subculture. Three generations of cells were divided into four groups. TGF-β1 was added to the first group at a final concentration of 10 ng/mL(According to pre-experimental results ), the second group was treated with TGF-β1 + 100 ng/mL TGF-β1 inhibitor, the third group was treated with TGF-β1 + 100 ng/mL Sp1 inhibitor, and the fourth group was a blank control group(the vehicle is added only).
Immunohistochemistry: Cells from the four groups were placed on slides,and continue to be cultured immediately for 2 d, washed with phosphate-buffered saline (PBS) three times for 2 min, and then fixed with glacial acetone for 10 min. Then, they were washed with PBS twice for 2 min, followed by incubation in formaldehyde containing 3% H2O2 for 30 min at room temperature to block endogenous enzymes. Trypsin (0.1%) was added for 5 min at room temperature, and then the primary antibody (1:50 dilution) was added at 4°C overnight. After rewarming the samples, the secondary antibody was added for 30 min. Next, the samples were washed with PBS three times for 2 min, and then DAB was used for color development and hematoxylin staining. The expression of Sp1, collagen I protein and vimentin was observed.
Quantitative PCR (qPCR): According to the instructions, total RNA was extracted from the cells and put into 0.2 mL PCR tubes (without RNase). Total RNA(2 µg) and 10 µmol/L Oligo (dT) were added to 0.2 mL of RNase-free water and heated at 65°C for 5 min, and then placed in an ice bath for 3 min.Reverse transcription was performed in a tube containing 4.0 µL of 5× reaction buffer, 2 µL of 10 mmol/L dNTP mix, 1 µL of RibolockTM RNase inhibitor, and 1 µL of Revert Aid TM M-MuLV reverse transcriptase at 42℃ for 60min and 70℃ for 5min. cDNA was extracted and stored at -80℃ until PCR analysis.PCR amplification was carried out with cDNA as the template. PCR reaction conditions: denaturation at 95°C for 5 min, and then 35 cycles of denaturation at 95°C for 30 s, annealing at 55°C for 30 s, and extension at 72°C for 40 s, followed by a final extension at 72°C for 10 min and 4°C for 10 min. Electrophoresis was used to examine the PCR products, which were photographed by a gel imaging system. To ensure accuracy, all experiments were conducted at least three times.Table 1 demonstrates nucleotide sequences of primers used in the experiments and β-actin serves as an internal reference primer.
Table 1
Primer sequence,annealing temperature and predicted product size
|
Gene
|
Forward primer
|
Reverse primer
|
Tm(℃)
|
Size(bp)
|
|
β-actin
|
GCTCTATCCTGGCCTCACTC
|
GGGTGAGGGACTTCCTGTAA
|
55
|
400
|
|
Collagen I
|
ACAAGCGATTACACACCCAA
|
TTAGTTTCCTGCCTCTGCCT
|
55
|
239
|
|
Sp1
|
CTCAAAGGAACAGAGTGGCA
|
GAGCTGGGAGTCAAGGTAGC
|
55
|
486
|
Protein expression detection: Total protein was extracted by adding lysis buffer to the tissues. The protein concentration of the scleral tissues was measured by the BCA method, and the expression levels of Sp1 and collagen I in scleral tissues were measured by western blotting. Anti-Sp1 and anti-collagen I antibodies were used as the primary antibodies, and β-actin was used as the internal reference. Quantity One software was used to conduct strip gray analysis: the relative expression level of Sp1 protein = the gray value of Sp1 protein band / β-actin band; the relative expression level of collagen I protein = the gray value of collagen I protein band / β-actin band.
Scoring systems: A double blind method was used to examine and score the slides with immunohistochemically stained cells. The positive products of Sp1 and collagen I were brown-yellow fine granules after immunohistochemical staining. Using a semi-quantitative standard, 10 high-power visual fields were randomly observed in each case and evaluated by calculating the number of positive cells and the staining depth of the recorded cells: ≤ 10% positive cells = 0 points, 11–25% positive cells = 1 point, 26–50% positive cells = 2 points, 51–75% positive cells = 3 points, ≥ 76% positive cells = 4 points. According to the staining intensity of positive cells: light yellow without positive staining or uniform background = 0 points, light brown yellow = 1 point, light brown = 2 points and brown = 3 points. Finally, the two integrals were multiplied: 0 points is (−), 1–4 points is (+), 5–8 points is moderately positive (++) and 9–12 points is (+++). The results were examined twice, and those with inconsistent scores were observed and confirmed again.
Statistical analysis
SPSS 17.0 software was used for statistical analysis. The data are expressed as mean ± SD. One-way analysis of variance (ANOVA) was used to analyze the samples that had more than two groups, and Dunnett’s multiple comparisons test was performed with the control groups. P < 0.05 was considered statistically significant. GraphPad Prism 5 was used to draw the statistical quantitative graph.