Isolation of human ADMSCs
Abdominal adipose tissue was obtained from healthy females by liposuction surgery. Lipoaspirate MSCs were isolated and characterized as previously described[26]. Cells in culture were maintained at 37 °C with 5% CO2, until 80% cell confluence, then cells were passaged on. ADMSCs from the third passage were plated in conventional 2D or 3D culture vessels. For 2D culture, cells were cultured in six-well plates at 1 × 106 cells/ml. Hydrogel (The well bioscience, Catalogue No. TWG002,Shanghai,China), as a non-animal derived polysaccharide hydrogel system that mimics the natural cellular microenvironment, is a new synthetic biomaterial for cell expansion in vitro, and is the main constituent of 3D culture. The hydrogel is mixed with cell culture medium to form a hydrogel matrix. The dilution ratio was 1:1, i.e., Hydrogel: PBS, 1:1, v/v. The hydrogel and ADMSCs were uniformly mixed and were seeded into a six-well plate at 1 × 106 cells/ml. The medium was replaced every three days. When ADMSCs grew to 80% confluence, the cells were passaged. The first day (d 1) was defined when ADMSCs from the third passage were seeded into six-well plates, as described.
Characterization Of ADMSCs
Flow cytometry assessment was conducted to confirm the mesenchymal origin of cells. Third passage cells were resuspended following digestion with 0.125% trypsin. A minimum of 1 × 105 cells/ml were collected from six-well plates. Rat monoclonal anti-human antibodies were used at a dilution of 1:150 for all cell surface markers. MSCs were incubated with phycoerythrin (PE)-coupled antibodies, CD34 (sc-7324; Santa Cruz) and CD45 (554,878; BD Biosciences), and fluorescein isothiocyanate (FITC)-coupled antibodies, CD44 (550,974; BD Biosciences) and CD105 (BD Biosciences), in the dark at room temperature for 30 min. IgG1-PE and IgG1-FITC were used as isotype controls. Cell data were analyzed using Paint-A-Gate Pro™ software.
Senescence-associated (SA)-β-galactosidase (Gal) Assay
ADMSCs from 2D and 3D cultures at 3d,7d,14d and 21d, were seeded in six-well plates at 1 × 105 cells/well overnight. The next day, cells were fixed for 30 min at room temperature in 4% formaldehyde, and washed twice in PBS (pH 7.3). Then, ADMSCs were incubated overnight at 37 °C with freshly prepared SA-β-Gal stain solution (C0602, Beyotime, Shanghai, China) following manufacturer’s instructions. At least 400 cells were observed in randomly chosen, non-overlapping fields by three independent observers to quantify SA-β-gal expression. Positive cells were stained blue and counted in three randomly selected fields under the microscope (XPF-550C, caikon, Shanghai, China). The experiment was performed three times, and the mean percentage of cells expressing SA-β-Gal was calculated.
Cell Viability
ADMSCs cell viability was determined using Muse Count & Viability Assay in the Muse Cell Analyzer (Luminex, USA) according to manufacturer’s instructions. Cells (1 × 106 cells/well) were harvested from both 2D and 3D cultures. They were then resuspended in medium to achieve a cell density of 2 × 105 cells/ml, from which 50 µl cells and 450 µl Muse™ count & viability reagent were added to a tube, and incubated for 5 min in the dark at room temperature. Cell viability was evaluated by miniaturized fluorescence detection and microcapillary cytometry with Muse Cell Analyzer.
Adipo- And Osteogenic Differentiation Of ADMSCs
ADMSCs from 3d,7d,14d and 21d were induced to undergo adipogenic and osteogenic differentiation, to identify cell capacity for differentiation in 2D and 3D cultures. For adipogenic differentiation, ADMSCs were seeded in 24-well plates at a density of 1×105 cells/well. MSCgo™ adipogenic differentiation medium (Catalogue No. 05412, STEMCELL, USA) was used to induce adipogenic differentiation after cells reached 95% confluence. Induction/maintenance media was replaced for cycles of three days/one day, respectively. Differentiated cells were assessed by staining intracellular lipid droplets with Oil Red O (MC37A0-1.4, VivaCell BIOSCIENCES, Shanghai, China) after 21 days in adipogenesis induction medium. For osteogenic differentiation, a similar process was also adopted. MSCgo™ osteogenic differentiation medium (Catalogue No. 05465, STEMCELL, USA) induced osteogenic differentiation when cells reached 95% confluence. Differentiated cells were stained using Alizarin Red S (MC37C0-1.4, VivaCell BIOSCIENCES, Shanghai,China) staining of accumulated calcium deposits, after 28 days of differentiation.
Real-time Fluorescence Quantitative Polymerase Chain Reaction (RT-qPCR)
Total RNA was isolated from ADMSCs using TRIzol reagent (Invitrogen, USA) following manufacturer’s instructions. cDNA was prepared by reverse transcription using the PrimeScript™ RT-PCR Kit (TaKaRa, Japan). Next mRNA levels were quantified for aging-related genes (p16, p21, p53) and stemness-related genes (Sox2, Oct4, Nanog, c-myc) by RT-qPCR on an ABI Prism7900 Detector (Applied Biosystems, USA), using SYBR Premix Ex Taq™. β-actin was used as a reference gene. Each experimental group was analyzed in triplicate. mRNA expression was calculated using the 2−ΔΔCt method. Primer sequences for RT-qPCR are shown (Table 1).
Table 1
Gene | Primer sequence (5′ − 3′) | Product size (bp) |
β-actin | Forward: CATGTACGTTGCTATCCAGGC | 250 |
| Reverse: CTCCTTAATGTCACGCACGAT | |
P16 | Forward: ATCATCAGTCACCGAAGG | 369 |
| Reverse: TCAAGAGAAGCCAGTAACC | |
P21 | Forward: CATCTTCTGCCTTAGTCTCA | 163 |
| Reverse: CACTCTTAGGAACCTCTCATT | |
P53 | Forward: CGGACGATATTGAACAATGG | 158 |
| Reverse: GGAAGGGACAGAAGATGAC | |
SOX2 | Forward: GCCGAGTGGAAACTTTTGTCG | 155 |
| Reverse: GGCAGCGTGTACTTATCCTTCT | |
OCT4 | Forward: CTGGGTTGATCCTCGGACCT | 243 |
| Reverse: CCATCGGAGTTGCTCTCCA | |
Nanog | Forward: TCTATAACTGTGGAGAGGAATC | 122 |
| Reverse: GGTCTGCTGTATTACATTAAGG | |
c-myc | Forward: GTCAAGAGGCGAACACACAAC | 162 |
| Reverse: TTGGACGGACAGGATGTATGC | |
TERT | Forward: AAATGCGGCCCCTGTTTCT | 76 |
| Reverse: CAGTGCGTCTTGAGGAGCA | |
Telomere Length And Activity Assay
Genomic DNA (gDNA) was isolated from ADMSCs and used as a template for RT-qPCR. The relative telomere length of ADMSCs from 3d,7d,14d and 21d was assayed using the relative human telomere length quantification RT-qPCR assay kit (Catalogue No. 8908, ScienCell, USA) following manufacturer’s instructions. Data were analyzed using the comparative quantification cycle value (∆∆Cq) method. Telomeres are maintained by telomerase, which comprises telomerase reverse transcriptase (TERT) and telomerase RNA component (TERC)[27]; thus, TERT expression is consistent with telomerase activity. The RT-qPCR assay indirectly reflects telomerase activity by detecting TERT mRNA expression levels. The procedure was identical to the above.
Relative Mitochondrial DNA Copy Number Quantification
Mitochondrial DNA (mtDNA) from ADMSCs was used as a template for RT-qPCR. The relative mtDNA copy number of ADMSCs from different time points was determined using the relative human mtDNA copy number quantification RT-qPCR assay kit (Catalogue No. 8938, ScienCell, USA) following manufacturer’s instructions. Data were analyzed using the comparative ∆∆Cq method.
Cellular Energy Metabolism Studies
The extracellular acidification rate (ECAR) and oxygen consumption rate (OCR) of cells were detected using the XF96 extracellular flux analyzer (Seahorse Bioscience; North Billerica, MA, USA) following manufacturer's instructions. ADMSCs were seeded at 5 × 103 cells/well in a 96-well Seahorse culture plate (Seahorse Bioscience, North Billerica, MA, USA), before conducting the experiment. For the ECAR assay, studies were performed in un-buffered DMEM (Catalogue No. 11965092, Gibco™, USA), pH 7.3 at 37 °C. Glucose (8 mM), oligomycin A (oligo;an ATP synthase inhibitor, 0.8 µM) and 2-deoxyglucose (2-DG; inhibitor of glycolysis; 80 mM) were added to different ports of the Seahorse cartridge. For OCR assays, analyses were conducted in medium consisting of 20 mM glucose, 1.8 mM sodium pyruvate in un-buffered DMEM, pH 7.3, at 37 °C. Oligomycin A (1 µM), carbonyl cyanide m-chlorophenylhydrazone (FCCP; a mitochondrial uncoupler; 400 nM), rotenone (complex I inhibitor; 0.8 µM) and antimycin A (complex III inhibitor; 0.8 µM) were added to different ports of the Seahorse cartridge. Each experimental group was assayed with four to five replicates in each analysis. ECAR and OCR data were normalized to cell numbers, as detected by CellTiter-Glo analysis (Promega, USA) at assay end.
Statistical Data Analysis
Numerical data were reported using means ± standard error of the mean (SEM). Data analyses were performed using paired t-tests with GraphPad Prism 7 software. Statistical differences were assessed at p < 0.05, p < 0.01, p < 0.001.