Animals
Healthy male Wistar rats (Beijing Vital River Laboratory Animal Technology Co., Ltd. Beijing, China) aged 8-10 weeks and weighing 253±13 g were used in this study. Animal experiments were approved by the Laboratory Animal Care and Use Committee of Tianjin Medical University, Tianjin, People’s Republic of China and conducted according to the Guide for the Care and Use of Laboratory Animals published by the US National Institutes of Health (NIH Publication No. 85-23, revised 1996). Rats were housed in a specific animal breeding room at 24 °C with luminosity cycles of 12 h light/dark and 60 % relative humidity. They had been given ad libitum access to water and standard rat chow.
Establishment of the I/R and IPC model in vivo
The myocardial I/R model was established by occluding the left anterior descending (LAD) coronary artery in rats for 30 min followed by 120 min reperfusion and IPC was induced by three cycles of 5 min ischemia and 5 min reperfusion of the LAD as previously described[5]. Successful occlusions were verified by observing the development of ST-segment elevation on electrocardiogram (ECG). Sham-operated rats were received as controls.
Isolation of circulating MVs
Circulating IPC-MVs and Sham-MVs were isolated from the blood of rats subjected to IPC or Sham treatment as reported previously[6]. Briefly, healthy male Wistar rats were divided into two groups randomly with n=5 each: (1) Sham-MV group: rats were left untreated for 45 min after a silk ligature was placed around the LAD coronary artery, the blood was drawn from abdominal aorta after 45 min. (2) IPC-MV group: rats were subjected to three cycles of 5 min ischemia and 5 min reperfusion of LAD after being untreated for 15 min, then the blood was drawn from abdominal aorta at once. The blood samples in two groups were collected in sodium citrate coated tubes and centrifugated at 2,600 g, 15 min and 10,000 g, 5 min at room temperature to obtain platelet-free plasma (PFP). Ninety μL PFP was collected and stored at -80 ℃ after fixed with paraformaldehyde (PFA) to a final concentration of 1 % for 1 h at room temperature for flow cytometry, the remaining PFP was ultracentrifuged at 100,000 g, 4 ℃ for 150 min, the supernatant was removed to obtain Sham-MVs and IPC-MVs. The pellet of MVs was resuspended in 100 μL 0.9% sodium chloride and stored at -80 °C. Rats were sacrificed by acute arterial hemorrhage.
Transmission electron microscopy (TEM)
TEM of circulating IPC-MVs and Sham-MVs was conducted as described previously[6]. Briefly, 40 μL MV resuspension was dropped on the carbon-coated copper grids, then grids were blotted dry with filter paper. For negative staining, 40 μL 2% phosphotungstic acid (pH 6.5) was used to stain for 2 min. After drying under the incandescent light, morphology of MVs was viewed in a HT7700 TEM (Hitachi, Japan), and the images were obtained using a digital camera (Olympus, Japan).
Flow cytometry analysis
Flow cytometry analysis was performed as described previously[6]. Briefly, 1 μm and 2 μm standard microspheres (Molecular Probe, Invitrogen, Carlsbab, CA, USA) were used to describe and calculate counts of IPC-MVs and Sham-MVs, an Accuri C6 flow cytometry (BD Biosciences, Franklin Lakes, NJ, USA) was used for analysis. Dot plots of forward scatter (FSC) versus side scatter (SSC) were established. Events <1 μm in diameter were defined as MVs. MVs could be counted by 2 μm beads with known concentration. Flow cytometric results were analyzed by FlowJo 7.6 software. The absolute count of MVs was calculated with the formula: MVs/μL = [events counted by flow cytometer´(beads added/beads counted by flow cytometer)]/sample volume.
Cell culture and establishment of the H/R and hypoxic preconditioning (HPC) model of H9c2 cells in vitro
H9c2 cells (ATCC, Manassas, VA, USA) were cultured in DMEM (Gibco, CA, USA) supplemented with 10 % FBS (Gibco, CA, USA) and 1 % Penicillin/Streptomycin under standard cell culture conditions (37 °C, 5 % CO2). All procedures were performed in accordance with the Declaration of Helsinki of the World Medical Association and the research protocol was approved by Ethics Committee of Tianjin Medical University.
For the H/R injury model, H9c2 cells were stimulated by H/R as previously described[17]. Briefly, H9c2 cells were subjected to hypoxic buffer (in mM: 0.9 NaH2PO4, 6.0 NaHCO3, 1.0 CaCl2, 1.2 MgSO4, 98.5 NaCl, 10.0 KCl, 20.0 HEPES, 40.0 sodium lactate, pH 6.2) in a hypoxic chamber (95 % N2-5 % CO2, Billups-Rothenberg, Del Mar, CA, USA) in 37 °C for 12 h followed by reoxygenation under standard cell culture conditions for 4 h. The control group was maintained in control buffer (in mM: 0.9 NaH2PO4, 20.0 NaHCO3, 1.0 CaCl2, 1.2 MgSO4, 129.5 NaCl, 5.0 KCl, 20.0 HEPES, 5.5 glucose, pH 7.4) under standard cell culture conditions for 16 h.
For the HPC model, H9c2 cells were transferred between hypoxic and normoxic conditions for five cycles as described previously[18]. Briefly, cells were placed into the hypoxic chamber under hypoxic buffer (pH 6.8) incubating with 95 % N2-5 % CO2 for 10 min, then were cultured normally in 37 °C, 5 % CO2 for 15 min.
Cell transfection
The FAM-miR-133a-3p mimics or miR-133a-3p mimics, inhibitor and negative control (NC) miRNAs (GenePharma, Shanghai, China) were transfected into H9c2 cells using Lipofectamine 2000 (Invitrogen, USA) according to the manufacturer’s instructions. The work concentration of mimics and mimics NC was 50 nM, whereas that of inhibitor and inhibitor NC was 100 nM. The transfection medium was refreshed after 6 h, and cells were harvested for total RNAs and proteins extraction after being cultured for 24 h. The efficiency of mimics or inhibitor was confirmed by qRT-PCR. Following that, the level of EGFR mRNA and the expression of EGFR protein were detected by qRT-PCR and Western blot, respectively. Meanwhile, after being transfected for 24 h, H9c2 cells were treated with H/R injury for further study.
Treatment with IPC-MVs on I/R injured rats in vivo
Rats were anesthetized intraperitoneally by 25% ethyl carbamate, then performed a thoracotomy before ligation of LAD coronary artery. The ends of the silk suture were passed through a polyethylene tube, which was used to occlude the LAD by pulling the thread. After achieving hemodynamic stability for 15 min, all rats were divided into four groups randomly with n=5 each. (1) Sham group, rats were left untreated for 145 min after a silk ligature was placed around the LAD. (2) I/R group, rats received I/R process. (3) Sham-MV + I/R group, Sham-MVs (7 mg/kg) were infused via the femoral vein in I/R injured rats. (4) IPC-MV + I/R group, IPC-MVs (7 mg/kg) were infused via the femoral vein in I/R injured rats. The same volume of 0.9% sodium chloride was given to Sham and I/R groups. All treatments began at 25-min ischemia, with additional 1 min infusion.
Treatment with IPC-MVs on H/R injured H9c2 cells in vitro
H9c2 cells were cultured under normal condition for 24 h, and were divided into four groups. (1) Control group, control buffer (pH 7.4) was added. (2) H/R group, hypoxic buffer (pH 6.2) was added. (3) Sham-MV + H/R group, hypoxic buffer (pH 6.2) with Sham-MVs (100 μg/mL) was added. (4) IPC-MV + H/R group, hypoxic buffer (pH 6.2) with IPC-MVs (100 μg/mL) was added. H9c2 cells in all groups were exposed to 12 h of hypoxia and 4 h of reoxygenation except Control group.
Measurement of myocardial infarct size
Hearts were ligated at 120 min after reperfusion, before the injection of 0.6% trypan blue solution via femoral vein, then cut off immediately. Hearts were washed in normal saline (NS) before frozen at -20 ℃ for 30 min, sliced into 1-mm-thick sections transversely from apex to base, and then incubated with 1% TTC (Sigma-Aldrich, St. Louis, MO, USA) at 37 ℃ for 15 min and finally incubated with 10 % formalin solution for 24 h. The infarct size (IS) was gray and the area at risk (AAR) was brick red. IS and AAR were isolated and weighted, respectively, then the ratio of IS to AAR (IS/AAR%) was calculated as the infarct size.
Cell viability assay
Cell viability was determined using methyl thiazolyl tetrazolium (MTT, Solarbio, Beijing, China) method. After treatment with H/R injury, H9c2 cells were incubated with 10 μL 0.5 % MTT solution for 4 h at 37 °C. Then the supernatant was discarded and 150 μL dimethyl sulfoxide was added to each well. Absorbance was measured at a wavelength of 490 nm with a microplate reader (Bio-Rad Laboratories, CA, USA) after the culture plate was shaken at high speed for 10 min.
LDH activity assay
The 0.2 mL blood was drawn from femoral vein at reperfusion 120 min, respectively, then centrifuged at 3000 g at room temperature for 15 min to obtain supernatant. After treatment with H/R injury, H9c2 cell culture supernatant was collected. All the supernatants were measured using LDH assay kit (Jiancheng Bioengineering Institute, Nanjing, China) according to the manufacturer’s instruction.
Caspase 3 activity assay
For detection of the activity of caspase 3, H9c2 cells were lysed at 4 °C for 15 min by caspase 3 lysis buffer (Beyotime, Nanjing, China). Protein extracts of 50 μL were incubated with 50 μL reaction buffer containing caspase 3 substrate (Ac-DEVD-pNA, 2 mM) for 2 h at 37 °C. The absorbance was measured at a wavelength of 405 nm with a multilabel reader (Bio-Tek, Winooski, VT, USA). Caspase 3 activity in H9c2 cells was calculated using the standard curve.
Microarray analysis of circulating MVs
Total RNAs were obtained from the six MV samples (IPC-MVs, n=3, Sham-MVs, n=3), then were quantified by the NanoDrop ND-2000 (Thermo Scientific) and the RNA integrity was detected by Agilent Bioanalyzer 2100 (Agilent Technologies). After all samples passed the quality control analysis, the total RNAs were dephosphorylated, denaturated and then labeled with Cyanine-3-CTP. After purification, the labeled RNAs were hybridized onto the microarray. After being washed, the arrays were scanned using the Agilent Scanner G2505C (Agilent Technologies).
Isolation and quantification of miRNAs from circulating MVs
Total RNAs were extracted from MVs using the miRNeasy kit (Qiagen) according to the manufacturer’s instruction. The yield of RNAs was determined using NanoDrop 2000 (Thermo Scientific, USA), and integrity evaluated using agarose gel electrophoresis. Then reverse transcription was performed with miScript Reverse Transcriptase Kit (Qiagen, Germany) and quantification of miRNAs was performed with QuantiFast® SYBR® Green PCR Kit (Qiagen, Germany). Amplification was performed at 95℃ for 10 min, followed by 30~45 cycles of 95℃ for 10 s, 60℃ for 20 s and 72℃ for 15 s. Each sample was run in triplicate for analysis. miRNA primers were subscribed from Generay Biotech (Generay, PRC), and the levels of miRNA analyzed by qRT-PCR were normalized to that of U6 snRNA. Fold induction was calculated using the Ct method: DDCt= (CtTarget miRNA-CtU6) IPC-MVs - (CtTarget miRNA-CtU6) Sham-MVs, and the final data were derived from 2-DDCt.
HPC-MV preparation and uptake by H9c2 cells
For generating HPC-MVs from miR-133a-3p overexpressed H9c2 cells, the FAM-miR-133a-3p mimics were transfected into cells using Lipofectamine 2000. After 24 h, H9c2 cells were labeled with a fluorescent dye DiI (Beyotime, Nanjing, China) by incubating them in the DiI working solution (5 μM) for 10 min at 37°C, followed by washing with D-hank’s solution. And then HPC-MVs were collected from the hypoxic buffer of H9c2 cells after treatment with HPC as described above. Briefly, hypoxic buffer was centrifuged at 2 700 g, 4°C for 20 min to remove cell debris, followed by ultracentrifugation at 100,000 g, 4℃ for 148 min to obtain HPC-MVs. The pellet was resuspended in 50 μL D-hank’s solution and stored at -80 °C. The protein concentration of MVs was determined by BCA assay (Beyotime, Nanjing, China). Then HPC-MVs (30 μg/mL) were incubated with H9c2 cells for 4 h at 37℃, 4% paraformaldehyde (Solarbio, Beijing) was used for fixing cells, DAPI was used for nucleus staining, and images were collected using a fluorescence microscope (Leica, Germany). HPC-MVs derived from unlabeled H9c2 cells were used as negative control (NC).
qRT-PCR
Cellular RNAs of each group were extracted using Trizol reagent (Invitrogen, USA). The purity of RNAs was determined by OD260/280 using a Nanodrop 2000 (DeNovix, USA), and integrity evaluated using agarose gel electrophoresis. The specific stem-looped qRT-PCR primers for miR-133a-3p were designed by GenePharma Co.Ltd. (Shanghai, China) (The sequences of rno-miR-133a-3p primers were: forward, ATGCTCATTTGGTCCCCTTC; reverse, TATGGTTGTTCTGCTCTCTGTCTC). EGFR and GAPDH primers were subscribed from GENEWIZ (Suzhou, China) (The sequences of rat EGFR primers were: forward, 5’-TCCAACTTTTACCGAGCCCT-3’; reverse, 5’-TCAAGAGTGGAGTCCGTGAC-3’. The sequences of rat GAPDH primers were: forward, 5’-TCGTGGAGTCTACTGGCGTCTT-3’; reverse, 5’- CATTGCTGACAATCTTGAGGGAG-3’). Mature miR-133a-3p levels were measured using SYBR Green Realtime PCR Master Mix (TIANGEN, Beijing, China) according to the manufacturer’s instructions. The stem-loop cDNAs were generated from 1 μg of RNAs using FastQuant cDNA First Chain Synthesis Kit (TIANGEN, Beijing, China). Reverse transcription was performed at 42℃ for 3 min, followed by 42℃ for 15 min, 95℃ for 3 min. Then qRT-PCR was carried out on a CFX96 Real-time System instrument (Bio-Rad, USA). Amplification was performed at 95℃ for 15 min, followed by 40 cycles of 95℃ for 10 s, 60℃ for 32 s. miR-133a-3p and U6 primers were subscribed from GenePharma (Shanghai, China), and the levels of miR-133a-3p analyzed by qRT-PCR were normalized to that of U6 snRNA.
Quantitative detection of EGFR mRNA was also performed by qRT-PCR as described above, and the mRNAs of GAPDH were used for normalization. Each sample was run in triplicate for analysis. Relative expression of miR-133a-3p or EGFR was calculated using the 2-DDCt method.
Western blot
Total proteins were extracted from H9c2 cells of each group with the Western and IP lysis buffer (Beyotime, Nanjing, China) for Western blot. Protein lysates were then centrifuged at 12,000 g for 10 min at 4°C. Total protein quantification was performed using a BCA protein assay. Equal amounts of proteins (20 μg) were separated by 8 % or 10 % SDS electrophoresis, and transferred onto PVDF membranes. Blots were blocked by 5 % skim milk for 2 h at room temperature, then incubated with primary anti-EGFR (Immunoway, USA, 1: 1000), anti-caspase 3 (Cell Signaling Technology, Danvers, MA, USA; 1:1000 dilutions), anti-cleaved caspase 3 (Cell Signaling Technology, Danvers, MA, USA; 1:1000 dilutions), anti-GRP78 (Cell Signaling Technology, Danvers, MA, USA; 1:1000 dilutions), anti-CHOP (Santa Cruz Biotechnology, Inc., CA, USA; 1:500 dilution), anti-caspase 12 (Santa Cruz Biotechnology, Inc., CA, USA; 1:500 dilutions) or anti-b-actin (Cell Signaling Technology, Danvers, MA, USA; 1:1000 dilutions) antibodies overnight at 4 °C, followed by horseradish peroxidase (HRP)-conjugated secondary antibody (Beyotime, Nanjing, China; 1:1000 dilutions) for 2 h, then after chemiluminescent ECL detection (Beyotime, Nanjing, China), analyzed with ImageJ software (NIH, Bethesda MD).
Statistical analysis
The raw data of microarray were analyzed by Feature Extraction software (version 10.7.1.1, Agilent Technologies). Genespring software (version 14.8, Agilent Technologies) was employed to finish the basic analysis with the raw data. Differentially expressed miRNAs were then identified through fold change and P value calculated using t-test. The threshold set for up- and down-regulated genes was a fold change≥2.0 and a P value≤0.05.
All values were expressed as Mean ± standard derivation (SD). An unpaired Student’s t-test was used for statistical analysis between two groups, and one-way analysis of variance (ANOVA) followed by the Tukey post hoc tests was used for multiple groups (>2). P<0.05 was considered significant. Statistical analyses were performed using SPSS 17.0.