Mice
Mice were bred and maintained in specific-pathogen-free conditions at the Australian National University (ANU), Canberra, Australia. Experimentation was performed according to the regulations approved by the local institution ethics committee, including the Australian National University’s Animal and human Experimentation Ethics Committee.
Generation of the Tlr7 and Rnaseh2b mutant mouse strains
Tlr7 Y264H and deficient mice as well as Rnaseh2b-deficient knockout mice were generated using CRISPR-Cas9 mediated gene editing technology (34). Genomic sequences were obtained from Ensembl (Ensembl.org) and compared to ascertain conservation of the sequences between mouse and human genes. Single guide RNA (sgRNA) and single stranded oligonucleotides were purchased from IDT with the following sequences:
Tlr7 Y264H sgRNA 5’-TATGGGACATTATAACATCG-3’ and
Rnaseh2b-5’-CTTTTAGTGCCACCACAGTT-3’
Tlr7 Y264H ssOligo: 5’- GTCAATGAATTGAAAGCATTGTCATGGATCTGTAAGGGGGAATTATTTTCACACGGTGTACACGGATATGGGACATTATGACATCGAGGGCAATTTCCACTTAGGTCAAGAACTTGCAACTCATTGAGGTTATTAAAATCATTTTCTTGGATTTTCTTAAT-3’
3-4 week old C57BL/6Ncrl mice mated with C57BL/6Ncrl males. Pseudopregnant CFW/crl mice were superovulated and mated with stud males. After detection of a vaginal plug, the fertilized zygotes were collected from the oviduct and Cas9 protein (50 ng/µl) was co injected with a mixture of sgRNA (2.5 ng/µl) and ssOligo (50 ng/µl) into the pronucleus of the fertilized zygotes. After the micro-injection of the eggs, the zygotes were incubated overnight at 37ºC under 5% CO2 and two-cell stage embryos were surgically transferred into the uterus of the pseudopregnant CFW/Crl mice. The primers designed to amplify these regions are: Tlr7_Y264H_F 5’- TGAAACACTCTACCTGGGTCA-3’, _ Tlr7_Y264H_R 5’- GCCTCCTCAATTTCTCTGGC-3’ Rnaseh2b-F 5’- GCAAGACCATCCCTACTCCA-3’ and Rnaseh2b-_R 5’- AACACCTGCCCACATCTGTA-3’.
Human samples DNA sequencing
Written informed consent was obtained as part of the Centre for Personalised Immunology program. The study was approved by and complies with all relevant ethical regulations of the Australian National University and ACT Health Human Ethics Committees, the University Hospitals Institutional Review Board, or by Renji Hospital Ethics Committee of Shanghai Jiaotong University School of Medicine. Saliva was collected in Oragene™ DNA self-collection kits and purified using PrepIT™ DNA purification kits (Oragene) and treated with Ribonuclease A (Qiagen). DNA samples were enriched with Human SureSelect XT2 All Exon V4 Kit and sequenced by Illumina HiSeq 2000 (Illumina, Inc.). Bioinformatic analysis was performed at JCSMR, ANU as previously described (34).
Human PBMC preparation
PBMCs were isolated using Ficoll-Paque (GE Healthcare Life Sciences) gradient centrifugation and frozen in Fetal Bovine Serum (FBS, Gibco) with 10% DMSO (Sigma Aldrich).
Flow cytometry
Single cells suspensions were prepared from mouse spleens or thawed PBMCs, and individual subsets analysed by flow cytometry. The primary antibodies used for mouse tissues included: SiglecH-APC (#551, Biolegend), IgD-FITC (#405718, Biolegend), IgD-PerCP Cy5.5 (#11-26c.2a, BD Pharmingen), CD3-A700 (#17A2, BioLegend), CD19- BUV395 (#1D3, BD Horizon), CD138-PE (#281-2, BD Pharmingen), PD1-BV421 (#29F.1A12, BioLegend), CCR7-PerCP Cy5.5 (#4B12, BioLegend), CD8-BUV805 (#53-6.7, BD Horizon), CD19-BV510 (#6D5, BioLegend), CD4-BUV395 (#6K1.5, BD Horizon) CD21/35-BV605 (#7G6, BD Horizon), CD45.1-BV605 (#A20, BioLegend), CD45.1-BV711 (#A20, BioLegend), CD45.1-PB (#A20, BioLegend, TLR7-PE (#A94B10, BD Pharmingen), CD23-BV421 (#B3B4, BioLegend), CXCR3-PE (#CXCR3-173, BioLegend), CD19-A700 (#eBio1D3, Invitrogen), FoxP3-FITC (#FJK-16s, Invitrogen (eBioscience), FoxP3-PECy7 (#FJK-16s, Invitrogen eBioscience), IgM-FITC (#II/41, BD Pharmingen), IgM-PECy7 (#II/41, Invitrogen), CD44-FITC (#IM7, BD Pharmingen), CD44-PB (#IM7, BioLegend), CD95 (FAS)-BV510 (#Jo2, BD Horizon), BCL6-A467 (#K112-91, BD Pharmingen), CD11b-PerCP Cy5.5 (#M1/70, BioLegend), IA/IE-BV421 (#M5/114.15.2, BioLegend), CD11c-A647 (#N418, BioLegend), CD11c-BV510 (#N418, BioLegend), CD11c-FITC (#N418, BioLegend), CD25-PE (#PC62, BioLegend), B220-A647 (#RA3-6B2, BD Pharmingen), B220-BUV395 (#RA3-6B2, BD Horizon), B220-BUV737 (#RA3-6B2, BD Horizon), CD98-PECy7 (#RI.388, BioLegend), CD4-PECy7 (#RM4-5, BD Pharmingen), CD25-A647 (#PC61, Biolegend), CD4-A647 (#RM4-5, Biolegend), CD11c-APC (#HL3, BD Pharmingen), CD138-Biotin (#281-2, BD Bioscience), CXCR5-Biotin (#2G8, BD Bioscience), Streptavidin-BUV805 (BD Horizon), Streptavidin-BV510 (BioLegend), CD19-BV605 (#6D5, Biolegend), B220-PE (#RA3-6B2, Biolegend), BST2-PE (#927, Biolegend), CD19-PE (#6D5, Biolegend), IgD-PE (#11-26c.2a, Biolegend), CD11b-PECy7 (#M1/70, eBiosciences), Streptavidin-PECy (eBiosciences), CD4-PerCPCy5.5 (#RM4-5, Biolegend), CD45.2-PerCPCy5.5 (#104, BD Bioscience), CD3-Pacific Blue (#HIT2, BD pharmingen). For human PBMCs: CD19-BV650 (#HIB19, Biolegend), HLA-DR-BV510 (#L243, Biolegend), CD 24-BV605 (#ML5, Biolegend), CD56-PECy7 (#NCAM16.2, BD pharmingen), CD14-PerCP (#MΦP9, BD pharmingen), IgD-BV510 (#IA6-2, Biolegend), CD123-PE (#7G3, BD pharmingen), CD21-APC (#B-ly4, BD pharmingen), CD11c-APC (#B-ly6, BD pharmingen), CD16-APC-H7 (#3G8, BD pharmingen), IgG-PECy7 (#G18-145, BD pharmingen), CD10-PE-CF594 (#HI10a, BD pharmingen), IgA-PE (#IS11-8E10, Miltenyi Biotech), CD27-APC-EF-780 (#O323, eBiosciences), IgM-EF450 (#SA-DA4, eBiosciences), CD38-PerCP-Cy5.5 (#A60792, Beckman Coulter), CD93-PECy7 (#AA4.1, Biolegend). Zombie aqua dye (BioLegend) or live dead fixable green (Thermos Fisher Scientific) was used for detecting dead cells. Cell Fc receptors were blocked using purified Rat anti-mouse CD16/CD32 (Mouse BD Fc Block™ BD Biosciences) and then stained for 30 min at 4°C, in the dark, with primary and secondary antibodies. Intracellular stains used the FOXP3 Transcription Factor Staining Buffer Set (eBioscience) as per the manufacturer’s instructions. Samples were acquired on a Fortessa or Fortessa X-20 cytometer with FACSDiva (BD, Biosciences) and analyzed using FlowJo software v10 (FlowJo LLC). All FACS and microscopy work was carried out at the Microscopy and Cytometry Facility, Australian National University.
Sanger sequencing
Primers for human TLR7 DNA sequencing were used at 10 µM (primer sequences available on request). PCR amplification was carried out using Phusion Hot Start II DNA Polymerase II (Thermo Fisher Scientific) and under conditions recommended by the manufacturer. PCR amplicons were electrophoresed and excised bands purified using the QIAquick Gel Extraction Kit (Qiagen). Sanger sequencing was completed using Big Dye Terminator Cycle sequencing kit v3.1 (Applied Biosystems, Carlsbad) using the same primers used for PCR amplication. Sequencing reactions were run on 3730 DNA Analyze (Applied Biosystems) at the ACRF Biomolecular Resource Facility, Australian National University.
Immunohistochemistry
Liver, pancreas and kidneys were fixed in 10% Neutral buffer formalin (NBF) solution, embedded in paraffin and stained by hematoxylin and eosin (H&E).
Bone Marrow Chimera experimentation
For competitive bone marrow chimeras, Rag1-/- mice were irradiated and injected intravenously with equal numbers of bone marrow cells from either WT or Kika CD45.2 and WT CD45.1 mice. Mice were given Bactrim in their drinking water for 48hrs before injection and for 6 weeks following injection, and housed in sterile cages. Following 22 weeks of reconstitution mice were taken down for phenotyping by flow cytometry.
B cell culture and Cell Trace Violet staining
Single cell suspensions were prepared from kika, WT or TLR7 KO mouse spleens. B cells were magnetically purified using mouse B Cell Isolation Kit (Miltenyi Biotec), labeled with Cell Trace Violet (CTV, Thermo Fisher) and cultured for 72 hours in complete RPMI 1640 media (Sigma-Aldrich) supplemented with 2mM L-Glutamine (GIBCO), 100 U penicillin-streptomycin (GIBCO), 0.1 mM nonessential amino acids (GIBCO), 100 mM HEPES (GIBCO), 55 mM β-mercaptoethanol (GIBCO) and 10% FBS (GIBCO) at 37°C in 5% CO2. For B cell receptor (BCR) stimulation, cells were cultured in 10 µg/mL AffiniPure F(ab')₂ fragment goat anti-mouse IgM, µ chain specific (Jackson Immuno Research) or 1 ug/ml each R837 (Invitrogen). CD93 expression was examined by sorting splenic B cells with CD19-PE (#6D5, Biolegend), CD3-APCCy7 (#17A2, Biolegend), CD93-APC (#AA4.1, Invitrogen) and the viability stain 7-aminoactinomycin D (Molecular Probes, Invitrogen), cells were cultured with complete RPMI for 72 hours and stimulated with anti-mouse IgM or R837. Bone marrow was obtained from mice, the Fc receptors blocked (Purified Rat Anti-Mouse CD16/CD32 (Mouse BD Fc Block™ BD Biosciences) and cells stained and sorted with B220-PE (#RA3-6B2, BioLegend), CD93-APC (#AA4.1, Invitrogen) and the viability stain 7-aminoactinomycin D (Molecular Probes, Invitrogen). Cells were sorted on a FACS Aria II and cultured in Complete RPMI media.
ADVIA blood analysis
Orbital bleeds were performed on mice and blood samples were run on the ADVIA (Siemens Advia 1200).
Western blotting
Cytosolic extracts were prepared from ~20-40 million splenocytes by lysis in TritonX100 buffer (0.5% TritonX100, 20mM Tris.HCl pH7.4, 150mM NaCl, 1mM EDTA, 10% glycerol) and centrifuged. Cytosolic extracts were resolved on 8% SDS-polyacrylamide gels and probed with the relevant primary and secondary antibodies. Rabbit anti-TLR7 (D7; Cell Signaling Technology) and mouse anti mouseTLR7-PE (A94B10; BD Biosciences) were used at 1:1000, the actin monoclonal antibody (JLA20, Developmental Studies Hybridoma Bank, The University of Iowa) was used at 1:5000. Membranes were developed with Clarity Western ECL Substrate (BioRad Laboratories).
Dual luciferase assays
RAW 264.7 cells were transfected with 245 ng of either pNIFTY (NF-κB luciferase; InvivoGen) or an IFN-β luciferase reporter, pRL-CMV (100 ng; Promega) renilla luciferase control plasmid, 125 ng of TLR7-HA plasmids (Genecopoeia Inc.) expressing the individual variants and MYD88. After overnight expression half the samples were stimulated with 1 ug/ml each R837 (Invitrogen) and R848 (Invitrogen) for 6 hrs and dual luciferase assays performed as previously described (34). For the MyD88 luciferase assays HEK293 cells were transfected with plasmids containing full length MYD88 (GenScript Biotech) or the MYD88 A6Pfs39* (GenScript Biotech) at 25, 50, 100 or 200 µg/ml.
Statistics
Statistical analysis was carried out using R software version 3.6.1 (The R Foundation for Statistical Computing) and the Emmeans package. Mouse spleen mass data was analysed using two experiments as a blocking factor, followed by a pairwise estimated marginal means comparison of genotypes. Mouse cellular phenotyping, ELISAs, white blood cell and platelet count analysis were performed using a logged linear regression model, followed by a pairwise estimated marginal means comparison of genotypes. Purified B cell cultures were analysed using linear regression model followed by a pairwise estimated marginal means comparison of genotypes and stimulatory effect. Luciferase assays statistics were analysed using a one-way ANOVA with Tukey’s multiple comparison (PRISM, GraphPad Software LLC). All data was graphed using PRISM.
DNA, RNA, nRNP ELISAs
Plates were coated with poly-L-lysine (Sigma Aldrich) before addition of 2.5 µg of either DNA (D7290, Sigma), RNA (AM7120G, Thermo Fisher) or nRNP (SRC-1000, Immunovision). Plates were then blocked in ELISA blocking buffer (PBS and 1% BSA) for 2 hours at room temperature. Mouse serum was diluted 1:40 with ELISA coating buffer (0.05 M Sodium Carbonate anhydrous/Sodium Hydrogen Carbonate, pH 9.6), and incubated in the ELISA plates overnight at 4°C. Plates were washed and goat anti-mouse IgG-AP antibody (Alkaline Phosphatase, Southern Biotech) added for 1 hour at 37°C. Phosphatase substrate (Sigma S0942) was used as described by the manufacturer. Samples were read on an Infinite 200 PRO Tecan Microplate Reader (Tecan Group Ltd, Switzerland) at an absorbance of 405 nm and normalised to background absorbance at 605 nm.
HEp-2/Crithidia luciliae immunofluorescence
Antinuclear antibodies (ANAs) and dsDNA were determined using Hep-2 and Crithidia luciliae slides (both from NOVA Lite), respectively. Serum was diluted 1:40 for HEp-2 slides and 1:20 for Crithidia slides and stained as described by the manufacturer using donkey anti-mouse IgG Alexa-488 (Moleclar Probes) as secondary antibody. Slides were imaged on an Olympus IX71 inverted bright-field/fluorescence microscope.