MHE models and treatments
A total of 40 Sprague-Dawley rats (experimental animal center of the Chinese Academy of Sciences in Shanghai) weighing 220-250 g were used. All experiments were carried out in accordance with the guidelines laid down by the Ethics Committee of the First Affiliated Hospital of Wenzhou Medical University regarding the care and use of animals for experimental procedures. Before experimentation, all animals underwent two behavioral tests: Y-maze (YM) and water-finding task (WFT). Normal values for these behavioral tests were obtained. Rats were then randomly divided into two groups: a control group (n=20) and a thioacetamide (TAA) treated group (n=30). Liver cirrhosis was induced by intraperitoneal injection (i.p.) of TAA (200 mg/kg in normal saline, Sigma-Aldrich) twice per week for 8 weeks. TAA-treated rats were diagnosed as hepatic encephalopathy (HE) based on the following symptoms: later development of decreased motor activity, lethargy, and eventual progression to coma. TAA-treated rats with no HE symptoms were subjected again to behavioral tests to confirm whether MHE had developed. If TAA-treated rats met the alternative criteria for MHE as follows, they were included in the MHE group: a) values of YM lower than mean ± 1.96·SD; b) values of WFT higher than mean ± 1.96·SD 19. For Thrombopoietin receptor agonist eltrombopag (ELT, Selleck Chemicals #S2229) administration, MHE rats were conducted oral administration (0,5,25mg/kg).
YM test
Rats were individually placed at the end of an arm and allowed to explore the maze freely for 8 min. Total arm entries and spontaneous alternation percentage (SA%) were measured. SA% was defined as the ratio of arm choices that differed from the previous two choices (‘successful choices’) to total choices during the run (‘total entry minus two’, because those two entries could not be evaluated) 20.
WFT test
A rat was placed at the near-right corner of the apparatus and allowed to explore it freely for 3 min. Rats were omitted from the analysis when they could not find the tube within the 3-min exploration. After the training session, rats were deprived of water for 24 h. In the trial session, rats were again individually placed at the same corner of the apparatus and allowed to find and drink the water in the alcove. The elapsed times until the entry into the alcove (entry latency, EL), until the touching/sniffing/licking of the water tube (contacting latency, CL) and until the initiation of drinking from the water tube (drinking latency, DL) were measured 21.
Primary hippocampal neurons (PHNs) culture and treatments
The hippocampus was dissected from 14 d gestation Sprague-Dawley rat embryos and placed in ice cold Hank’s buffered salt solution (HBSS). Tissues were incubated with 0.25% trypsin in HBSS for 5 min in 37 °C/5% CO2. Cells were dissociated by trituration through a glass Pasteur pipet and then passed through a 70 µm cell strainer (Falcon 352350). Cells were plated at a density of 200,000 cells/well onto poly-D-lysine/laminin-coated 8-well chamber slides in DMEM + 10% HIFBS +1% glutamine +1% Pen-Strep and incubated for 2 h. The medium was aspirated after 2 h and then replaced with selection medium (DMEM +2.75% SATO serum +1% glutamine+1% Pen-Strep) as described. Cultures were incubated in the selection medium for 5 days, and the medium was changed daily to remove dead cells.
Then cells were pre-treated with HIF1α antagonist YC-1 (10μM), HIF1α agonist DMOG (0.5 mM), GSK3β antagonist LiCl (1 mM), Sirt1 agonist resveratrol (100 μM), or Sirt1 antagonist nicotinamide (NAM, 3mM) alone or after preincubation with three concentrations of ELT (0, 6.25, 12.5 and 25 μM). After the preincubation period, the cells were stimulated with 100 nM insulin in the presence of normal (5.5mM) or high (30mM) concentration of D-glucose for 24 h.
Assessment of insulin resistance
To induce insulin resistance, primary hippocampal neurons (PHNs) were starved in serum-free DMEM medium with 0.5% (w/v) bovine serum albumin (BSA) for 3 h and pre-treated with normal (5.5mM) or high (30mM) concentration of D-glucose in 10% fetal bovine serum (FBS) DMEM. To evaluate insulin resistance, 3H-2-DG radioactivity taken up by the cells was determined by a scintillation counter. high D-glucose –treated cells showed a significantly lower radioactivity than normal D-glucose -treated cells and were considered to be insulin resistant. These insulin-resistant cells were used for the following experiments.
3H-2-DG uptake measurement
This assay was performed using a modified version of a previously described protocol [10]. Briefly, insulin-resistant cells were starved in serum-free, 0.5% (w/v) BSA DMEM for 3 h before treatment. To confirm insulin resistance, 100 nM insulin was added to the medium for 30 min and then the radioactivity of 3H-2-DG taken up by the cells was determined. To investigate the effects of ELT on glucose uptake or insulin-stimulated glucose uptake, various concentrations of ELT were added to the medium alone or followed by 100 nM insulin for 30 min. To determine the involvement of the HIF1α/GSK3β/Sirt1 pathway, the 10μM YC-1, 0.5mM DMOG, 1mM LiCl, 100μM resveratrol or 3mM NAM was added to the medium 30 min before ELT treatment, respectively. After washing three times with Krebs–Ringer phosphate buffer (KRP, 1.32 mM NaCl, 4.71 mM KCl2, 47 mM CaCl2, 1.24 mM MgSO4, 2.48 mM Na3PO4, and 10 mM HEPES (pH 7.4)), a final concentration of 1 μCi/ml 3H-2-DG was added to the cells. The medium was aspirated 10 min later, and the cells were washed three times with icecold KRP to terminate the reaction. Next, the cells were lysed with 0.1 N NaOH, and the radioactivity taken up by the cells was determined using a scintillation counter (LS 6500, Beckman Instruments, Fullerton, CA, USA). Nonspecific glucose uptake was measured by subtracting values for 3H-2-DG in the presence of 100 nM cytochalasin B.
Detection of fasting glucose and insulin levels
After the behavior tests, the rats fasted for 12 h, 3 ml of blood samples were collected from each rat and centrifuged at 1200×g, 15min to abtain the serum. The fasting blood glucose levels were determined by a glucose-oxidase biochemistry analyzer and fasting insulin levels were measured by homogeneous phase competitive immunoradiometric assay with an immunoreagent kit using a GC-911c immunoradiometric counter (Enterprises Group of USTC, Hefei, China). The homeostasis model of insulin resistance (HOMA-IR) was calculated using the formula: [fasting glucose (mmol/l) × fasting insulin (IU/mL)]/22.5.
Dendritic spine density analysis in primary neurons
Neural dendritic spine analysis was performed by immunocytochemistry with anti-microtubule-associated protein 2B (anti-MAP2B) and anti-vesicular glutamate transporter 1 antibodies. After fixation, neurons were incubated with primary antibodies anti-MAP2B (MAP2B; 1:200; BD Transduction Laboratories, San Jose, CA, USA) and anti-vesicular glutamate transporter 1 (vGlut1; 1:100; Neuromab, Davis, CA, USA) overnight at 4°C. Cells were then washed with PBS, incubated with secondary antibody conjugated with AlexaFluor conjugates (1:500; Life Technologies, Waltham, MA, USA) for one hour at room temperature, and coverslipped. A Z stack of optical section was visualized on a confocal laser scanning microscope (FV10i-w, Olympus, Tokyo, Japan). At least 10 cultured neurons from 2 batches of cultures per group were used for quantitative analysis.
Functional labeling of presynaptic boutons with FM4-64
FM4-64 staining (Invitrogen) was performed according to the manufacturer’s instructions. Briefly, primary neurons were incubated with 5 mg/mL FM4-64 (Invitrogen) and 50 mM KCl in HBSS for 1 min at 4°C, and washed with HBSS to remove free FM4-64.
Reverse transcription-polymerase chain reaction (RT-PCR) and Quantitative Real-time PCR (qPCR)
Total RNA was isolated using the Qiagen RNeasy kit (Hilden, Germany) according to the manufacturer’s protocol. cDNA was created using oligo (dT), dNTP, 0.1 M DTT, Moloney murine leukemia virus reverse transcriptase, RNaseOUT, and 5× FS Buffer (all from Invitrogen). For RT-PCR, cDNA was amplified with PCR Master Mix (Promega, Madison, WI, USA). Amplified products were electrophoresed on 2% agarose gels, visualized by EtBr staining, and normalized to GAPDH. For qPCR, mRNA expression was measured by quantitative PCR using SYBR Premix ExTaq and an MX3000 instrument. PCR was performed in a reaction that included 5 μl 2× PCR master mix, 0.5 μl forward primer (10 μM), 0.5 μl reverse primer (10 μM), 2 μl cDNA. The qPCR condition was as follows: an initial denaturation step of 10 min at 95°C; 40 cycles of 95°C for 10 s, 60°C for 60 s, and 95°C for 15 s; and a final step of slow heating from 60°C to 99°C. All samples were normalized to GAPDH to calculate relative mRNA concentrations.
The primers (Invitrogen) for the murine genes were as follows:
TPO,5′GGTGGACTTCCTCCTTCTCC3′(Forward) and 5′TCGCTAGCTGCTCTGATGAA3′(Reverse); MPL,5′CCTACTGCTGCTAAAGTGGCAA3′(Forward) and 5′CAATAGCTTAGTGGTAGGTAGGA3′(Reverse); HIF1α, 5′CGTTCCTTCGATCAGTTGTC3′ (Forward) and 5′TCAGTGGTGGCAGTGGTAGT3′ (Reverse); Sirt1, 5′GCCATCGCAAACTTGAACCACC3′ (Forward) and 5′CGTCCGCCA TCTTCCAACTGC3′ (Reverse); GSK3β, 5′GACGTCCGTGATTGGCTC3′ (Forward) and 5′AGCCCAGAGCCCTGTCAG3′ (Reverse); Synaptotagmin, 5′CGGCAAACT GACTGTCATTC3′ (Forward) and 5′GCCCCAGTGCTGTTGTAACCA3′ (Reverse); neuroligin1, 5′TGCCATCAACAGACATCACTC3′ (Forward) and 5′TCTACCGAGAAGGGACTTGG3′ (Reverse).
Immunoblotting
Cerebral cortex tissues or PHNs were harvested in a lysis buffer (Sigma-Aldrich). Samples (50 μg protein) were separated by SDS-polyacrylamide gel electrophoresis (PAGE) and electroblotted to PVDF membrane, which was blocked by incubation in 5% non-fat dry milk dissolved in tris buffered saline-Tween (TBS-T) (150 mM NaCl, 50 mM Tris, 0.05% Tween 20). Following transfer, proteins were probed using a primary antibody: MPL, TPO, HIF1α, HIF1β, GSK3β, pGSK3β, Sirt1, synaptotagmin, neuroligin1, GDNF, PDGF and β-actin (Santa Cruz, CA, USA). Then horseradish peroxidase-conjugated anti-rabbit secondary antibody was used to detect the primary antibodies. After extensive washing, protein bands detected by antibodies were visualized by ECL reagent (Pierce, Rockford, IL, USA) after exposure on Kodak BioMax film (Kodak).
Immunofluorescence staining, immunohistochemistry and cytochemistry
Frozen brain sections or PHNs cultured on glass coverslips were fixed with 4% paraformaldehyde and then treated with 0.1% Triton X-100 at room temperature. Blocking was with PBS containing 5% normal goat serum for 1 h at room temperature. Sections were then incubated overnight at 4°C with the following primary antibodies: HIF1α, GSK3Β, pGSK3β, Sirt1, synaptotagmin, neuroligin1, tyrosine hydroxylase (TH) (Abcam, Cambridge, MA, USA). Binding of primary antibodies was detected by incubating the sections for 30 min with Alexa Fluor 488 (green)/Alexa Fluor 594 (red) conjugated secondary antibodies (Abcam).
Statistical analysis
All of the data were expressed as mean ± SD. Data comparisons were analyzed using one-way analysis of variance (ANOVA). All of the data were tested in normal distribution and equal variances, when Back-of-the-envelope test was used to verify the normal distribution, and F-test was applied for determining the equality of variances. Dunnett’s post hoc multiple comparison test was applied when significant differences were determined by the ANOVA model. Then P values were made for adjustment by Bonferroni correction. The level of significance was determined by P < 0.05 or P < 0.01. All analyses were performed with SPSS 18.0 (PASW Statistics 18.0).