Novel biomimetic mesoporous silica nanoparticles system possessed targetability and immune synergy to promote solid tumor immuno- chemotherapy efficacy

doi:10.21203/rs.3.rs-1531920/v1

Download PDF

Research Article

Novel biomimetic mesoporous silica nanoparticles system possessed targetability and immune synergy to promote solid tumor immuno- chemotherapy efficacy

https://doi.org/10.21203/rs.3.rs-1531920/v1

This work is licensed under a CC BY 4.0 License

Version 1

posted

You are reading this latest preprint version

New strategies enhancing both targetability of chemotherapy drugs and synergistic effects of chemotherapy and immunotherapy remain a major challenge for the solid tumor therapy. In this research, a novel biomimetic nanoparticle system possessed function of tumor targeting and immune synergy was designed to accomplish the above requirements. The membranes was coated on mesoporous silica nanoparticles loaded with chemotherapy drugs named doxorubicin (DOX); and it was modified by the glycosyl-phosphatidylinositol (GPI) anchored anti-HER2 single chain variable fragment (scFv) and the GPI anchored co-stimulatory molecule CD80 to promote solid tumor targeted chemotherapy and cooperated immunotherapy, respectively. The effects of as-prepared nano therapeutic system in both tumor targeted chemotherapy and collaborated cellular immune response were investigated through in vitro and in vivo experiments. The results showed that the novel biomimetic therapeutic system can significantly promote antitumor efficiency in vitro and in vivo experiments. Besides, this therapeutic system further enhances antitumor capacity by increasing the CD8⁺ T-cell activation and the cytokine production and reducing the myeloid-derived suppressor cells (MDSCs) levels in tumors.

breast tumors

biomimetic

tumor targetability

immunoregulation

mesoporous silica

CD80

immunotherapy

Immuno-chemotherapy is revolutionizing the management of multiple tumors, and accumulating data support a key role for the immune system in determining both response to chemotherapy and long-term survival in patients with tumors. Clinical trials have shown that the use of chimeric antigen receptor T cell adoptive immunotherapy for multiple hematologic malignancies significantly exceeds the current standard chemotherapy ^[1–7]. These data and the striking clinical success across multiple cancers have reignited interest in combined immune and chemical strategies for treatment.

The immune and chemical combination therapy of has achieved great success in the treatment of hematopoietic tumors; however, their efficacy in the treatment of solid tumors is limited. Traditional chemotherapy drugs cause severe systemic side effects due to lack of precise tumor targeting. Unlike the hematopoietic tumors, there is also an obstacle to the immuno-chemotherapy of solid tumors —— difficulties in depth of drug delivery. Additionally, solid tumors also induces some cytokines that inhibit T cell activation in microenvironments, resulting in the inhibition of normal function of T cells and it also promotes the differentiation and maturation of regulatory T cells and myeloid derived suppressor cells (MDSCs) ^[8–10]. Therefore, in order to improve the clinical effect of solid tumors immuno-chemotherapy, there are above challenges must be overcame, such as targetability of chemotherapy drugs and synergistic effects of cellular immune response ^[11–15].

In recent, biomimetic nanomaterials have received growing attention due to the excellent biological functions in the treatment of diseases, in particular, the strategies combining nanotechnology with immunotherapy and chemotherapy for the treatments of cancer ^[16]. Nanoparticles between 10 and 200 nm have excellent penetrability, can avoid 5 nm renal filtration, and can prolong their blood circulation, which will greatly increase the chances of these nanoparticles interacting with tumor tissue ^[17]. Additionally, in the competition experiments of two heterologous tumors, the biomimetic nanoparticles coated with tumor cell membranes had higher tumor selectivity in vivo ^{[18; 19]}. To date, cell membranes of several cells have been used to encapsulate modified biomimetic nanoparticles, including platelets, red blood cells, white blood cells, and mesenchymal stem cell membranes ^[20]. According to current research trends, cancer diagnosis and treatment are highly dependent on the realization of cancer cell-specific targeting, so cell membrane-coated nanoparticles have the potential to be applied to the targeting treatment ^[20].

In addition, current clinical efforts are focused on developing immuno-chemotherapy combinations that convert non-responders to responders, deepen those responses that do occur, and surmount acquired resistance to antitumor therapy. The costimulatory immune molecule, CD80, provided a costimulatory signal necessary for T cell activation and survival to increase immune response to tumor cells ^{[21; 22]}. Studies have shown that CD80 molecules abolished the immunosuppressive effects mediated by PDL1 molecules in tumor cells via fused to the Fc domain of IgG1 or blocked PDL122 expression on the cell surface ^[23–25]. It was transfected into mouse tumor cells, which can be recognized by T cells to produce an immune cell response that caused tumor regression in the tumor model ^[26]. Similarly, nanoparticles coated with cancer cell membrane expressing costimulatory marker CD80 can be used as antigen presenters. This biomimetic antigen-presenting nanoparticles provide the immune system with a signal to directly stimulate T cells without professional antigen-presenting cells, which effectively stimulates the activity of specific anti-cancer T cells and shows good anti-cancer effect in the animal model of melanoma ^[27].

In the present experiment, with the purpose of enhancing anti-tumor efficacy, a novel biomimetic immuno-chemotherapy composite nanoparticle was designed based on mesoporous silica nanoparticles (MSNs), loaded with a chemotherapy drug named doxorubicin (DOX) and coated by the modified cell membranes. The cell membrane was co-modified by GPI-anchored CD80 and human epidermal growth factor receptor 2 (HER2) single chain variable fragments (scFv) to promote immune synergistic response and chemotherapy targeting, respectively (Scheme 1). Finally, the novel biomimetic targeted-immuno-chemotherapy composite nanoparticle was applied to a classic solid tumor model —— breast tumors, and its antitumor efficiency were evaluated and verified by in vitro and in vivo researches.

2.1. Reagent

For protein quantify, BCA protein quantitation reagent kit (Beyotime, P0010S, Shanghai, China) was purchased from Beyotime Institute of Biotechnology, China. For western blotting, the first antibodies against β-actin (PA1-46296, Invitrogen), HA Tag Antibody (26183, Invitrogen), Flag Tag Antibody (PA1-984B, Invitrogen), Her2 Antibody (MA5-13105, Invitrogen), Granzyme B Antibody (MA1-80734, Invitrogen), Perforin Antibody (14-9392-82, Invitrogen) and TNF-α Antibody (ARC3012, Invitrogen) and goat anti-Rabbit IgG (H + L) Cross-Adsorbed Secondary Antibody conjugated HRP (G-21234, Invitrogen) were purchased from Thermo Fisher Scientific, Inc. The ECL western-blotting substrate kit (32106, Pierce) and ELISA kits for the cell cultured supernatant immune factors: TNF-α (BMS607-3, Invitrogen) and IFN-γ (BMS606, Invitrogen) were purchased from Thermo Fisher Scientific (China) Co. Ltd., Beijing, China.

Human breast cancer cell lines SK-BR-3 and mouse breast cancer 4T1 cells were all from the American Type Culture Collection (ATCC; USA). Chinese hamster ovary (CHO) cells were obtained from the BeNa Culture Collection (Beijing, China). SK-BR-3, 4T1 and CHO cells were cultured in Dulbecco's Modified Eagle Medium (DMEM; Invitrogen, USA) supplemented with 10% fetal bovine serum (FBS; Beyotime, Shanghai, China) and 100µg/ml penicillin-chain Mycin (Beyotime, Shanghai, China).

2.2. Animals

BALB/c mice (8-weeks, female) and BALB/c-nu mice (8-weeks, female) were purchased from Changsheng Bioscience Co.inc (Liaoning, China). All experimental animals were maintained and propagated under pathogen-free conditions in the Animal Management Center of Jinan University Laboratory, with temperature of 22°C–25°C, relative humidity of 55% ± 5%, 12 h light/12 h dark cycle, adequate feed, and sterilized drinking water. All animal experiments were completed under the supervision of the Experimental Animal Ethics Committee of Jinan University.

2.3. Preparation of mesoporous silica powders (MSNs)

The MSNs were synthesized using a soft-templating method ^[28]. A mixture of 1.90 g of cetyl-trimethylammonium tosylate (CTATos, MERK) and 0.35 g of triethanolamine (TEAH₃) in 0.1 L of deionized water was stirred at 80°C for 1 h and 14.58 g of tetraethyl-orthosilicate (TEOS) was quickly added into the surfactant solution. The mixture was stirred at 80°C with a stirring speed of 1200 rpm for another 2 h. The synthesized C-MSNs were filtered, washed, and dried in the oven at 100°C for 20 h.

2.4. Construction of GPI-anchored CD80 and anti-Her2 scFv

GPI-CD80 cDNA was constructed by fusing cDNA encoding the extracellular domain of CD80 and the GPI-anchor signal sequence of LFA-3 ^{[29; 30]}. The chimeric CD80-LFA3 cDNA was ligated into pCMV6-AN-HA (PS100013, Origene, USA), a mammalian expression vector with N-terminal HA tag. For construction of GPI-anchored anti-Her2 scFv, the amino acid sequence of anti-Her2 scFv was further constructed by the protein sequence published by Carter et al. and which express the single-chain antibody with neutralizing Her2 activity ^{[31; 32]}. The chimeric anti-Her2 scFv-LFA3 cDNA was cloned into pCMV6-AN-DDK (PS100014, Origene, USA) a mammalian expression vector with N-terminal DDK tag. Constructed plasmid was transfected into CHO cells with lipofectamine™ 2000 (11668027, Invitrogen, USA).

2.5. Preparation of MSNs-Cell (MSNs-C)

The CHO cell membrane vesicles (CMs) were firstly prepared as previously described ^{[20; 33]}. Briefly, after harvesting CHO cells by centrifugation, the cells were washed with PBS and centrifuged, and repeated three times. The obtained cells were resuspended in pre-chilled Tris buffer (10 mM Tris, 10 mM MgCl₂ and 1×EDTA free protease inhibitor, pH 7.4), and then the cells were homogenized at 22,000 rpm for 1 min in a cell homogenizer (Bioprep-24, Allsheng Life Science, China). The homogenized solution was centrifuged at 500 g for 10 min at 4°C, then the supernatant was taken, and the supernatant was centrifuged at 10,000 rpm for 10 min and centrifuged at 100,000 g for 1 h (Optima XPN-100, Beckman, USA). The obtained cell membrane precipitate fraction was washed once with 10 mM Tris (pH 7.4) buffer, and the cell membrane fraction was collected by repeated centrifugation, then resuspended, and sonicated using an ultrasonic generator (Qsonica Q700, Qsonica, USA) for 5 sec to homodisperse the cell membrane. Finally, the CM of the CHO cells were obtained by extruding the solution through a 400 nm polycarbonate membrane (LiposoFast, Avestin, Canada).

To prepare MSNs-C ^[34], 5 mg of MSN was dispersed into 10 ml of an aqueous solution of DOX (0.5 mg/mL, 6 mL) and stirring was continued for 8 h. 1 mL of the prepared CM (1 mg/mL) was added to 6 mL of the DOX-loaded MSN dispersion solution. The mixture was gently stirred for 3 h, then the mixture was centrifuged and washed to remove excess DOX and other impurities from the supernatant. Finally, the centrifuged product was suspended and stored in PBS buffer. The supernatant was combined and measured at 496 nm of a UV-vis spectrophotometer (UV759CRT-FS, YOKE instrument, China) and the calculated DOX loading capacity was calculated. The DOX loading of MSNs or MSNs-C is expressed as the mass of DOX loaded per gram of MSN or MSNs-C.

2.6. Characterization of MSNs and MSNs-C

The nanosystem was characterized by field-emission scanning electron microscopy (FESEM; Merlin, Zeiss, Germany), high-resolution transmission electron microscopy (HRTEM; JEM-2100F, JEOL, Japan), Fourier transform infra-red spectroscopy (FTIR; EQUINOX55, Bruker, Germany), Raman particle size analysis (LabRAM Arami, HJY, France), N₂ adsorption-desorption isotherm (3H-2000BET, BeiShiDe instrument, China), Zeta potential analysis (Zetasizer, Malvern Ltd, UK), and X-ray photoelectron spectroscopy (XPS; Axis Ultra DLD, Kratos, UK).

2.7. Drug release

We evaluated the release of DOX in MSNs and MSNs-C by dialysis. 10 mg of MSNs-C was dispersed in PBS and the solution was transferred to a dialysis bag (Biotech membrane 14KD, Sangon Biotech, China). The dialysis bag was then placed in 30 mL of PBS buffer and stirred with a magnetic stirrer. At different time points, the content of DOX was determined by taking 0.5 mL of PBS from the buffer system, and an equal volume of fresh PBS was added to the buffer system. The cumulative drug release is calculated by the following formula:

Cumulative drug release (%) = (M_t/M₀) × 100, M_t represents the amount of drug released from the nanoparticle at time t, and M₀ is the amount of drug loaded into the nanoparticle.

2.8. Establishment of 4T1- Her2⁺ cells

Compared to the SK-BR-3 cell line, this cell continues to express Her2 gene so that the targeting effect of the Her2 gene on the drug cannot be verified alone; alternatively, the 4T1 and 4T1-Her2⁺ cell line can achieve.

To construct 4T1-Her2⁺ cells, the DNA sequence of Her2 (extracellular domain-containing signal peptide) containing 652 amino acids was cloned into a pcDNA3.1 vector. The Her2 expression vector (Her2-ORF/pcDNA3.1) or the empty pcDNA3.1 vector was transfected to 4T1 cells using Lipofectamine™ 2000 (11668027, Invitrogen, USA). After G418 selection (600 mg/ml), several stable transformants were established by the cylinder technique. The presence of 4T1-Her2⁺ cells were analysed by western blot analysis and quantitative real-time polymerase chain reaction (qPCR).

2.9. Colony forming assay

4T1 and 4T1-Her2⁺ cells were plated respectively at 2×10⁵ cells/ml in 12-well cell culture plate. After culturing for 6 h in cell incubator, the cells were co-cultured with nanoparticles and the activated peripheral blood mononuclear cell (PBMC) for 12 h, then wash 3 times with PBS. Surviving colonies were stained with 0.4% crystal violet (3580948, Sigma, USA) in 50% methanol, and the visible colonies were counted.

2.10. Elisa

The obtained mouse PBMCs were activated according to the method in the article ^[35]. PBMCs and irradiated tumor cells were co-cultured in 96-well cell culture plates for 72 h in a total volume of 200µL/well Iscove's Modified Dulbecco's Medium (IMDM; Invitrogen, USA). Activated PBMC were co-cultured with 4T1 or 4T1-Her2⁺ cells, and nanoparticles were added to the wells at different concentration for Colony forming assay. The cell cultured supernatant were collected for Elisa analysis to determine the concentrations of TNF-α and IFN-γ. Secreted cytokines in cell culture supernatants were analyzed using a TNF-α Elisa kit and an IFN-γ Elisa kit following the manufacturer’s instructions.

2.11. Confocal microscopy

CHO cells and SK-RB-3 cells were fixed in PBS buffer containing 4% paraformaldehyde (PFA) for 30 min, then washed three times with PBS buffer, and permeabilized with PBS buffer containing 0.2% Triton X-100, blocked with donkey serum. Anti-Flag antibody (F3165, Sigma, USA) and anti-HA antibody (SAB4300603, Sigma, USA) were used as primary antibodies. Donkey anti-mouse IgG conjugated with Alexa Fluor 488 (R37119, Thermo Fisher, USA) and donkey anti-rabbit IgG conjugated with Alexa Fluor 647 (A-31573, Thermo Fisher, USA) as a secondary antibody. DAPI dye (ab104139, Abeam, USA) was used for nuclear staining. Images were captured under 63× oil objective using a confocal microscope (TCS SP8, Leica, Germany).

2.12. Isolation of immune cells and flow cytometry

The isolations of immune cells from spleen and tumor tissues were processed as previously described ^{[36; 37]}. CD8⁺ T cells were purified by using CD8⁺ T cell isolation kit (Miltenyi Biotec, Germany) ^[38]. In the analysis of CD8⁺ T cell responses, cells were derived from splenocytes and tumor infiltrating lymphocytes of mice treated with nanoparticle drugs. Resuspend the cells in RPMI 1640 medium containing 2 mg/mL nanoparticles (DOX free), culture for 24 h, and with PMA (50 ng/mL), ionomycin (1 mg/mL) and BD Golgi plug (555029, Bioscience, USA) incubate for 6 h. After harvesting the cells, staining with PE-anti-CD8-antibody (ab28017, Abcam, USA) and intracellular APC -anti-IFNGR1-antibody (ab275700, Abcam, USA) the percentage of CD8⁺ IFN-γ⁺ cells were analyzed by flow cytometry. Mouse spleen cells and tumor infiltrating lymphocytes were stained in PBS buffer containing 3% FBS at 4°C, then treated with Red Blood Cell Lysis Buffer (00-4333-57, Invitrogen, USA) and incubated with purified Fc-block (CD16/CD32), then staining with anti-CD11b-PE (Fab1124p, R&D systems, USA) and anti-Gr1Percp (Fab1037c, R&D systems, USA).

2.13. Tumor transplantation models and groups

In order to verify the targeted effect of Her2 gene on the distribution of MSNS-C in mice, SK-BR-3 cells, 4T1 cells and 4T1-Her2⁺ cells were transplanted into BALB/c-nu mice, respectively. Until the tumor volume is about 150mm³, the three groups of mice were injected with MSNs-C, MSNs or Saline, respectively, and the mouse tissue was analyzed by DOX fluorescence imaging 12 hours later. Subsequently, various organs and tumor tissues of the mice were collected, and the expression level of Her2 gene in the mouse tissues was tested by Real time PCR reactions.

In the SK-BR-3 cell tumor xenograft model, 100µL of SK-BR-3 cell suspension (1 × 10⁷ cells) was subcutaneously injected into the right inguinal region of eight-week-old female BALB/c-nu mice. After 7 days, the mice were randomly divided into 4 groups (6 mice in each group), and were treated with 200µl of GPI-modified MSNs-C, unmodified MSNs-C and MSN nanoparticle solutions or normal saline at regular intervals. The size of the tumor was measured with a vernier caliper every other day to observe the growth of the tumor, and the tumor volume (V) was calculated by the formula: V = 1/2 × large diameter × (small diameter) ². After 29 days, the animals were euthanized, and the tumors were excised and weighed, photographed, and stored in liquid nitrogen for subsequent analysis.

4T1-Her2⁺ cells were transplanted into BALB/c mice in the same manner as described above. After 6 days, the mice were randomly divided into 7 groups (6 mice/group). Three groups were treated with 1 mg/Kg, 5 mg/Kg or 10mg/Kg doses of 200µl nanoparticle solution to verify the effect of different nanoparticle concentrations on tumor growth. The other 4 groups were treated by intravenous injection of 200µl 5mg/kg nanoparticle solution or normal saline to verify the effects of different nanoparticles on the immune function of mice. After 29 days, tumor cells were isolated and incubated with MSNs-C (10µg/well) for 24 hours, and then restimulated with PMA and ionomycin for 6 hours. CD8⁺ T cells were sorted by magnetic beads, and intracellular IFN-γ was detected by flow cytometry.

2.14. Histological analysis

Morphologic analyses were carried out on 4% paraformaldehyde-fixed for 24–48 h before being processed and embedded into paraffin wax. Deparaffinized, rehydrated sections were immunolabeled with anti-Ki67 antibody (ab15580, Abcam, USA). The antigen antibody was visualized using 3,3-diaminobenzidine. The sections were then dehydrated, washed (with xylene) and fixed (with resin). In every tumor section, the percentage of Ki67 positive cells in three different regions was counted.

2.15. Tunel assay

Apoptotic DNA fragments in cells were visualized according to the Click-iT™ TUNEL Kit (C10625, Invitrogen, USA). Cells marked with a brown nucleus were defined as TUNEL positive cells. The percentage of TUNEL positive cells in each region was estimated after averaging the values of three different regions.

2.16. RNA isolation and Real time PCR analysis

Total RNA from cells and tissues was isolated using TRIzol reagent (15596026, Invitrogen, USA) following manufacturer instructions, and total RNA was reverse-transcribed into cDNA using SuperScript III RT Kit (18080044, Invitrogen, USA). Real time PCR reactions were performed using specific primers to measure the mRNA abundance of genes. The data shown in the figure is the relative abundance of the indicated mRNAs, which are normalized to Actb and HPRT, respectively. Specific primer sequences for genes are derived from published articles. HER2 forward primer (TGCAGGGAAACCTGGAACTC) and reverse primer (ACAGGGGTGGTATTGTT CAGC), mouse Interferon gama (IFN-γ) forward primer (ATGAACGCTACACACTGCATC) and reverse primer (CCATCCTTTTGCCAGTTCCTC), mouse perforin 1 forward primer (AGCACAAGTTCGTGCCAGG) and reverse primer (GCGTCTCTC ATTAGGGAGTTTTT), mouse Granzyme B forward primer (CCACTCTCGACCCT ACATGG) and reverse primer (GGCCCCCAAAGTGACATTTATT), mouse Tumor necrosis factor alpha(TNF-α) forward primer (CCCTCACACTCAGATCATCTTCT) and reverse primer (GCTACGACGTGGGCTACAG), human HPRT forward primer (CCTGGCGTCGTGATTAGTGAT) and reverse primer (AGACGTTCAGTCCTGTC CATAA), mouse HPRT forward primer (TCAGTCAACGGGGGACATAAA) and reverse primer (GGGGCT GTACTGCTTAACCAG) were synthesized by Sangon Biotech (Guangzhou, China). The relative mRNA levels of multiple cytokine genes in each sample were displayed as 2^−ΔΔCt values and were representative of at least three independent experiments.

2.17. Western blot analysis

Tissues were lysed in RIPA buffer, and total protein was extracted. Then the protein concentration was determined using BCA assay and equalized before loading. Protein samples were separated by SDS-PAGE gels, transferred to polyvinylidene fluoride membranes (Millipore, Bedford, USA), and blocked with 5% non-fat dry milk (Sigma, Germany) in TBST for 2 hours at room temperature followed by incubation with primary antibody (1:1000 dilution) at 4°C overnight. After washing 3 times with TBST, the PVDF membrane was incubated with peroxidase-conjugated secondary antibody for 1 hour at room temperature, and then washed 3 times with TBST again. After fully wetting the PVDF membrane with ECL Western Blotting Substrate Kit for 1 minute, immunolabelling was detected using Tanon 5200 Chemiluminescent Imaging System.

2.18. Statistical analysis

The data are expressed as the average ± standard deviation. All experiments were repeated three or more times, and statistical methods were used to compare the data between the analysis of each group using an unpaired two-tailed Student's t test to perform statistical difference analysis. Comparison of multiple groups using one-way analysis of variance (ANOVA), followed by LSD test were performed for comparison between groups. Analysis and graphs of all data were performed using GraphPad Prism software (version 6.0) and the data were expressed as mean ± standard deviation. Statistical significance was set to p < 0.05.

3.1. Construction and Expression of GPI-CD80 and GPI-HER2 scFv in CHO Cells

To obtain the functional nanocarrier, the GPI-anchored form of CD80 molecular was generated by fusing cDNA encoding the extracellular domain of CD80 and the GPI signal sequence of LFA-3. The chimeric CD80-LFA3 cDNA was ligated into mammalian expression vector pCMV6-AN-HA, with N-terminal HA tag. Similarly, the chimeric anti-HER2 scFv-LFA3 cDNA was ligated into pCMV6-AN-DDK (N-terminal DDK tag). The two constructed plasmids were co-transfected into CHO cells with lipofectamine 2000. GPI-LFA3 and anti-HER2 scFv-LFA3 chimera were anchored on the cell surface by a GPI anchor, and visualized by laser-scanning confocal microscopy (LSCM). The expressed GPI-CD80 and GPI-HER2 scFv in cell surface were visualized using the labeled fluorescent anti-HA or anti-Flag antibody, respectively (Fig. 1A). The constructed cells can simultaneously express CD80 (green) and anti-HER2 scFv (red) fragments, and we believe that the yellow signal can be seen in the figure as the co-localization of the two gene fragments on the cell membrane. Furthermore, the expression of GPI-CD80 and GPI-HER2 scFv in CHO cells were examined by western blotting (Fig. 1B).

3.2. Preparation and Characterization of MSNs and MSNs-C

The SEM (Fig. 2B) and TEM (Fig. 2C) images of MSNs showed that the particle size of MSNs was around 100 nm. Figure 2H showed that the MSNs had a classical type IV N₂ adsorption-desorption isotherm with well-defined steps at relative pressures (P/P0) of 0.8-1.0. In Fig. 2G, MSNs show the uniform mesoporous channels and relatively narrow pore size distribution, which was also supported by SEM and TEM imaging in Figs. 2B and C. In addition, the specific surface areas and cumulative pore volumes of MSNs are 93.860 m² g^− 1 and 0.3850 cm³ g^− 1 respectively.

It was known that the nanocarriers required substantial design and functional design to achieve targeted drug delivery, which may restrain the pharmaceutical development ^[39]. In this work, the as-prepared MSNs were coated with cell membranes which modified by anti-HER2 single chain variable fragment (scFv) and co-stimulatory molecules CD80 as illustrated in Fig. 2A. Figure 2D showed the TEM imaging of MSNs after coated by the cell membrane (MSNs-C). In order to confirm the presence of cell membrane on MSNs, raman analysis was used and the raman spectra of MSNs-C showed that typical peaks approximately 480 ~ 490 cm^− 1, 1600 ~ 1700 cm^− 1, which were assigned to C-H, C-C peaks respectively; and peak approximately 3400 cm^− 1 belonged to intracellular water (Fig. 2F). In addition, the assembled MSNs-C possesses excellent stability in phosphate buffered saline (pH7.2) (Fig. 2E). MSNs show a negatively charged surface (-19.3 mV), while MSNs-C show a positively charged surface of Zeta-potential of (+ 0.1 mV). It was known that the cell's outer membrane is positively charged; the negative charge of MSNs was changed to positive after surrounded by cell membrane.

X-ray photoelectron spectroscopy (XPS) measurements were used to further identify the surface chemistry of MSNs and MSNs-C (Figs. 3A-D). Characteristic peaks of Si and O were present in the spectrum of MSNs, while the peaks of P/S/N peaks were found in that of MSNs-C (Fig. 3A). The chemical interactions in MSNs-C were analyzed by the transitions of N, P, and S peaks, and the changes of binding energy (Figs. 3B-D). Moreover, the particle distribution tests showed that the size of sample was still about 100nm after being coated by cell membrane (Fig. 3E). From Fig. 3F, it was known that about 40% of DOX was released from MSNs-C within 72 h. After MSNs and MSNs-C were loaded with DOX, the MSNs showed higher DOX loading capacities due to the smaller particle sizes and large pore volumes (Fig. 2I), and the drug loading capacity of MSNs-C reached 18mg DOX per gram MSNs-C.

3.3. MSNs-C Binding Mouse 4T1-Her2⁺ Cells and Human SK-BR-3 Cell in vitro

In order to verify the binding ability of MSNs-C to Her2 positive tumor cell in vitro, a stably expressing Her2 protein cell line (4T1-Her2⁺) was produced. The expression of Her2 protein was confirmed by flow cytometry and western blot analysis (Figs. 4A, B). In human breast cancer cell lines, SK-BR-3 over-expresses the Her2 gene product. In vitro, MSNs-C were co-cultured respectively with 4T1 cells, 4T1-Her2⁺ cells and SK-BR-3 cells for 60 min, and then washed with PBS three times. From Fig. 4B, both of CD80 and anti-Her2 scFv were detected from the lysate of the 4T1-Her2⁺ cells and SK-BR-3 cells by western blotting, but not from that of 4T1 cells. Moreover, the binding of CD80 and anti-Her2 scFv to the cell membrane surface depend on the increase of MSNs-C concentration (Fig. 4C). Furthermore, the binding of MSNs-C and SK-BR-3 cell surface was also visualized by confocal microscopy (Fig. 4D). These results suggested that MSNs-C can specific bind to the surface of the tumor cells with expressing Her2 protein.

3.4. Her2 Gene Targeting Affects the Distribution of MSNs-C in vivo

To observe the distribution of MSNs-C in mice, the mice tissues were analyzed by DOX fluorescence imaging. From Fig. 5A, GPI-modified MSNs-C mainly focused in the tumor sites, but not in the other tissues (heart, liver, spleen, lung and kidney) when MSNs-C were intravenously injected into mice after 12 hours. However, in control group (MSNs and Saline), DOX fluorescence signal was not detected in tumor sites. In unmodified MSNs-C group, DOX fluorescence signals intensity was weaker compared to the GPI-modified MSNs-C group (Fig. 5A). The HER2 gene expression levels in mice tissues were tested by real time PCR. The results showed that HER2 was higher expressed in tumor, lung and liver tissues than other tissue (Fig. 5B); and which may be related with 4T1-Her2⁺ tumor cells invasion and metastasis in nude mice.

3.5. MSNs-C Restores PBMC Activation and Inhibits Growth of Tumor Cell in vitro

The extracellular domain of CD80 can maintain the activation of both human and mouse T cells in treatment of PD-L1⁺ tumor cells ^{[24; 35]}. To investigate the inhibitory efficacy of MSNs-C (without DOX) to tumor cells, the phytohemagglutinin (PHA) activated peripheral blood mononuclear cells (PBMCs) were co-cultured with 4T1 (or 4T1 Her2⁺) cells in the presence or absence of increasing concentrations of either GPI modified MSNs-C or unmodified MSNs-C. The proliferation of 4T1 (or 4T1-Her2⁺) cell were analyzed using colony formation (Figs. 6A, B). The results showed GPI-modified MSNs-C significantly inhibited the growth of 4T1 cells in a dose dependent manner in vitro. Moreover, the GPI-modified MSNs-C more significantly inhibited the growth of Her2⁺ tumor cell, which suggested the anti-Her2 scFv could increase the targeting effect of MSNs-C to tumor cells in vitro. The levels of TNF-α and IFN-γ in the supernatant of cell culture were examined by Elisa (Figs. 6C). The results showed that GPI-modified MSNs-C could significantly increase the secretion of cytokines TNF-α and IFN-γ which may enhance the activation of immune cells and inhibit the colony formation of tumor cells.

3.6. MSNs-C Inhibit Tumor Growth in vivo

The antitumor efficacy of MSNs-C was examined in a xenograft (SK-RB-3) of human breast tumor in vivo. A subcutaneous transplantation model of human tumor cell SK-RB-3 was developed in nude mice, and the treatment solutions schematic is showed in Fig. 7A. A significant reduction in tumor volume was observed in GPI modified MSNs-C treated mice as compared to the other groups (Figs. 7B, C). Also, the tumor weight of MSNs-C treated animals was reduced compared to other groups mice (Fig. 7D).

Additionally, to establish whether or not this inhibitory effect is dose dependent, different concentrations of MSNs-C solution were administered to 4T1-Her2⁺ tumor transplantation model. Randomly grouped mice were injected intravenously with MSNs-C at 1mg/kg, 5mg/kg or 10mg/kg, and the treatment solutions schematic is showed in Fig. 7E. As shown in Figs. 7F-H, the inhibitory effect of MSNS-C on 4T1Her2 + tumors was clearly dose-dependent. The inhibitory effect was less at the dose of 1mg/Kg, whereas the best inhibition was clearly observed at a concentration of 10mg/Kg.

Histological analyses of SK-RB-3 tumor specimens resected from the animals treated with MSNs-C showed significantly reduced Ki67 positive cells compared to other groups and a significantly increased TUNEL positivity compared to other groups (Figs. 8A, B). The results suggested that MSNs-C inhibited the proliferation and promoted the apoptosis of tumor cells in vivo.

3.7. MSNs-C Promotes Robust Cellular Immune Response

Since the SK-BR-3 tumor cell nude mouse model can only verify the tumor suppressive properties of DOX drugs and the targeting of the Her2 gene, the immunomodulatory effect and mechanism of GPI-anchored CD80 on T cells can't be reflected. To further evaluate the cellular immune response of MSNs-C in tumor microenvironment, the tumor cell 4T1-Her2⁺ subcutaneous transplantation model was established in BALB/c mice. Compared with the control groups (no GPI-modified MSNs-C and MSNs), CD8⁺ T cells derived from the tumor tissue of mice treated with GPI-modified MSNs-C had secreted more IFN-γ (Fig. 9A, B). Western blotting and real time PCR were used to analyze the gene expressions of TNF-α, IFN-γ, Perforin and Granzyme B (GZB). The results showed MSNs-C could significantly induce the expression of these genes (Figs. 9C, D and E).

Additionally, we found that the proportion of MDSCs (CD11b⁺Gr1⁺) derived from spleens or tumors were significantly reduced after treatment with MSNs-C compared to control groups (Fig. 9F).

New strategies enhancing both cellular immune response and targetability of tumor immunomodulator —— the reason is that its weak penetration to tumor tissues and it can be functionally suppressed by the tumor microenvironment —— remain a major challenge for the immunotherapy in the solid tumor ^[11–13]. Bio-nanoparticles will overcome these, because they can deliver chemotherapeutic drugs to reach tumor lesions in a short time ^{[16; 17]}. In this study, a novel biomimetic immuno-chemotherapy composite nanoparticle system, based on MSN, was designed as a breast tumors targeted drug (MSNs-C). The cell membranes were modified by the glycosyl-phosphatidylinositol (GPI) anchored anti-Her2 single chain variable fragment (scFv) and the GPI anchored co-stimulatory molecule CD80; and the membranes was coated on mesoporous silica nanoparticles loaded with Doxorubicin (DOX). MSNs-C not only binds to the surface of Her2-positive tumor cells, but also activates CD8 T cells to kill tumor cells by enhancing the immune function of CD80. Moreover, MSNs-C can deliver chemical drugs to tumor tissues, further inhibiting the growth of tumor cells and promoting apoptosis of tumor cells.

MSN has been widely used in the research of tumor therapy due to excellent drug-loading and high penetration ability. The drug loading capacity of as-prepared MSNs-C reached 18mg DOX per gram (Fig. 2I); and about 40% of DOX was released from MSNs-C within 72 h (Fig. 3F). However, it is not enough for clinical application to have only the ability of drug control and release. Glycosylphosphatidylinositol (GPI) can be attached to the C-terminus of a protein, which has a very important role in a variety of biological processes ^[40–45]. For example, activating specific T cells ^[43], inducing tumor-specific T cells and CTLs ^[44]. These studies indicate that exogenously adding GPI-anchored proteins have biological functions in vivo and can potentially be used for therapy. In the process of preparing cell membranes, we used CHO cells capable of expressing GPI anchoring proteins CD80 and anti-Her2-scFv. CHO cells are usually used as mammalian cells ^[46]. In the CHO cells we constructed, the average expression efficiency of CD80 and HER2-scFv was greater than 80%. Also, CD80 and Her2-scFv were observed to be distributed on the cell surface under confocal microscopy (Fig. 1A). From the results, we found the bare MSN can easily aggregate together to form larger particles and precipitate in the buffer. However, after being coated with the cell membrane, it exhibits excellent dispersion and water solubility (Figs. 2B-E). Raman and XPS analysis were used to confirm the coating of cell membrane on MSNs. In addition, MSNs-C has a diameter of about 100 nm (Figs. 2D, 3E), which is suitable for intravenous injection in animals.

The growth and metastasis of murine 4T1 tumor cells is very similar to that of human breast cancer, we used breast cancer mouse cell lines (4T1) to construct animal models to assess the biological effects of MSNs-C in vivo. Her2 is a transmembrane tyrosine kinase receptor, and over-expressed in 18%-20% of invasive breast cancers ^[47], but 4T1 cell lack Her2 protein expression ^[48]. Therefore, we constructed a 4T1 cell line stably expressing the Her2 gene. Another human breast cancer cell line, SK-BR-3, is derived from pleural effusion in 43-year-old breast cancer patients. The cell line SK-BR-3 overexpresses the Her2 gene product ^[1]. In vitro, we labeled the two molecules with a CD80 molecular fragment fused to the HA tag and an anti-Her2 scFV fragment fused with the Flag tag. From the confocal image (Fig. 4D), the two molecules (red signal and green signal) can be detected, and the results show that MSNs-C is able to bind to the cell membrane of the cell line SK-BR-3 expressing Her2 protein, but not to the surface of 4T1 cells. So, we further confirmed that the nanoparticle MSNs-C containing the fragment of anti-HER2 scFv was able to target to the surface of the cell line expressing the Her2 protein. In addition, Western Blotting results also show that MSNs-C binds to the surface of cell lines expressing HER2 protein (Fig. 4B).

MSNs-C can significantly promote the killing of tumor cells by PBMC cells, and can promote the secretion of cytokines, such as TNF-α and IFN-γ (Fig. 6). We know that the expression of PDL1 in human cancer cells is associated with a decrease in patient survival and is also associated with a significant increase in patient mortality ^[49]. In addition, the primary immunosuppressive mechanism in cancer patients is the interaction and signal transduction between PDL1-PD1 ^[50–52]. CD80-Fc inhibits tumors through a dual mechanism, one that inhibits PDL1-PD1 interaction and one that interacts with CD28 to produce a costimulatory signal ^[35]. Therefore, we hypothesize that MSNs-C may activate CD8⁺ T cell proliferation and enhance tumor immune responses in the tumor microenvironment by blocking the PD1-PDL1 pathway and activating T cell co-stimulatory signals.

How to overcome immunosuppression is an important challenge for cancer treatment ^[53]. Interestingly, we found that the proportion of MDSCs (CD11b⁺Gr1⁺) derived from spleens or tumors were significantly reduced after treatment with MSNs-C compared to control groups (Fig. 9). In the tumor microenvironment, myeloid-derived suppressor cells (MDSCs) are thought to be negatively regulated immune cells and play an important role in immunosuppression ^{[54; 55]}. Tumor cell-induced immunosuppression can promote tumor escape immune surveillance, as well as tumor zdelivery system has the potential to reverse the immunosuppression in tumor microenvironment and enhance the anti-tumor effect of the drug.

In summary, we developed a new strategy for delivering anti-tumor drug doxorubicin to specifically target tumor site by GPI anchored anti-HER2 scFv, which induced the cytotoxic activity of CD8⁺ T cell in tumor microenvironment by GPI anchored co-stimulatory molecules CD80. The MSNs-C was composed of a shell containing anti-HER2 scFv and CD80 modified cell membranes and a core containing drug-loaded mesoporous silicon, which exhibits enhanced stability and much improved availability of drugs in the blood circulation. The higher accumulation of DOX in the tumors of mice treated with MSNs-C indicated that MSNs-C achieved specific targeting of HER2 positive breast tumor. MSNs-C greatly promoted CD8⁺ T-cell activation and cytokine production, and reduced MDSCs levels in tumors. Treatment of these particles significantly inhibited the growth of implanted breast tumors. Also, in this system, the new nanoparticle can be modified by other functional proteins except those mentioned in this article. We think this strategy could to be used as a general platform for cancer treatment, as well as for other types of cancer treatment by using immuno-chemotherapy composite nanoparticle system and cell membranes as a “Trojan horse” coat.

DOX

Doxorubicin

CD80

Cluster of differentiation 80

HER2

Receptor tyrosine-protein kinase erbB-2

MSN

Mesoporous silica nanoparticle

CMs

Cell membranes

PBMC

Peripheral blood mononuclear cell

MDSCs

Myeloid-derived suppressor cells

GPI

Glycosyl-phosphatidylinositol

CHO

Chinese hamster ovary

Ethics approval and consent to participate

All animal experiments were completed under the approval and supervision of the Experimental Animal Ethics Committee of Jinan University. The approved protocol number for animal experiments is IACUC-20210615-09.

Consent for publication

All the authors agree to publish this study in the Journal of Nanobiotechnology.

Availability of data and materials

The data and material are available.

Competing interests

The authors declare no potential conflicts of interest.

Funding

This work was supported by the Fundamental and Applied Basic Research Fund of Guangdong (No. 2021A1515111217), and Medical Scientific Research Foundation of Guangdong Province of China (No. A2019217).

Authors' contributions - provide individual author contribution

Jin Wo, Baocheng Wang, Zhizhong Li and Wei Liu designed experiments; Qianqian Fu assisted in Isolation of immune cells and flow cytometry analysis; Yuanyue Fu, Yang Liu, Zerong Huang and Kairui Zhu contributed to animal study design; Huige Hou, Chenghong Sun, Cheng Zhong contributed to synthetic nano-drug loading system; Renwen Zhang, Haoran Zhu and Xinfeng Yi performed research; Renwen Zhang and Haoran Zhu prepared the manuscript; Jin Wo, zhizhong Li and Baocheng Wang revised the manuscript.

Acknowledgements

Renwen Zhang, Haoran Zhu, Xinfeng Yi contributed equally to this work. We all thank Guodong Sun and Kui Shen for their guidance and help during the experiment.

Maus M V, Grupp S A, Porter D L, et al. Antibody-modified T cells: CARs take the front seat for hematologic malignancies[J]. Blood, 2014, 123(17): 2625–2635
Park J H, Geyer M B, Brentjens R J. CD19-targeted CAR T-cell therapeutics for hematologic malignancies: interpreting clinical outcomes to date[J]. Blood, 2016, 127(26): 3312–3320
Brentjens R J, Davila M L, Riviere I, et al. CD19-Targeted T Cells Rapidly Induce Molecular Remissions in Adults with Chemotherapy-Refractory Acute Lymphoblastic Leukemia[J]. Science Translational Medicine, 2013, 5(177):
Kochenderfer J N, Wilson W H, Janik J E, et al. Eradication of B-lineage cells and regression of lymphoma in a patient treated with autologous T cells genetically engineered to recognize CD19[J]. Blood, 2010, 116(20): 4099–4102
Maude S L, Frey N, Shaw P A, et al. Chimeric Antigen Receptor T Cells for Sustained Remissions in Leukemia[J]. New England Journal of Medicine, 2014, 371(16): 1507–1517
Porter D L, Levine B L, Kalos M, et al. Chimeric Antigen Receptor-Modified T Cells in Chronic Lymphoid Leukemia[J]. New England Journal of Medicine, 2011, 365(8): 725–733
Grupp S A, Kalos M, Barrett D, et al. Chimeric Antigen Receptor-Modified T Cells for Acute Lymphoid Leukemia[J]. New England Journal of Medicine, 2013, 368(16): 1509–1518
Contardi E, Palmisano G L, Tazzari P L, et al. CTLA-4 is constitutively expressed on tumor cells and can trigger apoptosis upon ligand interaction[J]. International Journal of Cancer, 2005, 117(4): 538–550
Gabrilovich D. Mechanisms and functional significance of tumour-induced dendritic-cell defects[J]. Nature Reviews Immunology, 2004, 4(12): 941–952
Rabinovich G A, Gabrilovich D, Sotomayor E M. Immunosuppressive strategies that are mediated by tumor cells[J]. Annual Review of Immunology, 2007, 25: 267–296
Wing A, Fajardo C A, Posey A D, et al. Improving CART-Cell Therapy of Solid Tumors with Oncolytic Virus-Driven Production of a Bispecific T-cell Engager[J]. Cancer Immunology Research, 2018, 6(5): 605–616
Klinger M, Brandl C, Zugmaier G, et al. Immunopharmacologic response of patients with B-lineage acute lymphoblastic leukemia to continuous infusion of T cell-engaging CD19/CD3-bispecific BiTE antibody blinatumomab[J]. Blood, 2012, 119(26): 6226–6233
Dunn G P, Old L J, Schreiber R D. The three Es of cancer immunoediting[J]. Annual Review of Immunology, 2004, 22: 329–360
Friedl P, Alexander S. Cancer Invasion and the Microenvironment: Plasticity and Reciprocity[J]. Cell, 2011, 147(5): 992–1009
Emens L A, Silverstein S C, Khleif S, et al. Toward integrative cancer immunotherapy: targeting the tumor microenvironment[J]. Journal of Translational Medicine, 2012, 10:
Zolnik B S, Gonzalez-Fernandez A, Sadrieh N, et al. Minireview: Nanoparticles and the Immune System[J]. Endocrinology, 2010, 151(2): 458–465
Ernsting M J, Murakami M, Roy A, et al. Factors controlling the pharmacokinetics, biodistribution and intratumoral penetration of nanoparticles[J]. Journal of Controlled Release, 2013, 172(3): 782–794
Zhu J Y, Zheng D W, Zhang M K, et al. Preferential Cancer Cell Self-Recognition and Tumor Self-Targeting by Coating Nanoparticles with Homotypic Cancer Cell Membranes[J]. Nano Letters, 2016, 16(9): 5895–5901
Hu C M J, Fang R H, Wang K C, et al. Nanoparticle biointerfacing by platelet membrane cloaking[J]. Nature, 2015, 526(7571): 118-+
Sun H P, Su J H, Meng Q S, et al. Cancer-Cell-Biomimetic Nanoparticles for Targeted Therapy of Homotypic Tumors[J]. Advanced Materials, 2016, 28(43): 9581-+
Baskar S, Glimcher L, Nabavi N, et al. Major histocompatibility complex class II + B7-1 + tumor cells are potent vaccines for stimulating tumor rejection in tumor-bearing mice[J]. Journal of Experimental Medicine, 1995, 181(2): 619 – 29.10.1084/jem.181.2.619
Freeman G J, Gribben J G, Boussiotis V A, et al. Cloning of B7-2: a CTLA-4 counter-receptor that costimulates human T cell proliferation[J]. Science, 1993, 262(5135): 909 – 11.10.1126/science.7694363
Haile S T, Horn L A, Ostrand-Rosenberg S. A Soluble Form of CD80 Enhances Antitumor Immunity by Neutralizing Programmed Death Ligand-1 and Simultaneously Providing Costimulation[J]. Cancer Immunology Research, 2014, 2(7): 610–615
Haile S T, Bosch J J, Agu N I, et al. Tumor Cell Programmed Death Ligand 1-Mediated T Cell Suppression Is Overcome by Coexpression of CD80[J]. Journal of Immunology, 2011, 186(12): 6822–6829
Bozeman E N, Cimino-Mathews A, Machiah D K, et al. Expression of membrane anchored cytokines and B7-1 alters tumor microenvironment and induces protective antitumor immunity in a murine breast cancer model[J]. Vaccine, 2013, 31(20): 2449–2456
Von Herrath M G, Guerder S, Lewicki H, et al. Coexpression of B7-1 and viral ("self") transgenes in pancreatic beta cells can break peripheral ignorance and lead to spontaneous autoimmune diabetes[J]. Immunity, 1995, 3(6): 727 – 38.10.1016/1074–7613(95)90062-4
Jiang Y, Krishnan N, Zhou J R, et al. Engineered Cell-Membrane-Coated Nanoparticles Directly Present Tumor Antigens to Promote Anticancer Immunity[J]. Advanced Materials, 2020, 32(30):
Zhang K, Xu L L, Jiang J G, et al. Facile Large-Scale Synthesis of Monodisperse Mesoporous Silica Nanospheres with Tunable Pore Structure[J]. Journal of the American Chemical Society, 2013, 135(7): 2427–2430
Staunton D E, Gaur A, Chan P Y, et al. Internalization of a major group human rhinovirus does not require cytoplasmic or transmembrane domains of ICAM-1[J]. Journal of Immunology, 1992, 148(10): 3271–4
Mchugh R S, Ahmed S N, Wang Y C, et al. Construction, purification, and functional incorporation on tumor cells of glycolipid-anchored human B7-1 (CD80)[J]. Proceedings of the National Academy of Sciences of the United States of America, 1995, 92(17): 8059 – 63.10.1073/pnas.92.17.8059
Carter P, Presta L, Gorman C M, et al. Humanization of an anti-p185HER2 antibody for human cancer therapy[J]. Proceedings of the National Academy of Sciences of the United States of America, 1992, 89(10): 4285 – 9.10.1073/pnas.89.10.4285
Kasuya K, Shimazu M, Suzuki M, et al. Novel photodynamic therapy against biliary tract carcinoma using mono-l-aspartyl chlorine e6: basic evaluation for its feasibility and efficacy[J]. Journal of Hepato-Biliary-Pancreatic Sciences, 2010, 17(3): 313–321
Gao Y, Chen Y, Ji X F, et al. Controlled Intracellular Release of Doxorubicin in Multidrug-Resistant Cancer Cells by Tuning the Shell-Pore Sizes of Mesoporous Silica Nanoparticles[J]. Acs Nano, 2011, 5(12): 9788–9798
Zou Z, He X X, He D G, et al. Programmed packaging of mesoporous silica nanocarriers for matrix metalloprotease 2-triggered tumor targeting and release[J]. Biomaterials, 2015, 58: 35–45
Haile S T, Dalal S P, Clements V, et al. Soluble CD80 Restores T Cell Activation and Overcomes Tumor Cell Programmed Death Ligand 1-Mediated Immune Suppression[J]. Journal of Immunology, 2013, 191(5): 2829–2836
Winans B, Nagari A, Chae M, et al. Linking the Aryl Hydrocarbon Receptor with Altered DNA Methylation Patterns and Developmentally Induced Aberrant Antiviral CD8(+) T Cell Responses[J]. Journal of Immunology, 2015, 194(9): 4446–4457
Fernandez-Poma S M, Salas-Benito D, Lozano T, et al. Expansion of Tumor-Infiltrating CD8(+) T cells Expressing PD-1 Improves the Efficacy of Adoptive T-cell Therapy[J]. Cancer Research, 2017, 77(13): 3672–3684
Grebe K M, Hickman H D, Irvine K R, et al. Sympathetic nervous system control of anti-influenza CD8 + T cell responses[J]. Proceedings of the National Academy of Sciences of the United States of America, 2009, 106(13): 5300 – 5.10.1073/pnas.0808851106
Sun Q H, Radosz M, Shen Y Q. Challenges in design of translational nanocarriers[J]. Journal of Controlled Release, 2012, 164(2): 156–169
Shen J N, He Q J, Gao Y, et al. Mesoporous silica nanoparticles loading doxorubicin reverse multidrug resistance: performance and mechanism[J]. Nanoscale, 2011, 3(10): 4314–4322
Xiu F M, Cai Z J, Yang Y S, et al. Surface anchorage of superantigen SEA promotes induction of specific antitumor immune response by tumor-derived exosomes[J]. Journal of Molecular Medicine-Jmm, 2007, 85(5): 511–521
Patel J M, Vartabedian V F, Kim M C, et al. Influenza Virus-Like Particles Engineered by Protein Transfer With Tumor-Associated Antigens Induces Protective Antitumor Immunity[J]. Biotechnology and Bioengineering, 2015, 112(6): 1102–1110
Huang J H, Getty R R, Chisari F V, et al. Protein transfer of preformed MHC-peptide complexes sensitizes target cells to T cell cytolysis[J]. Immunity, 1994, 1(7): 607 – 13.10.1016/1074–7613(94)90050-7
Mchugh R S, Nagarajan S, Wang Y C, et al. Protein transfer of glycosyl-phosphatidylinositol-B7-1 into tumor cell membranes: a novel approach to tumor immunotherapy[J]. Cancer Research, 1999, 59(10): 2433–7
Ferguson M A. The structure, biosynthesis and functions of glycosylphosphatidylinositol anchors, and the contributions of trypanosome research[J]. Journal of Cell Science, 1999, 112 (Pt 17): 2799–809
Wurm F M. Production of recombinant protein therapeutics in cultivated mammalian cells[J]. Nature Biotechnology, 2004, 22(11): 1393–1398
Moasser M M, Krop I E. The Evolving Landscape of HER2 Targeting in Breast Cancer[J]. Jama Oncology, 2015, 1(8): 1154–1161
Kau P, Nagaraja G M, Zheng H Y, et al. A mouse model for triple-negative breast cancer tumor-initiating cells (TNBC-TICs) exhibits similar aggressive phenotype to the human disease[J]. Bmc Cancer, 2012, 12:
Thompson R H, Kuntz S M, Leibovich B C, et al. Tumor B7-H1 is associated with poor prognosis in renal cell carcinoma patients with long-term follow-up[J]. Cancer Research, 2006, 66(7): 3381–3385
Brahmer J R, Drake C G, Wollner I, et al. Phase I Study of Single-Agent Anti-Programmed Death-1 (MDX-1106) in Refractory Solid Tumors: Safety, Clinical Activity, Pharmacodynamics, and Immunologic Correlates[J]. Journal of Clinical Oncology, 2010, 28(19): 3167–3175
Brahmer J R, Tykodi S S, Chow L Q M, et al. Safety and Activity of Anti-PD-L1 Antibody in Patients with Advanced Cancer[J]. New England Journal of Medicine, 2012, 366(26): 2455–2465
Topalian S L, Hodi F S, Brahmer J R, et al. Safety, Activity, and Immune Correlates of Anti-PD-1 Antibody in Cancer[J]. New England Journal of Medicine, 2012, 366(26): 2443–2454
Camisaschi C, Vallacchi V, Vergani E, et al. Targeting Immune Regulatory Networks to Counteract Immune Suppression in Cancer[J]. Vaccines, 2016, 4(4):
Umansky V, Blattner C, Gebhardt C, et al. The Role of Myeloid-Derived Suppressor Cells (MDSC) in Cancer Progression[J]. Vaccines, 2016, 4(4):
Tian J, Ma J, Ma K, et al. beta-Glucan enhances antitumor immune responses by regulating differentiation and function of monocytic myeloid-derived suppressor cells[J]. European Journal of Immunology, 2013, 43(5): 1220–1230

Scheme 1 is available in Supplementary Files section.

No competing interests reported.

Scheme1.png
Scheme 1. A novel biomimetic therapeutic system was designed as a targeted immunoregulation and chemotherapy of breast tumor. In this system, cell membranes modified by GPI anchored anti-HER2 scFv and CD80 was coated in MSNs with DOX. The therapeutic system (MSNs-C) can accumulate at tumor bits through anti-HER2 scFv, promote CD8-T cell activity and cytokine production, thereby reducing MDSC levels in tumor micro-environments and inhibiting tumor growth in the body.

Download PDF

Version 1

posted

You are reading this latest preprint version

Novel biomimetic mesoporous silica nanoparticles system possessed targetability and immune synergy to promote solid tumor immuno- chemotherapy efficacy

Status:

Version 1

Abstract

Figures

1. Introduction

2. Materials And Methods

2.1. Reagent

2.2. Animals

2.3. Preparation of mesoporous silica powders (MSNs)

2.4. Construction of GPI-anchored CD80 and anti-Her2 scFv

2.5. Preparation of MSNs-Cell (MSNs-C)

2.6. Characterization of MSNs and MSNs-C

2.7. Drug release

2.8. Establishment of 4T1- Her2+ cells

2.9. Colony forming assay

2.10. Elisa

2.11. Confocal microscopy

2.12. Isolation of immune cells and flow cytometry

2.13. Tumor transplantation models and groups

2.14. Histological analysis

2.15. Tunel assay

2.16. RNA isolation and Real time PCR analysis

2.17. Western blot analysis

2.18. Statistical analysis

3. Results

3.1. Construction and Expression of GPI-CD80 and GPI-HER2 scFv in CHO Cells

3.2. Preparation and Characterization of MSNs and MSNs-C

3.3. MSNs-C Binding Mouse 4T1-Her2+ Cells and Human SK-BR-3 Cell in vitro

3.4. Her2 Gene Targeting Affects the Distribution of MSNs-C in vivo

3.5. MSNs-C Restores PBMC Activation and Inhibits Growth of Tumor Cell in vitro

3.6. MSNs-C Inhibit Tumor Growth in vivo

3.7. MSNs-C Promotes Robust Cellular Immune Response

4. Discussions

5. Conclusions

Abbreviations

Declarations

References

Scheme

Additional Declarations

Supplementary Files

Status:

Version 1

2.8. Establishment of 4T1- Her2⁺ cells

3.3. MSNs-C Binding Mouse 4T1-Her2⁺ Cells and Human SK-BR-3 Cell in vitro