Association of Matrix Metalloproteinase-2 (MMP‑2) and MMP‑9 Promoter Variants, their Serum Levels, and Activities with Aortic Valve Calcification (AVC) in a Population from Western Iran

doi:10.21203/rs.3.rs-1526423/v1

Download PDF

Research Article

Association of Matrix Metalloproteinase-2 (MMP‑2) and MMP‑9 Promoter Variants, their Serum Levels, and Activities with Aortic Valve Calcification (AVC) in a Population from Western Iran

https://doi.org/10.21203/rs.3.rs-1526423/v1

This work is licensed under a CC BY 4.0 License

Journal Publication

published 06 May, 2024

Read the published version in Genetic Testing and Molecular Biomarkers →

Version 1

posted

You are reading this latest preprint version

Matrix metalloproteinase (MMP) enzyme gene polymorphisms, particularly MMP- 2 -1575G / A and MMP-9-1562 C / T promoter polymorphism, also their serum levels and activity were reported to have an association with aortic valve calcification (AVC). We investigated the possible relationship between allele A of MMP-2 and T allele of MMP-9 in synchrony and synergism and risk of AVC. 92 cases with AVC with a mean age of 63 years and 92 healthy individuals with a mean age of 61.78 years from West of Iran were included, and MMP- 2 -1575G / A and MMP-9-1562 C / T promoter polymorphism were detected using PCR–RFLP. We also investigated the serum levels of MMP- 2 and 9 and their activity by using ELISA and gelatin zymography methods, respectively. In addition, serum biochemical parameters including FBS, urea and creatinine, cholesterol, triglyceride, HDL, LDL, calcium, phosphorus, blood pressure SBP and DBP were measured. The frequency of A alleles from the MMP2-1575 variant was slightly higher in the presence of heart valve calcification disease (P = 0.002). Additionally, the frequency of T allele of the MMP9-1562 variant was higher than the control group (P = 0.007). Serum levels and activity of both MMP-2 and MMP-9 were found to be significantly higher than the control group (P < 0.001). Increased serum levels and activity of MMP-2 and MMP-9 in patients, then the control group predispose them to cardiovascular disease.

Aortic and Mitral Valve Calcification

MMP-9

MMP-2

MMP- 2 -1575G/A SNP

MMP-9-1562 C/T SNP

Aortic valve calcification (AVC) is one of the most common valvular illnesses in developed countries (1). AVC is classified as an active inflammatory condition with lipoprotein buildup, chronic inflammation, and calcium deposition in the valvular lobes, comparable to atherosclerosis (2, 3). Calcium deposition in some sections of the valve does not block the valve in the early stages of the illness, and this is referred to as normal valve function. Calcific aortic stenosis occurs when calcification thickens the valve surface, limiting blood flow and causing abnormalities in the movement of the valve leaflets (4, 5). This condition affects about 1% to 2% of the population and is a leading cause of AVC. The majority of these individuals' aortic valves become calcified over time, and just 1% of them have normal aortic valve function (6). Oxidative stress, hypertension, sex, age, obesity, metabolic syndrome, hyperlipidemia, diabetes, smoking, renal disease, and reduced Fetuin-A serum levels are the most critical variables in the illness's occurrence(5, 7, 8). NOTCH1, VDR, APOB, APOE, TGFB1, ESR1, and IL10 polymorphisms are among the most important genetic factors in the development of AVC (9). Aortic valve calcification affects 25% of persons aged 65 to 74 and 48% of adults over the age of 84. Shortness of breath, chest discomfort, syncope, and atrial fibrillation are the most common symptoms of AVC (10). Doppler echocardiography is the gold standard for determining the severity of valve calcification. The only effective therapy for calcification of the aortic valve is valve replacement. There is currently no medication therapy that can slow the course of aortic valve disease or improve survival rates (10). Mitral valve calcification (MAC) is a long-term calcification of the fibrous tissue of the mitral valve that is common in the elderly and is caused by rheumatic heart disease. The presence of MAC in the body has been linked to a greater frequency of cardiovascular disease in studies (11). Age, sex, chronic renal disease, hypertension, diabetes mellitus, dyslipidemia, smoking, Marfan's metabolic syndrome, Holler syndrome, and low blood calcium and phosphorus levels are the most relevant clinical risk factors (12). Matrix metalloproteinase (MMPs) enzymes belong to a larger family of proteases called super Metzincin (13, 14). MMPs may normally breakdown extracellular matrix (ECM) proteins and are involved in tissue deformation during morphogenesis and angiogenesis, tissue healing, and diseases such cirrhosis, arthritis, and metastasis (15, 16). MMP tissue inhibitors, such as tissue inhibitors of metalloproteinases-1 (TIMP-1) to TIMP-4, suppress matrix metalloproteinases at the level of gene transcription (17, 18). The MMP-2 and MMP-9 break down chondroitin sulfate, laminin, collagen IV, and V (19). The MMP-2 -1575G/A variant is located directly to 5′ to a half-palindromic potential estrogen receptor binding site. The 1575A allele has been reported to crucially reduce transcription activity (20). The polymorphism MMP-9 -1562 C>T in the promoter region may increase promoter activity (20, 21). These polymorphisms have also been reported in the susceptibility of individuals to several pathologies (22, 23). We investigated if there is a synergistic link between the appearance of allele A of MMP-2 and the T allele of MMP-9 and the risk of heart valve calcification in this study.

2-1 Study population

The study comprised 92 individuals (52 men and 40 women) with a mean age of 64.86±10.38 with aortic and mitral valve calcification, who were confirmed as the case group by a cardiologist (patient group). In addition, the Healthy group consisted of 92 sex- and age-matched people (43 men and 49 women), with a mean age of 63.77±7.46. There were no additional illnesses associated with matrix metalloproteinases 2 and 9 in the control group. Individuals with OVC were referred to Imam Ali Hospital based on a cardiologist's diagnosis; also, the control group had no history of cardiovascular illness. The study was done according to the guidelines of the 1975 Declaration of Helsinki.

2.2 Sample Collection and DNA Extraction

In each of the two groups, 10 mL of blood was taken and split into two portions of 5 mL to extract DNA and separate serum samples. The phenol-chloroform technique was used to extract DNA from peripheral blood cells (24-26), and samples were dissolved in ddH₂O and stored at −70 °C.

2.3 Genotyping

On chromosomes 20 and 16, target areas (MMP-9 C/T -1562 and MMP-2 G/A -1575) were amplified using polymerase chain reaction (PCR) (27, 28). Primers were designed using the Primer3 online website (https:// prime r3. ut. ee/). The sequences of the primers were as the following:

(MMP-9, F: 5′- GCCT GGC ACATAG TAG GCCC -3′, R: 5′- CTTCCTAGCCAGCCGGCATC -3′) (MMP-2, F: 5′- AGG TTT GTC ACT GGG TCA GGC TG -3′, R: 5′- CCT AGG AAG GGG GCA GAT AGG AC -3′)

MMP-2 and MMP-9 were genotyped using restriction fragment length polymorphism (RFLP), with RCA1 and sph1 as restriction enzymes, respectively. PCR was performed with 25 μL volume (1 μL of DNA at the concentrations of 200–600 ng, 0.6 μL of each primer at a concentration of 10 pmol, 0.75 μL of MgCl2 at a concentration of 50 mM, 0.5 μL of dNTPs at a concentration of 200 μM, 0.5 μL Taq polymerase at a concentration of 5 U/μL, and 2.5 μL of 10 × PCR buffer. The PCR process for determining the MMP-2 genotypes was completed in 35 cycles under initial denaturation at 94 °C for 5 min, denaturation at 94 °C for 30 s, annealing at 68 °C for 60 s, extension at 72 °C for 30 s, and a final extension at 72 °C for 10 min. The PCR product was detected as a 301 bp on 1.5% agarose gel after electrophoresis. 10 μL of the PCR product was digested with RCA1 enzyme for 16 h at 37 °C. The RFLP product was electrophoresed in 2.0% agarose gel and stained with ethidium bromide. The PCR product in this position was not cleaved by the RCA1 enzyme since there was no mutation in the wild allele (G/G), resulting in a 301-bp fragment. In the heterozygote form (A/G), three fragments of 301, 189, and 112 bp were generated, and two fragments of 189 and 112 bp in the mutant homozygote form (A/A) (Fig. 1a). The PCR process for determining the MMP-9 genotypes was performed in 35 cycles under initial denaturation at 94 °C for 5 min, denaturation at 95 °C for thirty seconds, annealing at 64 °C for 60 s, extension at 72 °C for 30 s, and a final extension at 72 °C for 10 min. The PCR product was detected as a 435 bp on 1.5% agarose gel after electrophoresis. 10 μL of the PCR product was digested with sph1 enzyme for 16 h at 37 °C. The RFLP product was electrophoresed in 2.0% agarose gel and stained with ethidium bromide. Since there was no mutation in the form of wild allele (C/C), the PCR product in this site was not cleaved by the sph1 enzyme, and a fragment with a length of 435 bp was created. Three fragments of 435 bp, 244 bp, and 191 bp were developed in the heterozygote form (C/T), and two fragments of 244 bp and 191 bp in the mutant homozygote form (T/T). (Fig. 1b).

2.4 Measurement of Serum MMP‑2 and MMP‑9

Serum MMP-2 and MMP-9 levels were measured using a Quantikine ELISA kit (R&D Systems-USA), and the results were detected using the Awareness Elisa reader version Stat fax 2100 (ChroMate, Minneapolis-US).

2.5 Measurement of matrix metalloproteinase 2 and 9 enzyme activity

The gelatin zymography technique was used to evaluate the serum enzymatic activity of MMP-2 and MMP-9, as well as their proenzymes. In brief, the amount of total protein was measured by Bradford method and diluted to adjust the protein content to 2 μg/μL. In this experiment, we used sodium dodecyl sulfate (SDS) acrylamide gel (8%) containing 1 mg/mL gelatin and loaded 20 μL of sample in each well before running the test. Electrophoresis was performed and then, gels were washed with 100 mL renaturation buffer comprising 2.5% Triton X-100 to remove the SDS three times and incubated with developing buffer in the shaker incubator at 37 °C for 18 h. After this step, the gels were stained with Coomassie brilliant blue for 40 minutes before being rinsed with H₂O, methanol, and acetic acid for 60 minutes. The gel image was analyzed using the software Image-J®program (NIH-USA)(Fig. 2a and 2b).

2.6 Biochemical and Clinical Parameters

In this study, the serum levels of urea, FBS, calcium, phosphorus, creatinine, total cholesterol, triacylglyceride (TG), high-density lipoprotein (HDL-C), and low-density lipoprotein (LDL-C) were measured by Pars Azmun kits-Iran using automated RA-1000 (AutoTechnicon, USA). The physician used a blood pressure monitor to measure SBP and DBP parameters (Omron, M2-HEM-7121-E-Vietnam). Angiography was used to diagnose AVC.

2.7 Statistical Analysis

The normal distribution of quantitative data was investigated by the One-Sample Kolmogorov–Smirnov test. Analysis of age, BMI, the serum levels and activity of matrix metalloproteinase 2 and 9, creatinine, TG, calcium, total cholesterol, urea, phosphorus, HDL-C, LDL-C, FBS, SBP, and DBP was performed by student’s t-test. Also, distribution of different qualitative data was compared between the groups using the Chi-square test (χ2). Simple and multiple logistic regression analyses were used for the calculation of the odds ratio. Moreover, we used the Pearson correlation test to assess the association between matrix metalloproteinase 2 and 9 with other biochemical and physiologic parameters. The statistical analysis was performed using SPSS (Ver 16, SPSS Inc., Chicago, USA) and P < 0.05 was considered to be statistically significant.

Table 1 shows the comparison of demographic data and means values of biochemical and clinical data between patient and control groups. MMP-9 serum levels, MMP-9 and MMP-2 activities, FBS, LDL-C, HDL-C, urea, creatinine, calcium, phosphorus, SBP, and DBP in the patient group were notably higher when compared to the control group (P<0.001). The distribution of genotypic and allelic frequencies of MMP-9 and MMP-2 genotypes between studied groups is shown in Table 2. The overall distribution of the frequency of MMP-9 genotypes in the patient group compared to the control group was significantly correlated (P=0.007, 2X=9.95, df=2). The frequency distribution of MMP-9 genotypes in the dominant form was significantly different in the patient group compared to the healthy group (P=0.002, 2X=9.79, df=1). The frequency of C alleles against T alleles in the patient group compared to the control group was significantly related (P<0.001, 2X=28.75, df=1). In individuals with CT+TT genotype, the risk of aortic and mitral valve calcification increased by 1.69% compared to people with CC genotype, and there was a significant difference (P = 0.002, 2χ= 9.79, df = 1). The risk of aortic and mitral valve calcification increased significantly by 3.22% in those carrying the T allele compared with those carrying the C allele. The overall distribution of the frequency of MMP-2 genotypes in the patient group compared to the control group was significantly correlated (P=0.002, 2X=12.43, df=2).

The patient group had a substantially different frequency distribution of MMP-2 genotypes in the dominant form than the control group (P=0.005, 2X=8.01, df=1). The frequency of G alleles versus A alleles was significantly associated in the sick group compared to the control group (P0.001, 2X=29.68, df=1). The risk of aortic and mitral valve calcification rose by 1.35 percent in persons with genotype GA+AA compared to people with genotype GG, although the difference was not significant. When comparing individuals with the T allele to those with the C allele, the risk of aortic and mitral valve calcification rose by 2.81 percent. Table 3 shows the differences in MMP-2 gene parameters in individuals with aortic and mitral valve calcification who had the GG genotype against the control group. Serum levels of MMP-9 and 2, MMP-2 activity, FBS, TG, HDL-C, LDL-C, urea, calcium, phosphorus, SBP, and DBP in the patient group were significantly increased compared to the control group, and no significant association was found in mean values of BMI (P=0.47), serum levels of total cholesterol (P=0.12) and MMP-9 activity (P =0.09), creatinine (P = 0.23) between two included groups. Comparison of MMP-2 gene parameters in patients with aortic and mitral valve calcification with GA+AA genotype showed that in these patients, serum levels and activities of MMP-2 and serum levels of MMP-9, LDL-C, urea, creatinine, calcium, phosphorus, SBP, and DBP in the patient group were significantly increased compared to the control group (P<0.001).

Table 4 compares MMP-9 gene values in individuals with aortic and mitral valve calcification who have the CC genotype to the control group. In the patient group, serum levels and activities of MMP-9 and MMP-2, FBS, TG, HDL-C, LDL-C, urea, calcium, phosphorus, SBP, and DBP were significantly higher than in the control group, while mean values of BMI (P=0.28), total cholesterol (P=0.17), and creatinine (P=0.05) showed no significant association.

Comparison of parameters in patients with aortic and mitral valve calcification with CT+TT genotype in comparison with the same genotype in control group showed that serum levels of MMP-2 and MMP-9, MMP-2 activities, LDL-C, Urea, Phosphorus, and SBP also showed significant association in the patient group compared to the control group. In addition, other parameters including BMI(P=0.25), MMP-9 activities (P=0.49), FBS(P=0.06), total cholesterol(P=0.99), TG (P=0.95), HDL-C (P=0.14), creatinine (P=0.12) and DBP showed no significant difference between the two groups. Table 5 shows the correlations between MMP-2 and MMP-9 levels and several biochemical and clinical indicators in both the patient and control groups. In the control group, MMP-2 levels were substantially related to urea (P=0.036). Furthermore, serum MMP-2 levels in the patient group had no significant relationship with the aforementioned criteria. Serum MMP-9 levels were found to be substantially related to creatinine levels in the control group (P=0.04). The result of gelatin zymograms for MMP-2 and MMP-9 in both groups the activity of MMP-2 and Map 9 enzymes in patients was higher than the control group and was statistically significant (Fig. 2).

MMPs have been implicated in the pathogenesis of atherosclerosis in previous investigations (29, 30). The use of MMP inhibitors like GM6001 disturbs the calcification process in the arteries (31). Increased levels and activity of matrix metalloproteinases increase the risk of extracellular matrix breakdown in the intima of coronary arteries, which can lead to atherosclerotic plaques and later plaque rupture (32). Kiefer et al. evaluated the role of MMP-2 in the pathology of CAC and Showed an increase in MMP-2 activity in CAC pathology, which was consistent with the results of our study (33). MMP activity is linked to vascular calcification in chronic kidney disease (CKD), and Chen et al. found that inhibiting MMP activity can reduce vascular calcification (34). Yihong Hua et al. found a link between MMP-2 and SHF gene polymorphisms and heart failure in a Chinese population. Their findings imply that allele A of SNP 1059, which has a better prognosis than other genotypes, might be used to detect SHF in northern Chinese Han people (35). The MMP-2 gene promoter SNP 1575G / A was shown to be strongly linked with cardiovascular disease in the current investigation; the results of another study in Iran found a link between MMP-2 and MMP-9 promoter polymorphism with cardiovascular disease (36). Chang et al. reported that MMP-2 gene promoter SNP 1575G / A was not significantly associated with cardiovascular disease which was in contradiction with our results (37). We aimed to look into the link between the presence of allele A of MMP-2 and T allele of MMP-9 in synchrony and synergism and the risk of AVC since there have been only a few studies on the MMP-2 gene promoter and its correlation with aortic and mitral valve calcification illness. Patients with allele A of polymorphism G / A 1575- should be considered carriers with a high-risk factor for cardiovascular disease. High serum levels of MMP-2 in allele A carriers were related to the risk of aortic and mitral valve calcification in patients. Also, In the present study, the activity of MMP2 was measured and their activity level was higher in the patient group than the control group, confirming the high serum level of this enzyme. The MMP-9 gene promoter SNP 1562TC was shown to be substantially related with cardiovascular disease in our investigation. The association of this polymorphism with coronary artery disease and MMP-9 levels was reported by Zhang et al. Their results showed that T <C mononucleotide polymorphism at position 1562 of the MMP-9 gene promoter was associated with increased genes expression involved in coronary artery stenosis and coronary aortic valve. They hypothesized that the T allele was associated with increased promoter activity relative to the C allele, which could be exacerbated by disease severity (38). Wang et al. investigated the function of the MMP-9 -1562 C>T SNP in China. Individuals with the 1562T allele were shown to have a greater chance of acquiring the condition, according to their findings (39). Shu ye et al. found that carriers of the 1562-T allele had high levels of mRNA of MMP-9 enzyme and high serum levels of MMP-9 and greater activity (34). Furthermore, polymorphisms in the MMP-9 -1562C/T promoter alter gene function through changing gene transcription (40, 41). Early-onset coronary artery disease (ECAD) was studied by Saedi et al. in Iran. They suggested that T allele in MMP-9 -1562 C>T may play a role in developing ECAD (42). Our previous study, which reported that both serum levels of MMP-2 and MMP-9 and their activity were higher in individuals with CAC compared with healthy people and also reported that A and T allele in MMP-9 and 2 SNPs may be a risk factor for developing CAC, supports the results of the present data (43). In this regard, Hua et al. showed that A allele MMP-2 rs243866 was related to lower risk of heart failure (35). Tissue inhibitors of metalloproteinases, or TIMPs,are important in the control of MMP activity.In future investigations, we recommend enrolling additional individuals and monitoring TIMPs (44-46). Finally, in patients with aortic and mitral valve calcification, those with the T allele of the C / T 1562 polymorphism MMP-9 should be regarded carriers with a high-risk factor for cardiovascular disease. In addition, as compared to the control group, elevated blood levels of MMP-9 in T allele carriers were linked to an increased risk of aortic and mitral valve calcification in patients.

In the present study, for the first time, the synergistic effect of both SNP and 1562 T - MMP-9 and 1575 A - MMP-2 alleles are jointly reported as risk factors for heart valve calcification. It seems that higher serum levels and activity of MMP-2, as well as MMP-9 in patients, compared to the control group make them more susceptible to cardiovascular involvement and myocardial infarction.

BMI Body mass index

CAC Coronary artery calcification

DBP Diastolic blood pressure

SBP Systolic blood pressure

SNP Single-nucleotide polymorphism

HDL High-density lipoprotein

LDL Low-density lipoprotein

DFU Diabetic foot ulcers

ECM Extracellular matrix

FBS Fasting blood sugar

AVC Aortic valve calcification

Funding: This work was supported by the Research Council of Kermanshah University of Medical Sciences (Grant number: 96681).

Conflict of Interest: The authors declare that they have no conflict of interest.

Acknowledgments

This work was performed in partial fulfillment of the requirements for the specialty of cardiology thesis of Faeghe Hoseini, in the School of Medicine, Kermanshah University of Medical Sciences Kermanshah, Iran. The authors gratefully acknowledge the Research Council of Kermanshah University of Medical Sciences (Grant Number 96681) for financial support.

Availability of data and material: The datasets used and/or analyzed during the current study are available from the corresponding author on reasonable request.

Code availability: N/A

Ethics approval and consent to participate: This study was approved by the ethics committee of Kermanshah Medical University (IR.KUMS.REC.1396.572). All patients signed a consent form.

Consent for publication: Patients signed informed consent regarding publishing their data and photographs.

Consent to participate: Informed consent was obtained from all individual participants included in the study.

Compliance with ethical standards

Conflict of interest: The authors declare that they have no known competing financial interests or personal relationships that could have appeared to influence the work reported in this paper.

Author contributions: All authors contributed to the study conception and design. Material preparation, data collection, were performed by SE, FH, NS, and data analysis were performed by FB, AF, and EM. The first draft of the manuscript was written by AK and RH and all authors commented on previous versions of the manuscript. All authors read and approved the final manuscript.

Milhorini Pio, S., Bax, J. and Delgado, V. (2020). How valvular calcification can affect the outcomes of transcatheter aortic valve implantation. Expert review of medical devices 17: 773–784.
Coté, N., Mahmut, A., Bosse, Y., Couture, C., Pagé, S., Trahan, S., Boulanger, M.C., Fournier, D., Pibarot, P. and Mathieu, P. (2013). Inflammation is associated with the remodeling of calcific aortic valve disease. Inflammation 36: 573–581.
de Oliveira Sá, M.P.B., Cavalcanti, L.R.P., Perazzo Á, M., Gomes, R.A.F., Clavel, M.A., Pibarot, P., Biondi-Zoccai, G., Zhigalov, K., Weymann, A., Ruhparwar, A. and Lima, R.C. (2020). Calcific Aortic Valve Stenosis and Atherosclerotic Calcification. Current atherosclerosis reports 22: 2.
Dweck, M.R., Boon, N.A. and Newby, D.E. (2012). Calcific aortic stenosis: a disease of the valve and the myocardium. Journal of the American College of Cardiology 60: 1854–1863.
Rajamannan, N.M., Evans, F.J., Aikawa, E., Grande-Allen, K.J., Demer, L.L., Heistad, D.D., Simmons, C.A., Masters, K.S., Mathieu, P. and O'Brien, K.D. (2011). Calcific aortic valve disease: not simply a degenerative process a review and agenda for research from the National Heart and Lung and Blood Institute Aortic Stenosis Working Group. Circulation 124: 1783.
Beppu, S., Suzuki, S., Matsuda, H., Ohmori, F., Nagata, S. and Miyatake, K. (1993). Rapidity of progression of aortic stenosis in patients with congenital bicuspid aortic valves. The American journal of cardiology 71: 322–327.
Aronow, W.S., Ahn, C., Kronzon, I. and Goldman, M.E. (2001). Association of coronary risk factors and use of statins with progression of mild valvular aortic stenosis in older persons. American Journal of Cardiology 88: 693–695.
Mohammadi-Noori, E., Salehi, N., Mozafari, H., Elieh Ali Komi, D., Saidi, M., Bahrehmand, F., Vaisi-Raygani, A., Elahirad, S., Moini, A. and Kiani, A. (2020). Association of AHSG gene polymorphisms with serum Fetuin-A levels in individuals with cardiovascular calcification in west of Iran. Molecular biology reports 47: 1809–1820.
Bossé, Y., Mathieu, P. and Pibarot, P. (2008). Genomics: the next step to elucidate the etiology of calcific aortic valve stenosis. Journal of the American College of Cardiology 51: 1327–1336.
Yutzey, K.E., Demer, L.L., Body, S.C., Huggins, G.S., Towler, D.A., Giachelli, C.M., Hofmann-Bowman, M.A., Mortlock, D.P., Rogers, M.B. and Sadeghi, M.M. (2014). Calcific aortic valve disease: a consensus summary from the Alliance of Investigators on Calcific Aortic Valve Disease. Arteriosclerosis, thrombosis, and vascular biology 34: 2387–2393.
Grimard, B.H. and Larson, J.M. (2008). Aortic stenosis: diagnosis and treatment. American family physician 78: 717–724.
van Rijk-Zwikker, G.L., Delemarre, B.J. and Huysmans, H.A. (1994). Mitral valve anatomy and morphology: relevance to mitral valve replacement and valve reconstruction, pp255-261, Wiley Online Library.
Najafi, K., Komi, D.E.A., Khazaie, H., Moini, A., Vaisi, A., Raygani, Ahmadi, H.R., Ghadami, M.R. and Kiani, A. (2019). Investigation of Serum Levels and Activity of Matrix Metalloproteinases 2 and 9 (MMP2, 9) in Opioid and Methamphetamine-Dependent Patients %J Acta Medica Iranica. 56: 559–562.
Elieh Ali Komi, D. and Bjermer, L. (2019). Mast Cell-Mediated Orchestration of the Immune Responses in Human Allergic Asthma: Current Insights. Clinical reviews in allergy & immunology 56: 234–247.
Rajamannan, N.M. (2010). Mechanisms of aortic valve calcification: the LDL-density-radius theory: a translation from cell signaling to physiology. American Journal of Physiology-Heart and Circulatory Physiology 298: H5-H15.
Komi, D.E.A., Khomtchouk, K. and Santa Maria, P.L. (2020). A Review of the Contribution of Mast Cells in Wound Healing: Involved Molecular and Cellular Mechanisms. Clinical reviews in allergy & immunology 58: 298–312.
Rao, V.H., Lees, G.E., Kashtan, C.E., Nemori, R., Singh, R.K., Meehan, D.T., Rodgers, K., Berridge, B.R., Bhattacharya, G. and Cosgrove, D. (2003). Increased expression of MMP-2, MMP-9 (type IV collagenases/gelatinases), and MT1-MMP in canine X-linked Alport syndrome (XLAS). Kidney international 63: 1736–1748.
Komi, D.E.A. and Redegeld, F.A. (2020). Role of Mast Cells in Shaping the Tumor Microenvironment. Clinical reviews in allergy & immunology 58: 313–325.
Mirabdaly, S., Elieh Ali Komi, D., Shakiba, Y., Moini, A. and Kiani, A. (2020). Effects of temozolomide on U87MG glioblastoma cell expression of CXCR4, MMP2, MMP9, VEGF, anti-proliferatory cytotoxic and apoptotic properties. Molecular biology reports 47: 1187–1197.
Radunovic, M., Nikolic, N., Milenkovic, S., Tomanovic, N., Boricic, I., Dimitrijevic, M., Novakovic, I. and Basta-Jovanovic, G. (2016). The MMP-2 and MMP-9 promoter polymorphisms and susceptibility to salivary gland cancer. J BUON 21: 597–602.
Singh, K., Agrawal, N.K., Gupta, S.K. and Singh, K. (2013). A functional single nucleotide polymorphism-1562C > T in the matrix metalloproteinase-9 promoter is associated with type 2 diabetes and diabetic foot ulcers. The international journal of lower extremity wounds 12: 199–204.
Habel, A.F., Ghali, R.M., Bouaziz, H., Daldoul, A., Hadj-Ahmed, M., Mokrani, A., Zaied, S., Hechiche, M., Rahal, K. and Yacoubi-Loueslati, B. (2019). Common matrix metalloproteinase-2 gene variants and altered susceptibility to breast cancer and associated features in Tunisian women. Tumor Biology 41: 1010428319845749.
Roncevic, J., Djoric, I., Selemetjev, S., Jankovic, J., Dencic, T.I., Bozic, V. and Cvejic, D. (2019). MMP-9-1562 C/T single nucleotide polymorphism associates with increased MMP-9 level and activity during papillary thyroid carcinoma progression. Pathology 51: 55–61.
Chacon Cortes, D.F. and Griffiths, L. (2014). Methods for extracting genomic DNA from whole blood samples: current perspectives. Journal of Biorepository Science for Applied Medicine 2014: 1–9.
Elieh Ali Komi, D., Sadeghi-Shabestari, M., Shanebandi, D., Babaloo, Z., Razavi, A., Sadigh-Eteghad, S. and Kazemi, T. (2019). Investigation of chitinase3like-1 (Chiti3L1) gene polymorphism (rs4950928) with susceptibility to allergic asthma in Iranian Northwestern Azeri population. Research in Molecular Medicine 7: 17–24.
Aslanian-Kalkhoran, L., Elieh-Ali-Komi, D., Sadeghi-Shabestari, M., Shanebandi, D., Babaloo, Z., Razavi, A., Sadigh-Eteghad, S. and Kazemi, T. (2017). Investigation of Fc Receptor-Like 3 (FCRL-3) Gene Polymorphism (rs7528684) with Susceptibility to Allergic Asthma in Iranian North-Western Azeri Population. Clinical Laboratory 63: 1301–1305.
Rybakowski, J.K. (2009). Matrix metalloproteinase-9 (MMP9)—a mediating enzyme in cardiovascular disease, cancer, and neuropsychiatric disorders. Cardiovascular psychiatry and neurology 2009.
Fanjul-Fernández, M., Folgueras, A.R., Cabrera, S. and López-Otín, C. (2010). Matrix metalloproteinases: evolution, gene regulation and functional analysis in mouse models. Biochimica et Biophysica Acta (BBA)-Molecular Cell Research 1803: 3–19.
Wågsäter, D., Zhu, C., Björkegren, J., Skogsberg, J. and Eriksson, P. (2011). MMP-2 and MMP-9 are prominent matrix metalloproteinases during atherosclerosis development in the Ldlr-/-Apob100/100 mouse. International journal of molecular medicine 28: 247–253.
Soliman, A.R., Sadek, K.M., Thabet, K.K., Ahmed, D.H. and Mohamed, O.M. (2019). The role of matrix metalloproteinases 2 in atherosclerosis of patients with chronic kidney disease in type 2 diabetes. Saudi Journal of Kidney Diseases and Transplantation 30: 387.
Qin, X., Corriere, M.A., Matrisian, L.M. and Guzman, R.J. (2006). Matrix metalloproteinase inhibition attenuates aortic calcification. Arteriosclerosis, thrombosis, and vascular biology 26: 1510–1516.
Liu, R., Chen, B., Chen, J. and Lan, J. (2018). Leptin upregulates smooth muscle cell expression of MMP–9 to promote plaque destabilization by activating AP–1 via the leptin receptor/MAPK/ERK signaling pathways. Experimental and Therapeutic Medicine 16: 5327–5333.
Kieffer, P., Giummelly, P., Schjoth, B., Carteaux, J.P., Villemot, J.P., Hornebeck, W. and Atkinson, J. (2001). Activation of metalloproteinase-2, loss of matrix scleroprotein content and coronary artery calcification. Atherosclerosis 157: 251–254.
Chen, N.X., O’Neill, K.D., Chen, X., Kiattisunthorn, K., Gattone, V.H. and Moe, S.M. (2011). Activation of arterial matrix metalloproteinases leads to vascular calcification in chronic kidney disease. American journal of nephrology 34: 211–219.
Hua, Y., Song, L., Wu, N., Xie, G., Lu, X., Fan, X., Meng, X., Gu, D. and Yang, Y. (2009). Polymorphisms of MMP-2 gene are associated with systolic heart failure prognosis. Clinica Chimica Acta 404: 119–123.
Chang, Y.-H., Lin, I.-L., Tsay, G.J., Yang, S.-C., Yang, T.-P., Ho, K.-T., Hsu, T.-C. and Shiau, M.-Y. (2008). Elevated circulatory MMP-2 and MMP-9 levels and activities in patients with rheumatoid arthritis and systemic lupus erythematosus. Clinical biochemistry 41: 955–959.
Bahrehmand, F., Vaisi-Raygani, A., Ahmadi, R., Kiani, A., Rahimi, Z., Tavilani, H. and Pourmotabbed, T. (2013). Paraoxonase (PON1) 55 polymorphism and association with systemic lupus erythematosus. Iranian Journal of Allergy, Asthma and Immunology: 211–219?
Zhang, B., Henney, A., Eriksson, P., Hamsten, A., Watkins, H. and Ye, S. (1999). Genetic variation at the matrix metalloproteinase-9 locus on chromosome 20q12. 2–13.1. Human genetics 105: 418–423.
Wang, L., Ma, Y.-t., Xie, X., Yang, Y.-n., Fu, Z.-y., Liu, F., Li, X.-m. and Chen, B.-d. (2011). Association of MMP-9 gene polymorphisms with acute coronary syndrome in the Uygur population of China. World Journal of Emergency Medicine 2: 104.
Zhen, G.-D., Zhao, L.-B., Wu, S.-S., Chen, M.-Y., Li, Z.-H., Zhou, S.-Z. and Li, Z.-F. (2017). Associations of MMP-2 and MMP-9 gene polymorphism with ulinastatin efficacy in patients with severe acute pancreatitis. Bioscience Reports 37.
Rollin, J., Régina, S., Vourc’h, P., Iochmann, S., Bléchet, C., Reverdiau, P. and Gruel, Y. (2007). Influence of MMP-2 and MMP-9 promoter polymorphisms on gene expression and clinical outcome of non-small cell lung cancer. Lung cancer 56: 273–280.
Saedi, M., Vaisi-Raygani, A., Khaghani, S., Shariftabrizi, A., Rezaie, M., Pasalar, P., Rahimi, Z. and Pourmotabbed, T. (2012). Matrix metalloproteinas-9 functional promoter polymorphism 1562C > T increased risk of early-onset coronary artery disease. Molecular biology reports 39: 555–562.
Elahirad, S., Elieh Ali Komi, D., Kiani, A., Mohammadi-Noori, E., Vaisi–Raygani, A., Mozafari, H., Bahrehmand, F., Saidi, M., Toupchi-Khosroshahi, V. and Salehi, N. (2022). Association of Matrix Metalloproteinase-2 (MMP-2) and MMP-9 Promoter Polymorphisms, Their Serum Levels, and Activities with Coronary Artery Calcification (CAC) in an Iranian Population. Cardiovascular toxicology 22: 118–129.
Komi, D.E.A. and Redegeld, F.A. (2020). Role of mast cells in shaping the tumor microenvironment. Clinical reviews in allergy & immunology 58: 313–325.
Reynolds, J. (1996). Collagenases and tissue inhibitors of metalloproteinases: a functional balance in tissue degradation. Oral diseases 2: 70–76.
Elieh Ali Komi, D. and Bjermer, L. (2019). Mast cell-mediated orchestration of the immune responses in human allergic asthma: current insights. Clinical reviews in allergy & immunology 56: 234–247.

Table 1. Comparison of demographic data and mean values of biochemical and clinical data between patient and control groups

p-value	Patient group	Control group	Parameters
P=0.07	19.3± 28.24	24.2± 02.25	BMI (kg.m²)
001.0>P	26.150 ± 16.4	44.56 ± 05.1	MMP-9 (ng/ml)
0.06= P	71.28 ± 121	45.21 ± 100	MMP-2(ng/ml)
001.0>P	73.18904 ± 00463	1.11274 ± 00981	MMP-9 activity
001.0>P	25.8223 ± 00012	3.5153 ± 00251	MMP-2 activity
001.0>P	78.23 ± 90.101	88.6 ± 09.92	FBS (mg/dL)
32.0P=	40.46 ± 65.163	78.26± 13.158	Total Cholesterol (mg/dL)
09.0P=	09.51± 88.127	45.22±118	Triglyceride (mg/dL)
01.0=‍P	67.44 ± 01.95	71.24 ± 33.81	LDL-C (mg/dL)
001.0P<	25.7±23.44	15.11±66.54	HDL-C (mg/dL)
001.0P<	93.6 ± 97.34	52.5 ± 92.27	Urea (mg/dL)
P= 01.0	18.0 ± 96.0	15.0 ± 90.0	Creatinine (mg/dL)
001.0P<	63.0 ± 99.7	35.1 ± 95.8	Calcium (mg/dL)
001.0P<	76.0 ± 80.4	35.0 ± 25.4	Phosphorus (mg/dL)
001.0P<	54.18 ± 55.125	22.8 ± 18.108	SBP (mmHg)
001.0P<	60.10 ± 89.78	25.5 ± 71.71	DBP (mmHg)

Values are written as mean ± SD or n (%) DM diabetes mellitus; BMI body mass index; FBS fasting blood sugar; HDL high-density lipoprotein cholesterol; LDL low-density lipoprotein cholesterol; SBP systolic blood pressure; DBP diastolic blood pressure; MMP-9 matrix metalloproteinase-9; MMP-2 matrix metalloproteinase-2 P < 0.05 was considered statistically significant

Table 2. Distribution of genotypic and allelic frequencies of MMP-9 genotypes and MMP-2 genotypes between studied groups

OR (95%CI, p-value)	Patient n (%)			Control n (%)	Polymorphism
MMP-9 genotypes
	(62%)57n=			(6%.82)76n=	CC
	(8%.34)32n=			(2%.15)14n=	CT
	(2%.3)3n=			(2%.2)2n=	TT
		P = 0.007 2χ=9.95 df= 2
	(62%)57n=			(6%.82)76n=	CC
1.69 (1.15 – 2.40)	(38%)35n=			(4%.17)16n=	CT+TT
	P = 0.002 2χ= 9.79 df = 1
Alleles
	n = 57(% 62)			n = 87(94.6)	C
	n = 35(38%)			(%4.5) n=5	T
3.22 (1.94 – 5.33)		P<0.001 2χ= 28.75 df = 1
MMP-2 genotypes
	(%6.57) 53n =			(%2.77) 71 n =	GG
	n =38(41.3 %)			(%5.18) 17n =	GA
	n =1(1.1 %)			(%3.4) 4n =	AA
		P=0.002 2χ= 43.12 df=2
	(%6.57) 53n =		(%2.77) 71 n =	GG
1.35(0.95- 1.92)	n =39(1.1 %)			(9.29 ) 21n =	GA+AA
		P = 0.005 2χ=8.01 df = 1
Alleles
	(%6.57) 53n =			(%4.92) 85n =	G
	n =39(42.4 %)			(%6.7 ) 7n =	A
2.81(1.80-4.38)		P<0.001 2χ=29.68 df =1

Distributing alleles and genotype frequency of MMP-2 and MMP-9 in patient group in comparison to the control group was done using simple and multiple logistic regressions. OR: odds ratio with its 95% CI, P-value* is based on multiple logistic regression for adjusting DM, FBS, Urea, Creatinine, HDL, Calcium, SBP, and DBP. P-value < 0.05 was considered significant

Table 3. Comparison of different parameters between the control and patient groups with respect to MMP2 genotypes

p-values	Patient group GA+AA	Control group GA+AA	p-values	Patient group GG	Control group GG	Parameters
0.07	15.3 ± 87.23	05.2 ± 26.25	47.0	22.3 ± 59.24	31.2 ± 95.24	BMI (kg.m²)
<0.001	96.146 ± 33.407	17. 12± 59.93	001.0>	44.150 ± E259.3	99. 55± 110	MMP-9 (ng/ml)
<0.001	11.26 ± 12.190	80. 30± 28.118	001.0>	37.29 ± E288.1	69. 31± E2 15.1	MMP-2 (ng/ml)
0.004	84.20111 ± 343000	821000±15082.71	001.0>	87.19381 ± E451.3	757.11721 ± E405.2	MMP-2 activity
0.05	40.29953 ±392000	20.3154 ± 101000	09.0	23.36374 ± E446.2	12.24743 ± E453.1	MMP-9 activity
0.08	05.22 ±5 .101	30. 7± 76.92	001.0	18.25 ±1.102	79. 6± 90.91	FBS (mg/dL)
0.53	14.44 ± 48.160	54.24 ± 167	12.0	28.48 ± 65.1	02.27 ± 155	Total Cholesterol (mg/dL)
0.80	22.48 ± 87.121	76.18 ± 09.119	04.0	12.53 ± 132	54.23 ± 117	Triglyceride (mg/dL)
0.83	71.46 ± 73.92	38. 20± 47.90	004.0	48.43 ± 68.96	35. 25± 62.78	HDL-C (mg/dL)
0.02	28.7 ± 15.44	02.8 ± 85.48	001.0>	29.7 ± 30.44	41.11 ± 38.56	LDL-C (mg/dL)
<0.001	29.6± 64.35	06.5 ± 71.28	001.0>	38.7± 49.34	67.5 ± 69.27	Urea (mg/dL)
0.01	18.0 ± 98.0	15.0 ±86.0	23.0	18.0 ± 95.0	16.0 ±91.0	Creatinine (mg/dL)
<0.001	72.0±07.8	06.1 ± 07.9	001.0>	54.0±93.7	43.1 ± 92.8	Calcium (mg/dL)
<0.001	49.0 ± 82.4	47.0 ± 10.4	001.0>	91.0 ± 78.4	30.0 ± 29.4	Phosphorus (mg/dL)
0.01	02.20 ± 76.124	89.5±33.113	001.0>	54.17 ± 126	22.8±106	SBP (mmHg)
0.009	60.11 ±51.78	59.5 ± 23.71	001.0>	91.9 ±16.79	18.5 ± 85.71	DBP (mmHg)

A t-test was applied for calculating the correlation values of serum biochemical parameters with MMP-2 polymorphism (rs243866) between patients and controls BMI body mass index; FBS fasting blood sugar; HDL high-density lipoprotein cholesterol; LDL low-density lipoprotein cholesterol; SBP systolic blood pressure; DBP diastolic blood pressure; MMP-9 matrix metalloproteinase-9; MMP-2 matrix metalloproteinase-2 A P < 0.05 was considered statistically significant.

Table 4. Comparison of different parameters between the control and patient groups with respect to MMP-9 genotypes

p-values	Patient group CT+TT	Control group CT+TT	p-values	Patient group CC	Control group CC	Parameters
0.25	03.3 ± 86.23	22.2 ± 84.24	28.0	29.3 ± 54.24	26.2 ± 06.25	BMI (kg.m²)
<0.001	84.148 ± 61.397	04. 45± 03.141	001.0>	04.151 ± 16.369	59. 21± 05.99	MMP-9 (ng/ml)
<0.001	68.29 ± 71.185	78. 34± 87.116	001.0>	81.26 ± 10.191	82. 30± 98.115	MMP-2 (ng/ml)
0.04	11.20144 ±40600	87.13199 ±29000	001.0>	47.18406 ±30600	88.11578 ±18100	MMP-9 activity
0.49	88.43747 ±26100	41.27333 ±17900	01.0	60.25927 ±23200	63.20624 ±13600	MMP-2 activity
0.06	29.20 ±4 .99	99. 5± 68.89	001.0	75.25 ±3 .103	98. 6± 60.92	FBS (mg/dL)
0.99	46.33 ± 54.158	46.33 ± 68.158	17.0	85.47 ± 78.166	42.25 ± 01.158	Total Cholesterol (mg/dL)
0.95	23.34 ± 74.117	10.26 ± 18.117	03.0	54.58 ± 10.134	80.21 ± 17.118	Triglyceride (mg/dL)
0.14	27.41 ± 98.93	36. 25± 36.77	03.0	98.46 ± 64.95	66. 24± 16.82	LDL-C (mg/dL)
<0.001	95.6 ± 25.45	35.11 ± 93.55	001.0>	42.7 ± 61.43	17.11 ± 39.54	HDL-C (mg/dL)
0.003	70.6± 80.33	37.4 ± 12.28	001.0>	02.7± 70.35	76.5 ± 88.27	Urea (mg/dL)
0.12	18.0 ± 97.0	20.0 ±88 .0	05.0	18.0 ± 96.0	15.0 ±90 .0	Creatinine (mg/dL)
0.68	57.0± 8	84.1 ± 14.8	001.0>	66.0±98.7	17.1 ± 12.9	Calcium (mg/dL)
<0.001	42.0 ± 76.4	28.0 ± 32.4	001.0>	91.0 ± 82.4	37.0 ± 23.4	Phosphorus (mg/dL)
0.01	76.20 ± 74.122	13.7±12 .109	001.0>	17 ± 28.127	46.8±98.107	SBP (mmHg)
0.31	59.10 ±77.76	08.4 ± 74	001.0>	49.10 ±19.80	37.5 ± 23.71	DBP (mmHg)

A t-test was applied for calculating the correlation values of serum biochemical parameters with MMP-9 polymorphism between patients and controls BMI body mass index; FBS fasting blood sugar; HDL high-density lipoprotein cholesterol; LDL low-density lipoprotein cholesterol; SBP systolic blood pressure; DBP diastolic blood pressure; MMP-9 matrix metalloproteinase-9; MMP-2 matrix metalloproteinase-2 A P < 0.05 was considered statistically significant

Table 5. Correlations among MMP-2 and MMP-9 levels with different biochemical and clinical parameters in the patient and control groups separately

	MMP-9 level (r*)		MMP-2 level (r*)	Parameters
Patient group	Control group	Patient group	Control group
r=0.031 P=0.770	r=-0.108 P=0.306	r=0.095 P=0.368	r = 0.191 P=0.068	FBS (mg/dL)
r=-0.114 P=0.279	r=-0.110 P=0.296	r=-0.011 P=0.914	r= -0.219 P=00.036	Urea (mg/dL)
r=0.027 P=0.796	r=-0.215 P=0.040	r=0.186 P=0.076	r=-0.122 P=0.246	Creatinine (mg/dL)
r=0.173 P=0.099	r=-0.017 P=0.875	r=0.039 P=0.715	r=0.039 P=0.715	Total Cholesterol (mg/dL)
r=-0.035 P=0.743	r=0.097 P=0.357	r=-0.035 P=0.740	r=-0.035 P=0.740	Triglyceride (mg/dL)
r=0.036 P=0.732	r=0.147 P=0.163	r=0.005 P=0.964	r=-0.055 P=0.606	HDL-C (mg/dL)
r=0.054 P=0.610	r=0.060 P=0.280	r=0.063 P=0.552	r=0.063 P=0.552	SBP (mmHg)
r=-0.079 P=0.455	r=0.012 P=0.907	r=-0.022 P=0.836	r=-0.022 P=0.836	DBP (mmHg)

*Pearson correlation coefficient

FBS fasting blood sugar; HDL high-density lipoprotein cholesterol; SBP systolic blood pressure; DBP diastolic blood pressure; MMP-9 matrix metalloproteinase-9; MMP-2 matrix metalloproteinase-2

A P < 0.05 was considered statistically significant

No competing interests reported.

Download PDF

Journal Publication

published 06 May, 2024

Read the published version in Genetic Testing and Molecular Biomarkers →

Version 1

posted

You are reading this latest preprint version

Association of Matrix Metalloproteinase-2 (MMP‑2) and MMP‑9 Promoter Variants, their Serum Levels, and Activities with Aortic Valve Calcification (AVC) in a Population from Western Iran

Status:

Journal Publication

Version 1

Abstract

Figures

1. Introduction

2. Methods

3. Results

4. Discussion

5. Conclusion

Abbreviations

Declarations

References

Tables

Additional Declarations

Status:

Journal Publication

Version 1