Dietary protein replacement of fish meal with black soldier fly larvae meal: Effects on growth, whole-body composition, digestive enzyme activity, muscle-growth-related gene expression and haemato-biochemical responses of juvenile goldfish, Carassius auratus

doi:10.21203/rs.3.rs-1538270/v1

Download PDF

Research Article

Dietary protein replacement of fish meal with black soldier fly larvae meal: Effects on growth, whole-body composition, digestive enzyme activity, muscle-growth-related gene expression and haemato-biochemical responses of juvenile goldfish, Carassius auratus

https://doi.org/10.21203/rs.3.rs-1538270/v1

This work is licensed under a CC BY 4.0 License

Version 1

posted

You are reading this latest preprint version

A 60-day indoor growth trial was carried out to investigate the effects of dietary replacement of fish meal (FM) protein with black soldier fly larvae meal (BSFLM) at graded concentrations on bio-growth parameters, whole-body chemical composition, digestive enzyme activity, muscle-growth-related gene expression and haemato-biochemical responses of goldish juveniles (Carassius auratus). Six isonitrogenous and isoenergetic diets were formulated with BSFLM to substitute FM protein at 0 (T0), 20 (T20), 40 (T40), 60 (T60), 80 (T80) and 100 percent (T100). The aquaria with 20 fishes in each replicate were fed with experimental diet twice a day. Gold fish juveniles fed T60 diet exhibited maximum growth performances and feed utilization. However, escalating the percentage of fishmeal substitution with BSFLM above 60 percentage led to significant reduction in growth and feed utilization of goldfish juveniles. The protease activity was high in T60 and T80, wherein the lipase and amylase activity were high in T100. The relative mRNA expression of GH and MyoD was significantly upregulated in fish fed T40 and T60 diets, while the myostatin was significantly downregulated fish fed T40 and T60 diets. Thus, the fishmeal protein substituted at 60 percent with BSFLM with an inclusion level of 20.1 g/kg of diet will be well suitable for the goldfish juveniles.

Black soldier fly larvae meal

fish meal

gene expression

goldfish

lipase

myostatin

Aquariculture being a pivotal component of aquaculture renders both aesthetic value and is a good earner of foreign- exchange. The ornamental fish industry is an ever-augmenting substantial activity valued at approximately US$15 billion (Rhyne et al., 2017). Feed is the major component in aquaculture and ornamental fish industry. Fish meal is most widely used as a major protein source in the production of fish feed due to its quality protein and amino acid composition. The upscaling demand and price for fish meal has awakened the need of an alternative source of protein for aqua diets. Therefore, many scientific research studies are proposed to find out cost-efficient alternative plant-based ingredients for fish meal free aqua feed production (Diener et al., 2011). Though, several substitute feed ingredients of plant origin have been utilized in the aquafeed formulations (Gatlin et al., 2007), they possess imbalanced amino-acids profiles, low palatability and also contain anti-nutritional factors (ANFs) which confine their use in aquafeed formulations (NRC, 2011).

Currently, insects are earning a flourishing intentness as a principal ingredient for replacing the fish meal in the aquafeeds. The European Food Safety Authority scientific committee (2015) recognized the aforementioned environmental and economic sustainability issues in the aquaculture sector by enabling regulation 893/2017, which allows the utilization of seven different insect species meal in fish feed. Among the permitted species, the black solider fly (Hermetia illucens) larvae had a tremendous development due to its preference for organic waste as growth substrate (Sheppard et al., 1934; Meneguz et al., 2018; Vargas et al., 2018). They are able in converting low-quality organic material into high-grade protein and fat (Ewald et al., 2020). The black solider fly larvae having protein content of about 35–46% (Henry et al., 2015; Meneque et al., 2018) and lipid content of about 19–37% (Makkar et al., 2014) and the amino-acid profile and fatty acid profile of black solider fly larvae make them suitable for inclusion in animal feeds (Makkar et al., 2014). BSF larvae meal has very less chances of transmitting zoonotic diseases. They also help in reducing the environmental footprint by lessening the greenhouse gas and NH₃ emissions (Oonincx et al., 2010)

The BSF larvae meal has proven to be a good protein source in some warm water species (Sudha et al., 2022, Bondari et al., 1981 and Sheppard et al., 1981), meanwhile only meagre data is available in ornamental fish species. The goldfish which belongs to Cyprinidae family, is one of the most substantial ornamental species being domesticated in aquaria. It has been cultured worldwide for its aesthetic value and firm inheritance. The present study has been carried out to mitigate the up-scaling prices of ornamental fish feeds and to fulfill the essentiality of sustainable and environmentally friendly goldfish feed. Since, the black soldier fly larvae meal being a new venture as protein swap to fish meal, it is vital to analyze bio-growth parameters, the hematological parameters and digestive enzyme analysis of the fish to confirm the performance of the diets on the experimental fish.

Muscle growth in fishes are regulated by the myogenic factors, such as myoD and myostatin. Myo D responsible for satellite cells activation and proliferation during myogenesis (Watabe, 2000). While, myostatin acts as a growth suppresser that inhibits proliferation and differentiation of satellite cells during muscle growth development. Dietary supplementation of BSFLM has been reported to influence the growth performances and relative expression of muscle growth related genes, such as MyoD and myostatin in fish species (Sudha et al., 2022). In this context, the present study was focussed to estimate the effects of dietary swap of fish meal with black soldier fly larvae meal on growth performance, muscle growth-related gene expression, whole-body composition and haemato-biochemical responses of juvenile gold fish, Carrassius auratus.

2.1. Ethical statement

This study was conducted based on the approval by the ethical committee of TNJFU, Nagapattinam, Tamil Nadu, India.

2.2. Experimental fish and feeding trial

Gold fish juveniles were procured from Ornamental Fish Trade Centre, Kolathur, Chennai, Tamil Nadu, India. Ostensibly, healthy seeds in the first instance were acclimatized in fibre-reinforced plastic tanks by feeding them with diet containing 320 g/kg of protein over a period of three weeks. Before the experiment, the fishes were graded to select an individual average weight of 2.8 ± 0.3 g and were stocked in indoor aquarium facility. Three hundred and sixty fishes were distributed in 18 groups with twenty fishes in each aquarium. The aquarium had a water holding capacity of 70 litres in which the fishes were stocked for the feeding trial. Satiation feeding was carried out twice a day (09.00 and 17.00 H) for 60 days and the daily feed consumption was noted. Water exchange was carried out at the rate of 10% every three days in each aquarium. Aeration was continuously provided throughout the experimental period using a 5-HP air blower (Everest Pvt). During the growth trial, water quality parameters were monitored daily and the mean values were as follows: water temperature at 30.96±0.54°C, pH at 8.22±0.07, dissolved oxygen at 6.64±0.61 mg/L, ammonia-N at 0.07±0.10 ppm, nitrite-N at 0.76±0.44 ppm, nitrate-N at 0.06±0.10 ppm and hardness at 408.51±68.64 ppm.

2.3. Experimental diets

Six different FM and BSFLM based isonitrogenous experimental diets were formulated to contain 320 g/kg of crude protein (Table 1). The experimental diets were supplemented with black solider fly larvae meal (Eco care Agrovet) at levels of 0.0 (T0), 6.7 (T20), 13.4 (T40), 20.1 (T60), 26.8 (T80) and 33.5 g/kg (T100) to replace fish meal protein at 0, 20, 40, 60, 80 and 100 percent, respectively. The experimental diet T0 was observed as a control diet with 20 g/kg inclusion of fish meal and excluding the addition of BSFLM. The inclusion level of palm oil was adjusted to maintain isolipidic nature of experimental diets. Dietary ingredients were finely ground, thoroughly mixed using vertical ingredient mixer (Jinan Sunpring Machinery) and then extruded at 60–70°C to prepare 1.5-mm floating pellets using a single screw extruder (Unitech). The air tight plastic containers were utilized to store all the experimental diets at room temperature.

TABLE 1: Formulation and chemical composition of the experimental diets (g/kg of diet)

Ingredients	T0	T20	T40	T60	T80	T100
Black soldier fly larvae meal ^{a, f}	0	67	134	201	268	335
Fish meal ^b	200	160	120	80	40	0
Soybean meal ^b	270	270	270	270	270	270
Groundnut oil cake ^b	80	80	80	80	80	80
Corn flour ^b	266	246	226	206	185	165
Rice bran ^b	100	100	100	100	100	100
Cassava starch ^b	30	30	30	30	30	30
Palm oil ^c	34	27	20	13	07	0
Dicalcium phosphate ^b	10	10	10	10	10	10
Vitamin premix ^d	5	5	5	5	5	5
Mineral premix ^e	5	5	5	5	5	5
Proximate composition (g/kg dry matter)
Crude protein	329.4	322.8	325.7	323.2	320.9	323.4
Crude lipid	70.1	71.2	71.6	70.4	71.1	70.9
Crude fibre	32.2	33.6	33.8	33.7	33.9	33.8
Ash	83.9	83.5	84.3	83.6	83.4	83.8
^aEco care agrovet, Puducherry, India ^bNational co-operative consumers ‘federation of India, Chennai, India ^cLocal market, Chennai, India ^dComposition of vitamin premix (quantity/kg): Vit. A—10,000,000 IU, Vit.B1—5,000 mg, Vit.B2—5,000 mg, Vit.B3—6,000 mg, Vit.B5—6,000 mg, Vit.B6—6,000 mg, Vit.C—60,000 mg, Vit.D3— 2,000,000 IU, Vit. E—10,000 EU, Vit. H—200 mg. ^eComposition of mineral premix (quantity/kg): magnesium—2,800 mg, iodine—7.4 mg, iron—7,400 mg, copper—1,200 mg, manganese—11,600 mg, zinc—9,800 mg, chlorides cobalt—4 mg, potassium—100 mg, selenium—4 mg, calcium carbonate—27.25%, phosphorous—7.45 mg, sulphur—0.7 mg, sodium—6 mg, Calpan—200 mg, aluminium—1,500 mg and choline chloride— 10,000 mg ^fProximate of BSFLM – crude protein-42.27 %, crude lipid-18%, crude fibre- 8.73%, ash- 24.16%, moisture- 20.3%

2.4. Fish growth sampling

After 60 days of feeding trial, all the fish were put down with an overdose of tricaine methane sulphonate (MS-222; Sigma-Aldrich) and individually counted and weighed to estimate their survival, feed conversion ratio (FCR), protein efficiency ratio (PER), Thermal-unit growth coefficient (TGC) as follows:

2.5. Proximate and amino acid analysis

Six fishes from each experimental unit were collected after completion of growth trial to determine whole-body composition. The proximate composition such as moisture, crude protein, crude lipid and ash contents of experimental diets as well as whole body was estimated following standard protocols (AOAC, 2010). The amino acid composition of control and treatment diets were estimated using ultra-pressure liquid chromatography (UPLC; Model—Waters ACQUITY-UPLC, Waters), following the method described by Ishida et al. (1981).

TABLE 2: Amino acid composition of the experimental diets (g/kg of diet)

	T0	T20	T40	T60	T80	T100
Essential amino acids
Arginine	25.6	25.2	24.9	23.6	23.2	23.4
Histidine	12.5	11.7	11.8	12.4	12.6	12.5
Isoleucine	18	17.4	17.5	18.6	18.3	18.1
Leucine	26.1	25.8	25.5	25.7	26.1	25.6
Lysine	19.5	19.3	19.2	18.8	18.6	18.3
Methionine	5.9	5.7	5.4	5.2	5.2	50.1
Phenylalanine	18.8	19.2	19.4	18.7	18.4	18.7
Threonine	14.6	14.3	14.5	14.2	14.1	14.1
Tryptophan	3.1	2.8	2.7	2.4	2.3	2.4
Valine	19.6	19	19.1	19.5	19.4	19.6
Non-essential amino acids
Cysteine	5.3	5.4	5.4	5.2	5.3	5.1
Tyrosine	13.3	13.5	13.5	13.3	13.3	13.3
Glutamic acid	61.7	63.1	64.6	65.2	66.1	66.6
Aspartic acid	43.4	43.2	42.7	46.4	44.8	44.4
Glycine	19.5	19.5	19.5	20.7	20.3	20.2
Serine	18.2	18.2	18.3	18.6	18.5	18.6
Alanine	18.8	17.2	17.4	17.8	18.5	19

2.6. Haemato-biochemical assay

The blood samples were obtained from three individual fishes from each replication of aquaria to analyze the hematological and serum biochemical parameters at the end of the feeding trial. The fishes were anaesthetized using clove oil before collection of blood and caudal vein puncture method was used to obtain blood using 1-ml syringe. The collected blood samples were expelled into heparinized and non-heparinized tubes and stored immediately on ice. The serum was obtained by keeping the non-heparinized tubes in slant position for 2 hours and then centrifugation at 3,500 rpm for 25min at 4°C in a refrigerated centrifuge (Eppendorf Centrifuge 5804 R) was done. Neubauer hemocytometer was used to determine the RBC (red blood cell) counts. Cyanmethemoglobin method (Drabkin, 1946) was used to analyze the haemoglobin (Hb) contents whereas the microhematocrit method (Nelson & Morris, 1979) was used to determine the hematocrit (Ht). Erythrocyte indices, such as MCH, MCV and MCHC were calculated according to the equation given by Wintrobe (1934). The equations are as follows:

MCV (per µl) = (Ht × 10)/erythrocytes

MCH (%) = (Hb × 10)/erythrocytes

MCHC (g/dl) = (Hb × 100)/Ht

The total serum protein was analysed following the Biuret method (Reinhold, 1953). The bromocresol green binding method (Doumas et al., 1971) was utilized to calculate the albumin content. The globulin value is derived by deducting the albumin values from the total serum protein. A/G ratio is calculated by dividing the albumin value and globulin value. The method of Parekh and Jung (1970) was followed to calculate Serum cholesterol (CHO). Triglyceride (TG) levels were estimated following the protocol of Rice (1970).

2.7. Digestive enzyme analysis

At the end of the feeding trial, three fish (n=3 triplicate per treatment) from each treatment were randomly selected, and intestine samples were collected by dissecting it on chilled condition. The sample was then homogenized with cold phosphate buffer (pH 7.8) and centrifuged at 4500 rpm for 5minutes. The supernatant was kept at -20°C until the enzyme assay was carried out.

Quantifying of amylase activity was fulfilled using 3.5 dinitro salicylic acid colorimetric technique based on the method illustrated by Clark (1964). Cherry and Crandel (1932) method was used to determine the lipase activity by measuring the fatty acid release caused by enzyme hydrolysis of olive oil. The protease activity was quantified using Lowry, Rosebrough and Farr technique. The enzyme activity was observed based on the changes in absorbance using a spectrophotometer (Lamba 25UV Win Lab V 6.0). One unit of enzyme activity was expressed as 1µg of maltose, fatty acid and tyrosine released per minute.

2.8. Quantitative real-time PCR (qRT-PCR)

Sequentially, after the end of the feeding trial, the skeletal muscle (for MyoD and myostatin gene) and pituitary gland (for GH gene; n = 3 fish per aquaria) was collected to extract the total RNA as per the manufacturer’s instruction using RNA iso-plus (Takara Bio). Then, 2g of total RNA was reverse-transcribed to cDNA according to the manufacturer's instruction. The protocols of Prabu et al. (2021) were utilized for relative gene expression studies. The gene-specific primers of MyoD, myostatin, 18sRNA, GH gene and β actin were shown in Table 3. The quantitative real-time-polymerase chain reaction (qRT-PCR) consisted of 20 ng of cDNA template, 10 μM of each primer (forward and reverse), and 1× SYBR Green PCR Master Mix Kit (Takara Bio), in a 20 μL of total volume. The qRT-PCR was performed in a C1000 Touch thermal cycler-CFX96 Real-time PCR (Bio- Rad). The PCR cycling profiles were carried out programmed with an initial denaturation at 95°C for 10 min, along with 40 cycles of 15 s denaturation at 95°C, annealing at 60– 62°C (depends on the target genes) for 30 s, extension at 72°C for 30 s and ended with dissolution curve. The threshold cycle values of the qRT-PCR performed in triplicates were calculated and from that the relative expression level of specific gene was presented as 2^−ΔΔCt (Livak & Schmittgen, 2001). The genes 18S rDNA and β-Actin were utilized as an internal control gene to collate the relative expression levels of the genes.

TABLE 3: Primers used for qRT-PCR analysis

Gene name	GenBank number	Primer sequence (5´-3´)
Myogenic Factor (MyoD)	GU246722	Forward: CCACCTGTCAGACAACCAGA Reverse: ACTGCGTTCGCTCTTCAGAC
Myostatin 1	FJ972683	Forward: TCCACATGACCCTGCAGAC Reverse: TGCACCACACATACTCCTCATC
18Sribosomal DNA (18SrDNA)	JF698683	Forward: GGACACGGAAAGGATTGACAG Reverse: GTTCGTTATCGGAATTAACCAGAC
Pituitary growth hormone	XM_003442542	Forward: TCGGTTGTGTGTTTGGGCGTCTC Reverse: GTGCAGGTGCGTGACTCTGTTGA
β-Actin	EU887951.1	Forward: CCACACAGTGCCCATCTACGA Reverse: CCACGCTCTGTCAGGATCTTCA

2.9. Statistical analysis

All the experimental data were shown as the mean values ± standard deviation (SD) of three replications. Each and every data were tested for normality (Shapiro–Wilk test) and homogeneity of variance (Levene’s test) and transformed when the data did not show normal distribution. One-way ANOVA was performed to test the significant differences, wherein the Tukey's test was used to find out the significant differences between experimental groups. Differences were considered significant at p < 0.05. The software SPSS 20.0 for windows (SPSS) was used to statistically analyze the data.

3.1. Growth performances and feed utilization:

Growth performances and feed utilization of goldfish juveniles after 60 days of feeding trial are given in Table 4. Significant difference was observed in weight gain, FCR, PER, SGR and TGC of fishes fed with BSFLM supplemented diets and control diet. The highest growth performance and feed utilization was observed at T60 when compared to other experimental diets. The weight gain, SGR and TGC were found to be highest in fish fed T60 diet and lowest at fish fed control and T100 diet. Best FCR and PER values were found in fish fed T60 diet. No significant difference was observed in the survival of the fishes fed with different experimental diets. The growth performance and feed utilization were significantly low at the fishes fed with control, T80 and T100 diets.

TABLE 4: Effect of replacing FM with BSFLM on growth performance and feed utilization of goldfish juveniles

	T0	T20	T40	T60	T80	T100	p value
Initial body weight (g)	2.92±0.09	2.66±0.18	2.87±0.06	2.68±0.14	2.82±0.22	2.85±0.07	0.22
Final body weight (g)	4.20±0.07^c	4.21±0.18^c	4.64±0.06^b	5.09±0.16^a	4.12±0.20^c	4.11±0.08^c	<0.001
Weight gain (g)	1.28 ±0.15^c	1.55±0.21^bc	1.77±0.12^b	2.40±0.20^a	1.30±0.10^c	1.25±0.14^c	<0.001
Survival (%)	95.57±3.54	96.66±2.88	88.33±2.88	96.66±2.88	96.66±5.77	96.66±2.88	0.125
Specific Growth Rate (% per day)	0.60±0.07^b	0.76±0.11^b	0.79±0.05^b	1.06±0.09^a	0.63±0.07^b	0.60±0.07^b	<0.001
ADG (g/fish)	0.021±0.002^c	0.025±0.003^bc	0.029±0.002^b	0.040±0.003^a	0.021±0.001^c	0.020±0.002^c	<0.001
FCR	2.59±0.14^ab	2.52±0.16^ab	2.28±0.10^b	1.88±0.14^c	2.56±0.17^ab	2.79±0.18^a	<0.001
PER	0.37±0.06^c	0.45±0.05^ab	0.52±0.03^b	0.78±0.07^a	0.38±0.01^ab	0.36±0.02^c	<0.001
Thermal Growth Coefficient	0.009±0.001^b	0.012±0.001^b	0.013±0.00^b	0.017±0.001^a	0.010±0.001^b	0.009±0.001^b	<0.001
Note: Values were expressed as means ± SD of three replicate cage per treatment (n=3) and values with different superscripts indicate significant differences as determined by Tukey’s test (p < 0.05)

3.2. Whole body composition

The whole-body composition of fish fed with control and graded levels of BSFLM included diets is presented in Table 5. Dietary replacement of fish meal with black soldier fly larvae meal had no significant differences in whole-body moisture, protein, lipid and ash contents of juvenile gold fish.

TABLE 5: Whole-body chemical composition (g/kg of wet weight) of goldfish juveniles fed experimental diets

		Initial	T0	T20	T40	T60	T80	T100	p value
Moisture		758.32	743.033 ± 3.45	741.83 ± 5.03	741.83±8.52	738.23±3.99	744.91±3.12	738.26±7.32	0.654
Crude protein		124.32	133.33±3.32	129.06±5.43	134.77±8.17	137.06±2.73	135.92±2.38	135.07±3.09	0.415
Crude fat		64.35	72.77±5.51	77.73±4.53	77.14±4.93	76.33±3.56	73.03±1.46	7.5967±5.78	0.541
Ash		27.54	23.23±1.83	26.17±4.51	24.23±1.12	22.82±.1.96	26.37±2.73	22.03±2.02	0.245
	Values are means ± SD (n = 3). Values in the same line with different superscript letters are significantly different (p < .05)

3.3. Digestive enzyme

Digestive enzyme activity of goldfish juveniles fed experimental diets are represented in Table 6. Dietary supplementation of BSFLM had significant effects on the digestive enzyme activities of gold fish juveniles. The amylase activity was found to be highest in fish fed T40, T80 and T100 diets, while lowest amylase activity was found in fish fed T20 diet. The protease activity was found to be highest in fish fed T60 and T80 diets, whereas lowest protease activity was found in fish fed T0 and T20 diets. Significantly highest and lowest lipase activity was found in fish fed with T100 and T0 diets, respectively.

TABLE 6: Digestive enzyme activity of goldfish juveniles fed different experimental diets

	T0	T20	T40	T60	T80	T100	p value
Amylase	0.433±0.04^b	0.373±0.01^c	0.480±0.01^a	0.420±0.01^b	0.483±0.04^a	0.466±0.02^a	<0.001
Protease	3.03±0.02^d	3.07±0.02^d	3.54±0.04^b	3.88±0.01^a	3.81±0.00^a	3.47±0.01^c	<0.001
Lipase	0.49±0.01^e	0.69±0.00^d	0.70±0.01^d	0.89±0.01^c	1.49±0.00^b	1.89±0.00^a	<0.001
Amylase as micromole of maltose released min−1 mg−1 protein
Protease as micromole of tyrosine released min−1 mg−1 protein
Lipase as units mg−1 protein

3.4. Hematology and serum biochemical parameter

Hb, Ht, WBC, RBC, MCV, MCH and MCHC levels were significantly different among the dietary groups (Table 7). The Hb value was found to be significantly highest in fish fed T60 diet compared to fish fed other experimental diets. The red blood cell indices (MCV, MCH, MCHC) were negligibly low at fish fed T100 diet. The biochemical parameters, such as total protein, albumin, globulin and A/G ratio values were significantly high at fish fed T60 diet, while the total cholesterol and triglyceride values were found to be significantly lowest in fish fed T60 diet.

TABLE 7: Haematological and biochemical parameters of goldfish juveniles fed different experimental diets

	T0	T20	T40	T60	T80	T100	p value
Haematological parameters
Hb (g/dl)	4.30±0.36^b	4.33±0.05^b	4.33±0.05^b	4.93±0.05^a	4.06±0.05^b	4.23±0.05^b	<0.001
RBC (million/cu mm)	0.53±0.00^b	0.48±0.01^c	0.54±0.00^b	0.57±0.01^a	0.48±0.01^c	0.43±0.0^d	<0.001
PCV	7.5±0.20^c	7.23±0.05^d	7.9±0.10^b	8.3±0.10^a	6.43±0.05^c	6.16±0.05^e	<0.001
MCV	125.3±1.65^f	145.5±0.15^c	153.8±0.52^a	151.6±0.10^b	133.5±0.10^d	129.5±0.05^e	<0.001
MCHC	59.6±0.05^d	60.1±0.05^c	59.5±0.10^d	62.8±0.10^a	61.5±0.43^b	55.6±0.05^e	<0.001
MCH	84.7±0.10^c	87.6±0.10^b	91.53±0.15^a	91.66±0.05^a	82.5±0.10^d	80.46±0.05^e	<0.001
Polymorphs	3.10±0.10^c	3.13±0.05^c	3.13±0.05^c	3.43±0.05^b	2.66±0.15^d	14.2±0.05^a	<0.001
Lymphocytes	96.2±0.10^b	95.26±0.05^c	96.5±0.10^a	94.93±0.05^d	96.1±0.10^b	80.53±0.15^e	<0.001
Eosinophils	0.43±0.05^e	0.80±0.10^d	0.46±0.05^e	1.73±0.05^b	1.06±0.11^c	4.93±0.05^a	<0.001
Monocytes	0.26±0.05^b	0.56±0.15^a	0.13±0.05^bc	0.33±0.05^c	0.33±0.05^c	0.03±0.05^c	<0.001
Biochemical parameters
TP	3.28±0.01^e	4.54±0.05^b	3.71±0.00^c	5.29±0.01^a	3.47±0.01^d	3.68±0.07^c	<0.001
Albumin	0.84±0.15^f	1.05±0.01^d	1.02±0.15^e	2.36±0.010^a	1.36±0.015^b	1.17±0.005^e	<0.001
Globulin	2.41±0.005^d	2.57±0.01^c	2.66±0.01^b	2.92±0.005^a	2.12±0.01^e	2.53±0.02^c	<0.001
A/G Ratio	0.34±0.01^c	0.41±0.01^bc	0.37±0.01^bc	0.70±0.10^a	0.63±0.005^a	0.45±0.005^b	<0.001
TCHO	111.0±1^b	119.0±1^a	116.0±1^a	75±1^d	115.6±0.57^a	96.6±1.15^c	<0.001
Triglycerides	101.6±1.5^d	169±1^a	132±0^b	99±1^d	110.6±0.57^c	84.6±1.52^e	<0.001
Values were expressed as means ± SD of three replicate cages per treatment (n=3), and values with different superscripts indicate significant differences as determined by Tukey’s test (p < 0.05). Abbreviations: TCHO, total cholesterol, haemoglobin; MCH, mean corpuscular haemoglobin; MCHC, mean corpuscular haemoglobin concentration; MCV, mean corpuscular volume; TP, total protein; PCV, packed cell volume.

3.5. Muscle-growth-related gene expression

The relative expression of muscle growth-related-genes (MyoD, myostatin) and GH gene of gold fish juveniles were illustrated in figure 1. The relative expression of GH was significantly upregulated in fish fed T40 and T60 diets compared to fish fed other experimental diets. The mRNA expression of MyoD was significantly upregulated and downregulated in fish fed T60 and T100 diets, respectively. However, the relative mRNA expression of myostatin was significantly downregulated in fish fed T40 and T60 diets.

ETHICAL APPROVAL AND CONSENT TO PARTICIPATE:

This study was conducted based on the approval by the ethical committee of TNJFU,

Nagapattinam, Tamil Nadu, India.

HUMAN AND ANIMAL ETHICS:

The experimental procedure involving animal (fish) was approved by the ethical committee of TNJFU, Nagapattinam, Tamil Nadu, India.

CONSENT FOR PUBLICATION:

The authors agree to publish the article under the springer publication.

DATA AVAILABILITY STATEMENT:

The data that support the findings of this study are available within the article.

COMPETING INTERESTS:

The authors declare that they have no relevant financial or non-financial interests to disclose.

FUNDING:

The authors declare that no funds, grants, or other support were received during the preparation of the manuscript.

AUTHOR’S CONTRIBUTION

A. Kamalii: conducted the feeding trial, analysed the data and drafted the manuscript.

Cheryl Antony: conceptualized and designed the study, and corrected the manuscript.

B. Ahilan: formulated the experimental diets and corrected the manuscript.

A. Uma: carried out the gene expression analysis part and corrected the manuscript.

E. Prabu: analysed the data for statistical analysis and corrected the manuscript.

ACKNOWLEDGEMENT

I am sincerely thankful to Tamil Nadu Dr. J. Jayalalithaa Fisheries University, Nagapattinam, Tamil Nadu, India for rendering their support in conducting this study.

AUTHOR’S INFORMATION

Ahilan kamalii, TNJFU- Dr. M.G.R. Fisheries College and Research Institute, Ponneri - 601204, Tamil Nadu. [email protected]

Cheryl Antony, TNJFU- Dr. M.G.R. Fisheries College and Research Institute, Ponneri –

601204, Tamil Nadu. [email protected]

Baboonsundaram Ahilan, TNJFU- Dr. M.G.R. Fisheries College and Research Institute, Ponneri – 601204, Tamil Nadu. [email protected]

Arumugam Uma, TNJFU- State Referral Laboratory for Aquatic Animal Health, Chennai - 600051, Tamil Nadu. [email protected]

Elangovan Prabu, Directorate of Incubation and Vocational Training in Aquaculture, ECR -Muttukadu - 603112, Tamil Nadu. [email protected]

Adeparusi, E., & Ajayi, A. (2004). Haematological characteristics of Nile Tilapia (Oreochromis niloticus) fed differently processed lima bean (Phaseolus lunatus L.) diets. Journal of research in science and management, 1, 73–80.
Anvo, M. P. M., Aboua, B. R. D., Compaoré, I., Sissao, R., Zoungrana-Kaboré, C. Y., Kouamelan, E. P., & Toguyéni, A. (2017). Fish meal replacement by Cirina butyrospermi caterpillar's meal in practical diets for Clarias gariepinus fingerlings. Aquaculture research, 48(10), 5243–5250. https://doi.org/10.1111/are.13337
Belsare, S., Dhaker, H. S., Pawase, A., Joshi, V., Mohite, S., & Rathod, R. (2018). Effects of dietary protein and lipid levels on growth, feed utilization and body composition in juvenile goldfish, Carassius auratus. Indian Journal of Animal Research, 52(6), 875–881. 10.18805/ijar.v0iOF.7816
Bondari, K., & Sheppard, D. (1981). Soldier fly larvae as feed in commercial fish production. Aquaculture, 24, 103–109.
Calado, R., Olivotto, I., Oliver, M. P., & Holt, J. (2017). Marine ornamental species aquaculture (Vol. 712): Wiley Online Library.
Chong, A., Hashim, R., & Ali, A. b. (2003). Assessment of soybean meal in diets for discus (Symphysodon aequifasciata heckel) farming through a fishmeal replacement study. Aquaculture research, 34(11), 913–922. https://doi.org/10.1046/j.1365- 2109.2003.00945.x
Council, N. R. (2011). Nutrient requirements of fish and shrimp: National academies press.
Devic, E., Leschen, W., Murray, F., & Little, D. C. (2018). Growth performance, feed utilization and body composition of advanced nursing Nile tilapia (Oreochromis niloticus) fed diets containing Black Soldier Fly (Hermetia illucens) larvae meal. Aquaculture nutrition, 24(1), 416–423. https://doi.org/10.1111/anu.12573
Diener, S., Zurbrügg, C., Gutiérrez, F. R., Nguyen, D. H., Morel, A., Koottatep, T., & Tockner, K. (2011). Black soldier fly larvae for organic waste treatment—prospects and constraints. Proceedings of the WasteSafe, 2, 13–15.
Doumas, B. T., Watson, W. A., & Biggs, H. G. (1971). Albumin standards and the measurement of serum albumin with bromcresol green. Clinica chimica acta, 31(1), 87–96.
Doumas, B. T., Watson, W. A., & Biggs, H. G. (1971). Albumin standards and the measurement of serum albumin with bromcresol green. Clinica chimica acta, 31(1), 87–96. https://doi.org/10.1016/0009-8981(71)90365-2
Drabkin, D. L. (1946). Spectrophotometric studies: XIV. The crystallographic and optical properties of the hemoglobin of man in comparison with those of other species. Journal of biological chemistry, 164(2), 703–723. https://doi.org/10.1016/S0021-9258(17)412725
Ewald, N., Vidakovic, A., Langeland, M., Kiessling, A., Sampels, S., & Lalander, C. (2020). Fatty acid composition of black soldier fly larvae (Hermetia illucens)–Possibilities and limitations for modification through diet. Waste Management, 102, 40–47. https://doi.org/10.1016/j.wasman.2019.10.014
Fagbenro, O., Adeparusi, E., & Jimoh, W. (2010). Haematological profile of blood of African catfish (Clarias gariepinus, Burchell 1822) fed sunflower and sesame meal based diets. http://hdl.handle.net/1834/38229
Fawole, F. J., Sahu, N., Jain, K., Gupta, S., Rajendran, K., Shamna, N., & Poojary, N. (2017). Haemato-biochemical, non-specific immunity, antioxidant capacity and histopathological changes in Labeo rohita fingerlings fed rubber protein isolate. Fish physiology and biochemistry, 43(3), 677–690. http://hdl.handle.net/1834/38229
Fazio, F. (2019). Fish hematology analysis as an important tool of aquaculture: a review. Aquaculture, 500, 237–242.
Gatlin III, D. M., Barrows, F. T., Brown, P., Dabrowski, K., Gaylord, T. G., Hardy, R. W.,.. . Nelson, R. (2007). Expanding the utilization of sustainable plant products in aquafeeds: a review. Aquaculture research, 38(6), 551–579. https://doi.org/10.1111/j.1365-2109.2007.01704.x.
Hayashi, S., Aso, H., Watanabe, K., Nara, H., Rose, M. T., Ohwada, S., & Yamaguchi, T. (2000). Sequence of IGF-I, IGF-II, and HGF expression in regenerating skeletal muscle. Histochemistry and cell biology, 122(5), 427–434. https://doi.org/10.1007/s00418-004-0704-y
Hu, Y., Huang, Y., Tang, T., Zhong, L., Chu, W., Dai, Z.,.. . Hu, Y. (2020). Effect of partial black soldier fly (Hermetia illucens L.) larvae meal replacement of fish meal in practical diets on the growth, digestive enzyme and related gene expression for rice field eel (Monopterus albus). Aquaculture Reports, 17, 100345. https://doi.org/10.1016/j.aqrep.2020.100345
Iheanacho, S. C., Ogunji, J. O., Ogueji, E. O., Nwuba, L. A., Nnatuanya, I. O., Ochang, S. N.,.. . Haruna, M. (2017). Comparative assessment of ampicillin antibiotic and ginger (Zingiber officinale) effects on growth, haematology and biochemical enzymes of Clarias gariepinus Juvenile. Journal of Pharmacognosy and Phytochemistry, 6(3), 761–767.
Ishida, Y., Fujita, T., & Asai, K. (1981). New detection and separation method for amino acids by high-performance liquid chromatography. Journal of chromatography A, 204, 143–148. https://doi.org/10.1016/S0021-9673(00)81650-7
Jawad, L. A., Al-Mukhtar, M., & Ahmed, H. (2004). The relationship between haematocrit and some biological parameters of the Indian shad, Tenualosa ilisha (Family Clupeidae). Animal biodiversity and conservation, 27(2), 47–52.
Johnston, I. A., Lee, H.-T., Macqueen, D. J., Paranthaman, K., Kawashima, C., Anwar, A.,.. . Dalmay, T. (2009). Embryonic temperature affects muscle fibre recruitment in adult zebrafish: genome-wide changes in gene and microRNA expression associated with the transition from hyperplastic to hypertrophic growth phenotypes. Journal of Experimental Biology, 212(12), 1781–1793. https://doi.org/10.1242/jeb.029918
Kumar, V., Sahu, N., Pal, A., & Kumar, S. (2007). Immunomodulation of Labeo rohita juveniles due to dietary gelatinized and non-gelatinized starch. Fish & shellfish immunology, 23(2), 341–353.. https://doi.org/10.1016/j.fsi.2006.11.008
Li, S., Ji, H., Zhang, B., Tian, J., Zhou, J., & Yu, H. (2016). Influence of black soldier fly (Hermetia illucens) larvae oil on growth performance, body composition, tissue fatty acid composition and lipid deposition in juvenile Jian carp (Cyprinus carpio var. Jian). Aquaculture, 465, 43–52. https://doi.org/10.1016/j.aquaculture.2016.08.020
Livak, K. J., & Schmittgen, T. D. (2001). Analysis of relative gene expression data using real-time quantitative PCR and the 2 – ∆∆CT method. methods, 25(4), 402–408. https://doi.org/10.1006/meth.2001.1262
Makkar, H. P., Tran, G., Heuzé, V., & Ankers, P. (2014). State-of-the-art on use of insects as animal feed. Animal Feed Science and Technology, 197, 1–33. https://doi.org/10.1016/j.anifeedsci.2014.07.008
Meneguz, M., Gasco, L., & Tomberlin, J. K. (2018). Impact of pH and feeding system on black soldier fly (Hermetia illucens, L; Diptera: Stratiomyidae) larval development. PloS one, 13(8), e0202591. https://doi.org/10.1371/journal.pone.0202591.
Meneguz, M., Schiavone, A., Gai, F., Dama, A., Lussiana, C., Renna, M., & Gasco, L. (2018). Effect of rearing substrate on growth performance, waste reduction efficiency and chemical composition of black soldier fly (Hermetia illucens) larvae. Journal of the Science of Food and Agriculture, 98(15), 5776–5784.. https://doi.org/10.1002/jsfa.9127
Michelato, M., Zaminhan, M., Boscolo, W. R., Nogaroto, V., Vicari, M., Artoni, R. F.,.. . Furuya, W. M. (2017). Dietary histidine requirement of Nile tilapia juveniles based on growth performance, expression of muscle-growth-related genes and haematological responses. Aquaculture, 467, 63–70. https://doi. org/10.1016/j.aquaculture.2016.06.038
Motte, C., Rios, A., Lefebvre, T., Do, H., Henry, M., & Jintasataporn, O. (2019). Replacing fish meal with defatted insect meal (Yellow Mealworm Tenebrio molitor) improves the growth and immunity of pacific white shrimp (Litopenaeus vannamei). Animals, 9(5), 258. https://doi.org/10.3390/ani9050258
Ojolick, E., Cusack, R., Benfey, T., & Kerr, S. (1995). Survival and growth of all-female diploid and triploid rainbow trout (Oncorhynchus mykiss) reared at chronic high temperature. Aquaculture, 131(3–4), 177–187. https://doi.org/10.1016/0044-8486(94)00338-O
Oonincx, D. G., Van Broekhoven, S., Van Huis, A., & van Loon, J. J. (2015). Feed conversion, survival and development, and composition of four insect species on diets composed of food by-products. PloS one, 10(12), e0144601. https://doi.org/10. 1371/journal.pone.0144601.
Parekh, A. C., & Jung, D. H. (1970). Cholesterol determination with ferric acetate-uranium acetate and sulfuric acid-ferrous sulfate reagents. Analytical Chemistry, 42(12), 1423–1427. https://doi.org/10.1021/ac60294a044
Prabu, E., Felix, N., & Uma, A. (2021). Dietary arginine requirement in diets of GIFT strain of Nile tilapia, Oreochromis niloticus: Effects on growth performance, whole-body composition, growth‐related gene expression and haemato‐biochemical responses. Aquaculture research, 52(10), 4816–4828. https://doi.org/10.1111/are.15315
Punitha, S., Babu, M. M., Sivaram, V., Shankar, V., Dhas, S., Mahesh, T., Citarasu, T. (2008). Immunostimulating influence of herbal biomedicines on nonspecific immunity in Grouper (Epinephelus tauvina) juvenile against Vibrio harveyi infection. Aquaculture International, 16(6), 511–523. https://doi.org/10.1007/s10499-007-9162-6
Reinhold, J. G. (1953). Standard methods of clinical chemistry. Academic Press, New York, 1, 88.
Renna, M., Schiavone, A., Gai, F., Dabbou, S., Lussiana, C., Malfatto, V.,.. . Biasibetti, E. (2017). Evaluation of the suitability of a partially defatted black soldier fly (Hermetia illucens L.) larvae meal as ingredient for rainbow trout (Oncorhynchus mykiss Walbaum) diets. Journal of animal science and biotechnology, 8(1), 1–13. https://doi.org/10.1186/s40104-017-0191-3
Rhyne, A. L., Tlusty, M. F., Szczebak, J. T., & Holmberg, R. J. (2017). Expanding our understanding of the trade in marine aquarium animals. PeerJ, 5, e2949. https://doi.org/10.7717/peerj.2949
Rice, E., Epstein, M., WITTER, R. F., & Platt, H. A. (1970). Triglycerides (“neutral fat”) in serum. In Standard methods of clinical chemistry (Vol. 6, pp. 215–222): Elsevier. https://doi.org/10.1016/B978-0-12-609106-9.50027-0
Satheeshkumar, P., Ananthan, G., Kumar, D. S., & Jagadeesan, L. (2012). Haematology and biochemical parameters of different feeding behaviour of teleost fishes from Vellar estuary, India. Comparative Clinical Pathology, 21(6), 1187–1191.. . org/10.1007/s00580-011-1259-7
Sealey, W. M., Gaylord, T. G., Barrows, F. T., Tomberlin, J. K., McGuire, M. A., Ross, C., & St-Hilaire, S. (2011). Sensory analysis of rainbow trout, Oncorhynchus mykiss, fed enriched black soldier fly prepupae, Hermetia illucens. Journal of the World Aquaculture Society, 42(1), 34–45. https://doi.org/10.1111/j.1749-7345.2010.00441.x
Shamna, N., Sardar, P., Sahu, N. P., Phulia, V., Rajesh, M., Fawole, F.,.. . Angel, G. (2017). Heamato-immunological and physiological responses of Labeo rohita fingerlings to dietary fermented Jatropha curcas protein concentrate. Animal Feed Science and Technology, 232, 198–206. https://doi.org/10.1016/j.anifeedsci.2016.10.020
Sheppard, D. C., Newton, G. L., Thompson, S. A., & Savage, S. (1994). A value added manure management system using the black soldier fly. Bioresource technology, 50(3), 275–279. https://doi.org/10.1016/0960-8524(94)90102-3
St-Hilaire, S., Sheppard, C., Tomberlin, J. K., Irving, S., Newton, L., McGuire, M. A.,.. . Sealey, W. (2007). Fly prepupae as a feedstuff for rainbow trout, Oncorhynchus mykiss. Journal of the World Aquaculture Society, 38(1), 59–67. https://doi.org/10.1111/j.1749-7345.2006.00073.x
Sudha, C., Ahilan, B., Felix, N., Uma, A., & Prabu, E. (2022). Effects of dietary protein substitution of fishmeal with black soldier fly larval meal on growth and physiological responses of juvenile striped catfish, Pangasianodon hypophthalmus. Aquaculture research. https://doi.org/10.1111/are.15739
Tan, X., Sun, Z., Huang, Z., Zhou, C., Lin, H., Tan, L.,.. . Huang, Q. (2017). Effects of dietary hawthorn extract on growth performance, immune responses, growth-and immune-related genes expression of juvenile golden pompano (Trachinotus ovatus) and its susceptibility to Vibrio harveyi infection. Fish & shellfish immunology, 70, 656–664. https://doi.org/10.1016/j.fsi.2017.09.041
Van Huis, A., Van Itterbeeck, J., Klunder, H., Mertens, E., Halloran, A., Muir, G., & Vantomme, P. (2013). Edible insects: future prospects for food and feed security: Food and agriculture organization of the United Nations.
Watabe, S. (2000). Myogenic regulatory factors. Fish Physiology—Muscle Development and Growth, 18, 19–41.
Wintrobe, M. (1934). Anemia: classification and treatment on the basis of differences in the average volume and hemoglobin content of the red corpuscles. Archives of internal medicine, 54(2), 256–280. 10.1001/archinte.1934.00160140099006
Xiao, X., Jin, P., Zheng, L., Cai, M., Yu, Z., Yu, J., & Zhang, J. (2018). Effects of black soldier fly (Hermetia illucens) larvae meal protein as a fishmeal replacement on the growth and immune index of yellow catfish (Pelteobagrus fulvidraco). Aquaculture research, 49(4), 1569–1577. https://doi.org/10.1111/are.13611
Zhang, J., Liu, J., Li, L., & Xia, W. (2008). Dietary chitosan improves hypercholesterolemia in rats fed high-fat diets. Nutrition Research, 28(6), 383–390. https://doi.org/10.1016/j.nutres.2007.12.013.

No competing interests reported.

Download PDF

Version 1

posted

You are reading this latest preprint version

Dietary protein replacement of fish meal with black soldier fly larvae meal: Effects on growth, whole-body composition, digestive enzyme activity, muscle-growth-related gene expression and haemato-biochemical responses of juvenile goldfish, Carassius auratus

Status:

Version 1

Abstract

Figures

1. Introduction

2. Materials And Methods

3. Results

Declarations

References

Additional Declarations

Status:

Version 1