Oxygen-Glucose Deprivation (OGD) decreases the motility and length of Axonal Mitochondria in Cultured Dorsal Root Ganglion Cells of Rat

doi:10.21203/rs.3.rs-1535786/v1

Download PDF

Research Article

Oxygen-Glucose Deprivation (OGD) decreases the motility and length of Axonal Mitochondria in Cultured Dorsal Root Ganglion Cells of Rat

https://doi.org/10.21203/rs.3.rs-1535786/v1

This work is licensed under a CC BY 4.0 License

You are reading this latest preprint version

Controlling axonal mitochondria is important for their neural network to keep normal functions. Oxygen-glucose deprivation (OGD), mimicking ischemia model, finally induces neuronal cell death as same as axonal degeneration. Axonal mitochondria are disrupted in process in neural degeneration induced by OGD, but the mechanism of mitochondria dysfunctions has not been fully understood. We focused on dynamics of mitochondria in axons exposed to OGD and the number of motile mitochondria significantly reduced in 1 hour after OGD exposure. Further, we found the length of stationary mitochondria decreases which was reasoned by three patterns how stationary mitochondria size decrease; first, stop of motile mitochondria: second, fission of longer stationary mitochondria: third, changing from tubular to sphere mitochondria in axons exposed to OGD. Our study shows that OGD exposure reduces the number of motile mitochondria earlier than stationary mitochondria fragmentation and provides three reasons why stationary mitochondria decrease. Our result suggests that mitochondria are new target for neuroprotective strategy to prevent neuro degeneration induced by ischemia.

Mitochondria

axon

oxygen-glucose deprivation (OGD)

fission

Local ischemia, inhibiting blood supply of nutrition and oxygen to tissue, induces pain, hypersensitivity and peripheral neuropathies [Coderre et al. 2010; Coderre and Bennett 2010; Fulas et al. 2021]. Peripheral neuropathies induced by ischemia are caused by many disease, diabetics, compression of connective tissue, complex regional pain syndrome and non-systemic vasculitic neuropathy (NSVS) [Coderre 2011; Coderre and Bennet 2010; Collins and Hadden 2017; Sommer et al. 2017]. Especially, the guideline of NSVS was published in 2010 and NSVS is characterized by necrotizing inflammation resulting in luminal narrowing of the vasa nervorum, leading to ischemic injury to peripheral nerves [Castiglione et al. 2021; Dyck et al. 1987; Lubana et al. 2015].

Typical neuron is divided two construction, cell body and long axon. Although axonal transport, from the cell body to the axon, contribute partially to axonal survive, blood supply is largely important to control axonal function [Ubogu 2020]. In nervous system, ischemic disease typically affects both central nervous system (CNS) and peripheral nervous system (PNS), as well as neural cell bodies and axons. Finally, the inhibition of blood supply requires local change and induces neural or axonal degeneration [Bastian et al. 2018a]. In experimental model, oxygen-glucose deprivation (OGD) is usually used as mimic-ischemic model in vitro, including cellular or organ culture system [Sommer 2017; Tornabene 2019].

Mitochondria are organelles that provide adenosine triphosphate (ATP) to cells. There are two types of mitochondria in axons: stationary and motile, which respond to axonal energy demands [Fabricius et al. 1993; Morris and Hollenbeck 1995]. It is readily understood that axonal mitochondria are affected by ischemia. The dynamics of axonal mitochondria contribute significantly to axonal survive by producing ATP or buffering calcium ions [Nicholls and Budd 2020]. Two types mitochondria are observed in axon, motile or transfer and stationary mitochondria. In the process of axonal degeneration, the two types mitochondria are disturbed separately. Ko et al revealing that lowering the rate of motile mitochondria in injured axon is observed before calcium influx or axon fragmentation [2021]. They mentioned the number of motile mitochondria decreased, but not mention stationary mitochondria [Ko et al. 2021].

In recent studies, axonal mitochondrial destruction was reported to lead to neurodegenerative diseases, such as Alzheimer’s disease, Huntington’s disease, multiple sclerosis, and optic atrophy [Cai and Tammineni 2016; Campbell et al. 2014; Cherubini and Ginés 2017; Lopez Sanchez et al. 2016]. Similarly, stimulations to axons affect axonal mitochondria [Chiang et al. 2015; Kikuchi et al. 2018; Kiryu-Seo et al. 2010; Ohno et al. 2011]. The axonal mitochondria exposed to OGD shows that the number of motile mitochondria and mitochondria size reduce in axon [Baltan 2014]. However, the sequence of mitochondria event in axons exposed with OGD remains unclear. We recognize that OGD might affect not only the axon, but also dendrites and cell bodies. Clarifying the mechanisms of axonal degeneration that are directly induced by changes in the axon environment should have first priority, because axonal degeneration eventually leads to neural death (e.g., Wallerian degeneration). Therefore, we focused on the effect of OGD on the axon only. This study was designed to explore the direct effects of OGD on axonal mitochondria in non-myelinated peripheral axons. We focused on alterations in axonal mitochondria size and/or rate of transport in culture systems produced from dorsal root ganglia (DRG) taken from rat embryos.

Ethics Statement

All our studies were approved by the Animal Experimentation Committee and the Gene Recombination Experimentation Committee at Sapporo Medical University.

Primary Dorsal Root Ganglion (DRG) culture

Rat DRG cultures were prepared and maintained as described previously, with minor modifications [Fex Svenningsen et al. 2003; Kikuchi et al. 2018; Kiryu-Seo et al. 2010]. Briefly, DRGs were dissected from the embryos of pregnant Sprague-Dawley rats on the 18–19th day of gestation. The DRGs were collected in L-15 medium and digested with 0.25% trypsin in Hank’s Balanced Salt Solution (Thermo Fisher Scientific Inc., Waltham, MA, USA) at 37°C for 30 minutes (min). Digestion was stopped using Dulbecco’s Modified Eagle’s Medium (Wako Co., Ltd., Tokyo, Japan) containing 10% fetal calf serum. The cells were then mechanically dissociated using a Pasteur pipette. The dissociated cells were resuspended in culture medium. (Neurobasal medium containing 2% B27, 0.3% GlutaMax, 10 ng/mL nerve growth factor, and penicillin/streptomycin; Thermo Fisher Scientific Inc.) One week after harvest, ascorbic acid was added to the medium. The cells were maintained for another 5–6 weeks with change of medium every 2–3 days. In this way, we maintained DRG cultures for 42 days in vitro (DIV) before observation.

Lentiviral preparation

To observe mitochondria in live cells, we used lentivirus prepared using ViraPower HiPerform Lentiviral Expression Systems (Invitrogen) following the manufacturer’s protocol and our previous report [Kikuchi et al. 2018]. Briefly, the vector containing the sequences targeting mitochondria with DsRed2 (Mito-DsRed2) was purchased from Clontech (Mountain View, CA, USA). The Mito-DsRed2 vector was amplified using polymerase chain reaction (PCR) using forward primer, 5’–CACCACCATGTCCGTCCTGACGCCGCTG–3’ and reverse primer 5’–ACTACAGGAACAGGTGGTGGCGGCCCTC–3’. The PCR products were subcloned into the pLenti6.3/V5 lentiviral vector using the TOPO cloning technique. The construct and packaging plasmids were transfected into 293 FT cells using Lipofectamine 3000 (Invitrogen). The viral supernatants were collected 48 hours after the transfection, filtered using 0.45-μm polyvinylidene membranes (Millipore, Billerica, MA, USA), and kept at -80°C until use.

Observation of mitochondria in DRG axons and oxygen-glucose deprivation

After three to four weeks of DRG culture, the lentivirus was added to the cells. Another two to three weeks after virus transfection, mitochondrial dynamics were measured using an inverted microscope (Axio Observer Z1, Carl Zeiss, Inc., Germany). This microscope has a micro-incubator (Tokai Hit Co., Ltd., Fujinomiya, Shizuoka, Japan) used to keep temperature at 37.0 ± 0.5°C and a 100% humid environment. Time-lapse images of mitochondrial dynamics were collected every 6 seconds for a total of 200 images. Before Oxygen-glucose deprivation (OGD) exposure, mitochondrial dynamics were recorded as pre-exposure (OGD-pre). After the observation of OGD-pre, the culture medium was then replaced with glucose-free medium and initial gas mixture containing 95% air and 5% CO₂ was changed to 1% O₂ and 5% CO₂regulated by N₂ for OGD. After 1, 2, 3, 4, 5 and 6 hours (hr) OGD exposure (OGD-1hr—6hr), the behavior of mitochondria in the same axon were recorded and compared to that OGD-pre. For control, after the observation of same condition to OGD-pre (Cont-pre), the culture medium was then replaced normal DMEM, including glucose, and kept the initial gas mixture containing 95% air and 5% CO₂. The timing to collect the mitochondrial dynamics was same to OGD-1hr—6hr (Cont-1hr—6hr). To count the numbers of motile mitochondria and measure the length of stationary mitochondria in the axon, a kymograph was generated using the sequential images obtained using Fiji.

Our experimental paradigm for in vitro OGD treatment of DRG cultures is shown in Fig. 1A.

Quantification of mitochondrial dynamics

Time-lapse images were processed using Fiji software, and kymographs were generated as described previously [Miller and Sheetz 2004]. We measured the number of motile mitochondria for 20 min and the lengths of stationary mitochondria in the kymograph. Stationary mitochondria were represented by vertical lines on the kymographs and motile mitochondria appeared as diagonal lines. The lengths of stationary mitochondria were measured as the vertical length labeled by DsRed2 at each stationary mitochondrion and converted to micrometers (Fig. 1B).

Transmission electron microscopy

We used cultured DRGs with decreasing length of axonal mitochondria by six-hour OGD exposure, along with sham-treated controls, to study the detailed structures of the axonal mitochondria. Both samples were fixed using 4% PFA containing 1% glutaraldehyde in 0.1 M cacodylate buffer overnight at 4°C. After washing with distilled water, the enhanced samples were post-fixed in 1% OsO₄ for 90 min at room temperature. The samples were then dehydrated in graded ethanol solutions, embedded in epoxy resin, and cut into ultrathin sections using an ultramicrotome (MT6000; Dupont, Wilmington, DE, USA). The ultrathin sections were then stained with uranyl acetate and lead citrate, and examined using a transmission electron microscope (JEM-1400, JEOL Ltd., Tokyo, Japan).

To assess neural condition, nucleus in neural cell body was observed. Aspect ratio of axonal mitochondria is compared as [(major axis) / (minor axis)] with Fiji by manual tracing, to clear morphological change to sphere in mitochondria by OGD exposure [Picard et al. 2013].

Data analysis

Values are presented as means ± standard deviations (SD) in the text and error bars show means and the 95% confidence interval in figures. Statistical analysis was undertaken using one-way analyses of variance (one-wat ANOVAs) and Bonferroni corrections to compare three or more groups or T-test to compare two groups. The statistical analyses were performed using EZR ver.1.53 (Saitama Medical Center, Jichi Medical University, http://www.jichi.ac.jp/saitama-sct/SaitamaHP.files/statmedEN.html, Saitama, Japan) [Kanda 2013].

Axonal swelling, an indication of axonal degeneration, was not observed in axon reacted with anti-neurofilament antibody by immunohistochemical staining (Fig. 2A). TEM imaging showed clear neural nucleus, suggesting that no signs of necrosis or apoptosis were detected (Fig. 2B). These results represent that cultured neuron, including axon and cell body, from DRG is not died while OGD exposure for 6 hours.

We obtained Kymographs of time-lapse imaging of control from 17 axons/ 7 dishes and OGD from 21 axons/ 8 dishes. The counted number of motile and stationary mitochondria in Kymographs of time-lapse imaging from control or OGD are as follows: Cont-pre, 271 motile mitochondria/ 156 stationary mitochondria; Cont-1hr, 305/ 169; Cont-2hr, 286/ 172; Cont-3hr, 282/ 172; Cont-4hr, 281/ 177, Cont-5hr, 304/ 185; Cont-6hr, 284/ 181; OGD-pre, 354/ 215; OGD-1hr, 143/ 246; OGD-2hr, 130/ 247; OGD-3hr, 86/267; OGD-4hr, 61/ 274; OGD-5hr, 24/ 292; OGD-6hr, 10/ 309

OGD lower the number of motile axonal mitochondria

To explore the effect of OGD on living axonal mitochondria, we observed axonal mitochondria labeled with mitochondria-targeted fluorescent construct by treating cultured DRG neurons with a lentivirus. We transfected pDsRed2-Mito by lentivirus into our DRG cultures at 28 DIV and maintained the cultures for a further 2 to 3 weeks, to 42—49 DIV. Mitochondrial motility was assessed using time-lapse imaging. In control, the rate of motile mitochondria was no difference through observation time. In contrast, the rate of motile mitochondria was significantly reduced one hour after OGD exposure (Fig. 3A and B). Since OGD reduces the number of motile mitochondria in peripheral axons, we calculate the percentage of axons without motile mitochondria in OGD group. Some axon loss motile mitochondria one hour after OGD exposure and the ratio of the axons without motile mitochondria increase in time-dependent manner. The axon without motile mitochondria was observed one hour after OGD exposure. In particular, four-hour or more OGD exposure induces over 50% axons perfectly loss of motile mitochondria in our culture system (Fig. 3C).

Axonal motile mitochondria were seen to move in both directions (anterograde and retrograde). Our data did not detect a preferred direction; neither did we see selective inhibition by OGD of one direction over the other [Kikuchi et al. 2018]. Motile mitochondria moving to both directions are detected in OGD-1hr (the second panel of right lane in Fig. 3A).

Velocity. Significant differences were not detected by one-way ANOVA. The velocities of motile mitochondria in control collected on 17 axons/ 7 dishes were as follows: 1.04 ± 0.17 µm/s for Cont-pre (n = 271 mitochondria); 1.08 ± 0.24 µm/s for Cont-1hr (n = 305); 1.14 ± 0.29 µm/s for Cont-2hr (n = 286); 1.08 ± 0.22 µm/s for Cont-3hr (n = 282); 1.10 ± 0.20 µm/s for Cont-4hr (n = 281); 1.14 ± 0.21 µm/s for Cont-5hr (n = 304); 1.05 ± 0.28 µm/s for Cont-6hr (n = 284). The velocities in OGD collected on 21 axons/ 8 dishes were as follows: 0.923 ± 0.16 µm/s for OGD-pre (n = 354 mitochondria); 0.77 ± 0.24 µm/s for OGD-1hr (n = 143); 0.87 ± 0.30 µm/s for OGD-2hr (n = 130); 0.78 ± 0.44 µm/s for OGD-3hr (n = 86); 0.69 ± 0.27 µm/s for OGD-4hr (n = 61); 0.70 ± 0.27 µm/s for OGD-5hr (n = 24); 0.83 ± 0.44 µm/s for OGD-6hr (n = 10).

OGD reduce the average length of stationary mitochondria in cultured axon

Both of motile and stationary mitochondria are detected in our cultured peripheral axons. The length of stationary mitochondria is susceptible to surrounding or internal influence [Chiang et al. 2015; Kikuchi et al. 2018; Kiryu-Seo et al. 2010; Ohno et al. 2011]. In our result, statistical significance about the length of stationary mitochondria is detected only between control and OGD-6hr. In stationary mitochondria, six-hour OGD exposure induces significant shortening of axonal stationary mitochondria (Fig. 2A and Fig. 4).

The number of motile mitochondria decrease one hour after OGD exposure, and some motile mitochondria should stop in axon. In general, motile mitochondria is smaller than stationary mitochondria [Hollenbeck and Saxton 2005]. In our data suggested that motile mitochondria were significantly shorter than stationary mitochondria in Cont-pre and OGD-pre(Fig. 5A). The result means that the average length of stationary mitochondria significantly decreases, due to shorter motile mitochondria stopping and being stationary mitochondria in axons.

When we think the dynamics of mitochondria, the fusion and fission are the most attention thing [Berman et al. 2009; van der Bliek et al. 2013]. The fission was detected during our observation and the stationary mitochondria after fission kept in the range of interest thorough observation (Fig. 5B).

In our observation, the stationary mitochondria become shorter and kept their form over the experiment (Fig. 5C).

OGD increase sphere form mitochondria in axon

In microscopic observations, the average length of stationary mitochondria decreases 6 hours after OGD exposure in axons. To confirm whether morphological change of mitochondria occurs or not, we observed the microstructure of mitochondria in axons by transmission electron microscope (TEM) (Fig. 6A, B and C1—3). We compared aspect ratio of axonal mitochondria in control to OGD-6hr (Fig. 7A). The averages of aspect ratio were significantly large in control than OGD-6hr, 4.82 ± 2.42 for control (n = 178 mitochondria / 3 dishes) and 2.73 ± 2.04 for OGD-6hr (n = 172 / 3) (Fig. 7B). The aspect ratio of mitochondria smaller than 2 were 50% or more in OGD-6hr (Fig. 8C and D). The result showed that OGD exposure for 6 hours increase the ratio of sphere mitochondria. The significantly decrease of the aspect ratio in OGD means morphological change of mitochondria from tubular to sphere in axons. Therefore, morphological change of axonal mitochondria from tubular to sphere form is responsible for reducing the length of stationary mitochondria. The result showed that the decrease of mitochondrial lengths is due to increasing occupancy of sphere mitochondria in axons exposed to OGD.

Considering the results obtained from time-lapse and TEM images together, reducing the length of axonal mitochondria induced by OGD exposure is due to morphological change of axonal mitochondria from tubular to sphere form. And then, the morphological change is due to stop of motile mitochondria, mitochondrial fission and shortness of stationary mitochondria themselves in OGD exposed axons.

In this study, we used time-lapse imaging to observe mitochondria dynamics in living single non-myelinated axon while oxygen-glucose deprivation (OGD) or normal culture conditions (control). Medium exchanges to set the conditions for OGD and control groups were same timing, because to avoid the effect to cells by simply medium exchange [Tornabene et al. 2019]. Therefore, the differences detected in our data suggest the effect by OGD.

To reveal the effect of OGD in living axonal mitochondria, we observed mitochondria labeled with mitochondria-targeted fluorescent construct by treating cultured DRG neurons with a lentivirus. We transfected pDsRed2-Mito by lentivirus into our DRG cultures at 28 DIV and maintained the cultures for a further 2 to 3 weeks, to 42—49 DIV. Mitochondrial motility was assessed using time-lapse imaging [Kikuchi et al. 2018]. The results showed that OGD exposure induces significantly inhibition of motile mitochondria within one hour and then shortening of the length of stationary mitochondria in axon. To confirm the ultrastructure of axonal mitochondria, we observed ultrastructure of mitochondria with TEM. Axonal mitochondria are well detected, neither the signs of degeneration in axons nor neural nucleus. These results showed that six-hour OGD exposure influences axonal mitochondria without neuropathological signs. We previously reported that cobalt or capsaicin induced destruction mitochondrial dynamics in axons and the changes of axonal mitochondria are lowering rate of motile mitochondria and decrease of length of stationary mitochondria in axons [Chiang et al. 2015; Kikuchi et al. 2018]. OGD, used in this study, is widely used in an in vivo model for ischemia [Tasca et al. 2015]. Axonal degeneration induced by peripheral ischemia is more popular disease than our previous our reports [Chiang et al. 2015; Kikuchi et al. 2018], therefore the results reported in this paper shows common and ubiquitous process of axonal degeneration [Stecker and Stevenson 2015].

We observed axonal mitochondria at 7 sets of 20 min in one experiment and there were 40 min gap between each set. It means that we could not every event occurred in axonal mitochondria during OGD. Therefore, we present the data which we could obtain during observations. In our results, three reasons of length-shortening of stationary mitochondria were observed; first, stop of motile mitochondria; second, fission of longer stationary mitochondria; third, shrink of stationary mitochondria themselves (Fig. 8). The symptoms of axonal degeneration, like a swelling, was not observed in axons exposed with OGD for 6 hours. The data strongly suggests that axonal degeneration, induced by local ischemia, happened following loss of dynamics of axonal mitochondria [Berbusse et al. 2016].

The inhibition of motile mitochondria means losing response in energy demand in axon or synapse button [Pathak et al. 2015; Sheng 2017] and salvaging old mitochondria for mitophagy at neural cell body [Xu et al. 2021]. Mitochondria transport in axons is very important to supply ATP to meet the energy demand in local part of axon and control synaptic activity [Chamberlain and Sheng 2019]. Not enough mitochondria supply induces functional loss of axon and synapse [Chamberlain and Sheng 2019]. Suppression of motile mitochondria occurs immediately after, at least one-hour after, OGD exposure. Therefore, the dysfunction of motile mitochondria is observed in early stage of OGD, mimicking ischemia, in axon.

Shortening of stationary mitochondria in axon is reported in some previous reports [Bastian et al. 2018a, b; Chiang et al. 2015; Kikuchi et al. 2018; Kiryu-Seo et al. 2010; Ohno et al. 2011]. Almost reports noted that fission rate of mitochondria increased under some stresses. Berbusse reported that mitochondrial fragmentation is likely a result of the combined decrease in mitochondrial fission, fusion and motility [Ko et al. 2021]. In our study, fission of mitochondria observed as one reason of shortening of stationary-mitochondria length. A dynamic balance of fusion and fission of mitochondria is very important to keep mitochondrial morphology and function [Karbowski et al. 2004]. Decreasing rate of motile mitochondria in axons exposed to OGD is observed in our study, in addition to the fission of axonal mitochondria. Furthermore, mitochondrial morphological change is observed and the change is occurred by tubular mitochondria changing to sphere mitochondria. Our obtaining data does not fully collect mitochondria event during OGD. However, the limited data, which we obtained in present study, showed that mitochondria shortening causes by stop of motile mitochondria, fission or/and morphological change of stationary mitochondria induce mitochondria shortening with statistical significance at six-hour OGD exposure.

Time-lapse data shows that lowering ratio of motile mitochondria is observed before length shortening of stationary mitochondria in axons during OGD exposure. Our previous report shows cobalt ion induces lowering motile mitochondria before fragmentation of stationary mitochondria [Kikuchi et al. 2018]. Our findings in conjunction with our previous studies lead to a model of disruption of mitochondrial dynamics in OGD exposing axons, which is motile mitochondria is disturbed earlier than stationary mitochondria shortening [Kikuchi et al. 2018].

It is clear that OGD induces axon degeneration [Jin et al. 2000], but it is unclear whether the disruption of mitochondrial dynamics induced by OGD directly affects axon degeneration. OGD induces drastic changes to axon in CNS and PNS, like calcium ion increase, ATP decrease and oxidative stress [Baltan 2014; Wang et al. 2002]. Functional disruption of neural mitochondria induces some neural diseases [Cai and Tammineni 2016; Campbell et al. 2014; Cherubini and Ginés 2017; Lopez Sanchez et al. 2016]. Especially, Charcot-Marie-Tooth (CMT)2A, which is one of hereditary motor sensory neuropathy (HMSN), is caused by mutations in the MFN2 gene. Animal models with MFN2 mutations have abnormal mitochondrial structure and induce axonal degeneration [Baloh 2008; Bobylev et al. 2018]. In molecular level, Bastian et al reported that Dynamin Related Protein-1 (Drp-1), enhance the fission of mitochondria, is translocated to mitochondria from cytoplasm during OGD in optic nerve [Bastian et al. 2018a]. Some reports showed the molecules to participate in mitochondrial fusion and fission [Kraus et al. 2021; Rey et al. 2022; Song et al. 2022]. In addition, it is clear that some molecules are detected as modules to transfer or stop motile mitochondria [Granatiero and Manfredi 2019; Maday et al. 2014; Sheng 2017]. However, it is unclear whether or not molecules are involved in morphological changes of axonal mitochondria from tubular to sphere in axon exposed to OGD. Mitochondria fragmentation or failure of mitochondrial dynamics is a step in the axonal degeneration induced by vincristine [Berbusse et al. 2016]. Our results are thus consistent with those of previous reports, which indicate that loss of mitochondrial dynamics is observed earlier than axonal degeneration signs. However, we are not able to control other effect induced by OGD that may lead to axonal degeneration. The possibility of a direct relationship between mitochondrial destruction and neurodegeneration induced by OGD warrants further investigation.

In summary, our results conclude that OGD, mimicking ischemia, induces inhibition of motile mitochondria earlier than shortening of stationary mitochondria in peripheral non-myelinated axons. In addition, the shortening of stationary mitochondria induced with OGD results from three reasons; stop of motile mitochondria, fusion of longer stationary mitochondria and shrink of stationary mitochondria themselves. These mitochondrial disruptions in non-myelinated axons under OGD are observed without observation of neuropathological signs. It means that our data suggested that axonal mitochondria in ischemia are target for neuroprotective strategy.

Acknowledgment

We wish to thank H. Okushima and Y. Hayakawa of Sapporo Medical University for technical support.

Grant support

This work was supported by grants from the Ministry of Education, Culture, Sports, Science and Technology of Japan (15K01419 and 18K10678) to S. Kikuchi, (19K05736) to T. Kohno, (19K07464) to T. Kojima and (21K06733) to Y. Ohsaki.

Autor Contribution

S. Kikuchi and T. Ninomiya designed the experiments; S. Kikuchi, T. Kohno, T. Kojima and T. Ninomiya performed research and analyzed data; S. Kikuchi, H. Tatsumi, Y. Ohsaki and T. Ninomiya wrote the paper.

Baloh RH (2008) Mitochondrial dynamics and peripheral neuropathy. Neuroscientist 14: 12-18. https://doi.org/10.1177/1073858407307354
Baltan S (2014) Excitotoxicity and mitochondrial dysfunction underlie age-dependent ischemic white matter injury. Adv Neurobiol 11: 151-170. https://doi.org/10.1007/978-3-319-08894-5_8
Bastian C, Politano S, Day J, McCray A, Brunet S, Baltan S (2018a) Mitochondrial dynamics and preconditioning in white matter. Cond Med 1: 64-72
Bastian C, Zaleski J, Stahon K, Parr B, McCray A, Day J, Brunet S, Baltan S (2018b) NOS3 Inhibition Confers Post-Ischemic Protection to Young and Aging White Matter Integrity by Conserving Mitochondrial Dynamics and Miro-2 Levels. J Neurosci 38: 6247-6266. https://doi.org/10.1523/JNEUROSCI.3017-17.2018
Berbusse GW, Woods LC, Vohra BP, Naylor K (2016) Mitochondrial Dynamics Decrease Prior to Axon Degeneration Induced by Vincristine and are Partially Rescued by Overexpressed cytNmnat1. Front Cell Neurosci 10: 179. https://doi.org/10.3389/fncel.2016.00179
Berman SB, Chen YB, Qi B, McCaffery JM, Rucker EB, Goebbels S, Nave KA, Arnold BA, Jonas EA, Pineda FJ, Hardwick JM (2009) Bcl-x L increases mitochondrial fission, fusion, and biomass in neurons. J Cell Biol 184: 707-719. https://doi.org/10.1083/jcb.200809060
Bobylev I, Joshi AR, Barham M, Neiss WF, Lehmann HC (2018) Depletion of Mitofusin-2 Causes Mitochondrial Damage in Cisplatin-Induced Neuropathy. Mol Neurobiol 55: 1227-1235. https://doi.org/10.1007/s12035-016-0364-7
Cai Q, Tammineni P (2016) Alterations in Mitochondrial Quality Control in Alzheimer's Disease. Front Cell Neurosci 10: 24. https://doi.org/10.3389/fncel.2016.00024
Campbell GR, Worrall JT, Mahad DJ (2014) The central role of mitochondria in axonal degeneration in multiple sclerosis. Mult Scler 20: 1806-1813. https://doi.org/10.1177/1352458514544537
Castiglione JI, Marrodan M, Alessandro L, Taratuto AL, Brand P, Nogués M, Barroso F (2021) Vasculitic Peripheral Neuropathy, Differences Between Systemic and Non-Systemic Etiologies: A Case Series and Biopsy Report. J Neuromuscul Dis 8, 155-161. https://doi.org/10.3233/JND-200576
Chamberlain KA, Sheng ZH (2019) Mechanisms for the maintenance and regulation of axonal energy supply. J Neurosci Res 97, 897-913. https://doi.org/10.1002/jnr.24411
Cherubini M, Ginés S (2017) Mitochondrial fragmentation in neuronal degeneration: Toward an understanding of HD striatal susceptibility. Biochem Biophys Res Commun 483: 1063-1068. https://doi.org/10.1016/j.bbrc.2016.08.042
Chiang H, Ohno N, Hsieh YL, Mahad DJ, Kikuchi S, Komuro H, Hsieh ST, Trapp BD (2015) Mitochondrial fission augments capsaicin-induced axonal degeneration. Acta Neuropathol 129: 81-96. https://doi.org/10.1007/s00401-014-1354-3
Coderre TJ (2011) Complex regional pain syndrome: what's in a name? J Pain 12: 2-12. https://doi.org/10.1016/j.jpain.2010.06.001
Coderre TJ, Bennett GJ (2010) A hypothesis for the cause of complex regional pain syndrome-type I (reflex sympathetic dystrophy): pain due to deep-tissue microvascular pathology. Pain Med 11: 1224-1238. https://doi.org/10.1111/j.1526-4637.2010.00911.x
Collins MP, Hadden RD (2017) The nonsystemic vasculitic neuropathies. Nat Rev Neurol 13: 302-316. https://doi.org/10.1038/nrneurol.2017.42
Dyck PJ, Benstead TJ, Conn DL, Stevens JC, Windebank AJ, Low PA (1987) Nonsystemic vasculitic neuropathy. Brain 110 (Pt 4): 843-853. https://doi.org/10.1093/brain/110.4.843
Fabricius C, Berthold CH, Rydmark M (1993) Axoplasmic organelles at nodes of Ranvier. II. Occurrence and distribution in large myelinated spinal cord axons of the adult cat. J Neurocytol 22: 941-954. https://doi.org/10.1007/BF01218352
Fex Svenningsen A, Shan WS, Colman DR, Pedraza L (2003) Rapid method for culturing embryonic neuron-glial cell cocultures. J Neurosci Res 72: 565-573. https://doi.org/10.1002/jnr.10610
Fulas OA, Laferrière A, Coderre TJ (2021) Novel Co-crystal of Pentoxifylline and Protocatechuic Acid Relieves Allodynia in Rat Models of Peripheral Neuropathic Pain and CRPS by Alleviating Local Tissue Hypoxia. ACS Chem Neurosci 12: 3855-3863. https://doi.org/10.1021/acschemneuro.1c00312
Granatiero V, Manfredi G (2019) Mitochondrial Transport and Turnover in the Pathogenesis of Amyotrophic Lateral Sclerosis. Biology (Basel): 8. https://doi.org/10.3390/biology8020036
Hollenbeck PJ, Saxton WM (2005) The axonal transport of mitochondria. J Cell Sci 118, 5411-5419. https://doi.org/10.1242/jcs.02745
Jin KL, Mao XO, Greenberg DA (2000) Vascular endothelial growth factor: direct neuroprotective effect in in vitro ischemia. Proc Natl Acad Sci U S A 97: 10242-10247. https://doi.org/10.1073/pnas.97.18.10242
Kanda Y (2013) Investigation of the freely available easy-to-use software 'EZR' for medical statistics. Bone Marrow Transplant 48: 452-458. https://doi.org/10.1038/bmt.2012.244
Karbowski M, Arnoult D, Chen H, Chan DC, Smith CL, Youle RJ (2004) Quantitation of mitochondrial dynamics by photolabeling of individual organelles shows that mitochondrial fusion is blocked during the Bax activation phase of apoptosis. J Cell Biol 164: 493-499. https://doi.org/10.1083/jcb.200309082
Kikuchi S, Ninomiya T, Kohno T, Kojima T, Tatsumi H (2018) Cobalt inhibits motility of axonal mitochondria and induces axonal degeneration in cultured dorsal root ganglion cells of rat. Cell Biol Toxicol 34: 93-107. https://doi.org/10.1007/s10565-017-9402-0
Kiryu-Seo S, Ohno N, Kidd GJ, Komuro H, Trapp BD (2010) Demyelination increases axonal stationary mitochondrial size and the speed of axonal mitochondrial transport. J Neurosci 30: 6658-6666. https://doi.org/10.1523/JNEUROSCI.5265-09.2010
Ko KW, Devault L, Sasaki Y, Milbrandt J, DiAntonio A (2021) Live imaging reveals the cellular events downstream of SARM1 activation. Elife: 10. https://doi.org/10.7554/eLife.71148
Kraus F, Roy K, Pucadyil TJ, Ryan MT (2021) Function and regulation of the divisome for mitochondrial fission. Nature 590: 57-66. https://doi.org/10.1038/s41586-021-03214-x
Lopez Sanchez MI, Crowston JG, Mackey DA, Trounce IA (2016) Emerging Mitochondrial Therapeutic Targets in Optic Neuropathies. Pharmacol Ther 165: 132-152. https://doi.org/10.1016/j.pharmthera.2016.06.004
Lubana SS, Singh N, Sanelli-Russo S, Abrudescu A (2015) Non-Systemic Vasculitic Neuropathy: An Enigmatic Clinical Entity. Am J Case Rep 16: 449-453. https://doi.org/10.12659/AJCR.894601
Maday S, Twelvetrees AE, Moughamian AJ, Holzbaur EL (2014) Axonal transport: cargo-specific mechanisms of motility and regulation. Neuron 84: 292-309. https://doi.org/10.1016/j.neuron.2014.10.019
Miller KE, Sheetz MP (2004) Axonal mitochondrial transport and potential are correlated. J Cell Sci 117: 2791-2804. https://doi.org/10.1242/jcs.01130
Morris RL, Hollenbeck PJ (1995) Axonal transport of mitochondria along microtubules and F-actin in living vertebrate neurons. J Cell Biol 131: 1315-1326. https://doi.org/10.1083/jcb.131.5.1315
Nicholls DG, Budd SL (2000) Mitochondria and neuronal survival. Physiol Rev 80: 315-360. https://doi.org/10.1152/physrev.2000.80.1.315
Ohno N, Kidd GJ, Mahad D, Kiryu-Seo S, Avishai A, Komuro H, Trapp BD (2011) Myelination and axonal electrical activity modulate the distribution and motility of mitochondria at CNS nodes of Ranvier. J Neurosci 31: 7249-7258. https://doi.org/10.1523/JNEUROSCI.0095-11.2011
Pathak D, Shields LY, Mendelsohn BA, Haddad D, Lin W, Gerencser AA, Kim H, Brand MD, Edwards RH, Nakamura K (2015) The role of mitochondrially derived ATP in synaptic vesicle recycling. J Biol Chem 290: 22325-22336. https://doi.org/10.1074/jbc.M115.656405
Picard M, Gentil BJ, McManus MJ, White K, St Louis K, Gartside SE, Wallace DC, Turnbull DM (2013) Acute exercise remodels mitochondrial membrane interactions in mouse skeletal muscle. J Appl Physiol (1985) 115: 1562-1571. https://doi.org/10.1152/japplphysiol.00819.2013
Rey F, Ottolenghi S, Zuccotti GV, Samaja M, Carelli S (2022) Mitochondrial dysfunctions in neurodegenerative diseases: role in disease pathogenesis, strategies for analysis and therapeutic prospects. Neural Regen Res 17, 754-758. https://doi.org/10.4103/1673-5374.322430
Sheng ZH (2017) The Interplay of Axonal Energy Homeostasis and Mitochondrial Trafficking and Anchoring. Trends Cell Biol 27: 403-416. https://doi.org/10.1016/j.tcb.2017.01.005
Sommer C, Geber C, Young P, Forst R, Birklein F, Schoser B (2018) Polyneuropathies. Dtsch Arztebl Int 115: 83-90. https://doi.org/10.3238/arztebl.2018.083
Sommer CJ (2017) Ischemic stroke: experimental models and reality. Acta Neuropathol 133: 245-261. https://doi.org/10.1007/s00401-017-1667-0
Song M, Zhou Y, Fan X (2022) Mitochondrial Quality and Quantity Control: Mitophagy Is a Potential Therapeutic Target for Ischemic Stroke. Mol Neurobiol: https://doi.org/10.1007/s12035-022-02795-6
Stecker MM, Stevenson M (2015) Effects of pH on the response of peripheral nerve to anoxia. Int J Neurosci 125: 221-227. https://doi.org/10.3109/00207454.2014.922971.
Tasca CI, Dal-Cim T, Cimarosti H (2015) In vitro oxygen-glucose deprivation to study ischemic cell death. Methods Mol Biol 1254: 197-210. 10.1007/978-1-4939-2152-2_15.
Tornabene E, Helms HCC, Pedersen SF, Brodin B (2019) Effects of oxygen-glucose deprivation (OGD) on barrier properties and mRNA transcript levels of selected marker proteins in brain endothelial cells/astrocyte co-cultures. PLoS One 14: e0221103. https://doi.org/10.1371/journal.pone.0221103.
Ubogu EE (2020) Biology of the human blood-nerve barrier in health and disease. Exp Neurol 328; 113272. https://doi.org/10.1016/j.expneurol.2020.113272.
van der Bliek, AM, Shen Q, Kawajiri S (2013) Mechanisms of mitochondrial fission and fusion. Cold Spring Harb Perspect Biol 5: https://doi.org/10.1101/cshperspect.a011072.
Wang C, Nguyen HN, Maguire JL, Perry DC (2002) Role of intracellular calcium stores in cell death from oxygen-glucose deprivation in a neuronal cell line. J Cereb Blood Flow Metab 22: 206-214. https://doi.org/10.1097/00004647-200202000-00008.
Xu M, Feng J, Tang M, Guo Q, Zhan J, Zhu F, Lei H, Kang Q (2021) Blocking retrograde axonal transport of autophagosomes contributes to sevoflurane-induced neuron apoptosis in APP/PS1 mice. Acta Neurol Belg 121: 1207-1215. https://doi.org/10.1007/s13760-020-01359-6

No competing interests reported.

Download PDF

Editor assigned by journal
09 Apr, 2022
Submission checks completed at journal
08 Apr, 2022
First submitted to journal
08 Apr, 2022

You are reading this latest preprint version

Oxygen-Glucose Deprivation (OGD) decreases the motility and length of Axonal Mitochondria in Cultured Dorsal Root Ganglion Cells of Rat

Status:

Version 1

Abstract

Figures

Introduction

Materials And Method

Ethics Statement

Primary Dorsal Root Ganglion (DRG) culture

Lentiviral preparation

Observation of mitochondria in DRG axons and oxygen-glucose deprivation

Quantification of mitochondrial dynamics

Transmission electron microscopy

Data analysis

Results

OGD lower the number of motile axonal mitochondria

OGD reduce the average length of stationary mitochondria in cultured axon

OGD increase sphere form mitochondria in axon

Discussion

Declarations

References

Additional Declarations

Status:

Version 1