Evaluation of the relationship between different variants of Alpha 1 antitrypsin and the severity of COVID-19 disease

doi:10.21203/rs.3.rs-1541180/v1

Download PDF

Research Article

Evaluation of the relationship between different variants of Alpha 1 antitrypsin and the severity of COVID-19 disease

https://doi.org/10.21203/rs.3.rs-1541180/v1

This work is licensed under a CC BY 4.0 License

Version 1

posted

You are reading this latest preprint version

Background and Aim: In late 2019, incidence of respiratory diseases increased due to the outbreak of Corona virus. A1AT is a serine protease which its deficiency causes lung disease. In this study, it was hypothesized that different variants of SERPINA1 gene affect the severity of COVID-19 disease.

Materials and methods: 42 Swab samples containing purified DNA along with RNA virus, patients with COVID-19 from the age of 25-60 years were classified into three study groups contain of 14 patients each; outpatients, inpatients and the patients that admitted in intensive care units. The PCR method were used to amplification, of SERPINA1 gene, then the PCR product were sequenced by Sanger sequencing and the results were analyzed.

Results: The result of this study depicted that in the 3 outpatient, inpatient, and ICU study groups, the non-synonymous SNP, polymorphism in locus 5895 C> G (exon 2) with a frequency of 33.3% in which the amino acid alanine was changed to glycine was observed in the ICU group ,while in outpatient, inpatient groups two non-synonymous polymorphisms in locus 5646 and 5892 (exon 2) were reported , due to the high frequency of polymorphisms at position 5895 in the ICU group compared to other study groups may be related to the severity of symptoms of COVID-19 disease with this polymorphism Also, among the synonymous polymorphisms of SNP, in locus 11295 (exon 5) with a frequency of 21.4% in the outpatient group, probably showed the highest resistance against COVID-19.

Coronavirus disease 2019 (COVID-19)

SERPIN 1

Single nucleotide polymorphisms (SNPs)

SARS-CoV-2

Alpha1-antitrypsin (A1AT)

Coronaviruses are a large family of viruses that cause disease in humans and animals and include 39 species of the Coronaviridae family. There are at least seven known types of coronaviruses that cause respiratory disorders in humans. The three most recent examples of mutant viruses are SARSCOV, MERS-COV, and SARS-COV-2(Ortiz-Prado et al., 2020). In contrast to the two outbreaks of coronavirus, the acute respiratory syndrome of coronavirus 2 (SARS-CoV-2), coronavirus 2019 agent, caused a global epidemic that resulted in the loss of life and severe economic problems(Day, 2020). Coronavirus includes replicase, spike protein S, envelope protein E, membrane protein M, and nucleocapsid (Zhang et al., 2020). COVID-19 uses angiotensin-converting enzyme 2 (ACE2) as a receptor and infects cells with ACE2 through the receptor-binding domain found in the Spike (S) protein. The ACE2 receptor is abundant in alveolar cells, Cardiomyocytes, and vascular endothelium (Ding et al., 2017).

Real-time reverse transcription-PCR (RT-PCR) is the standard method for determining coronavirus infection; the combined use of imaging or computed tomography (CT) clinical signs can aid in the early diagnosis of COVID-19-induced pneumonia(Tang et al., 2020b). A1AT is a single-chain glycoprotein containing 394 amino acids with a molecular mass of 50 kDa (Brantly et al., 1988, Crystal, 1990) and is one of the most important serine proteases or serum serpins, produced mainly in the liver and, in addition, by macrophages and epithelial cells of the intestinal wall. Serpins are a group of inhibitors that are involved in inhibiting proteolytic, complement, and coagulation reactions. A1AT is the major inhibitor of neutrophil elastase and plays a vital role in protecting lung tissue against elastin degradation. Alpha 1 antitrypsin deficiency (A1ATD) can be associated with a high risk of pulmonary emphysema, chronic liver disease, and the rare form of cutaneous infections such as rheumatoid arthritis, vasculitis, glomerulonephritis, and others(Carrell et al., 1982). The normal amount of A1AT in serum is about 150–350 mg percent, and its distribution in tissues is not uniform. The small size of the A1AT molecule allows this protein to penetrate into various body fluids and tissues, so that its amount in the lung parenchyma is 3–5 micromoles. In humans, the A1AT gene is located on chromosome 14q32.1, which is composed of 5 exons and 4 introns longer than 12 kb (Potempa, 1994, Crystal et al., 1989, Crystal, 1989)

More than one hundred million known SNPs have been identified and listed. Most of these SNPs are in DNA sequences that do not directly encode amino acids. These SNPs affect gene binding, transcription factor binding, messenger RNA degradation, and other factors affecting gene transcription and mRNA translation into proteins(Shaw, 2013). To date, more than 100 allelic variants of the A1AT gene have been identified by DNA sequencing followed by isoelectric focusing. Approximately 11% of the nucleotide sequence is encoded for the A1AT protein sequence. Most studies (molecular biology techniques, DNA sequencing, IEF, etc.) show that the A1AT gene is highly polymorphic, and on the other hand, using molecular biology techniques (such as DNA sequencing), it has been found that, there are even more varieties than those detected at the protein level (Brantly et al., 1988, Crystal, 1990, Carrell et al., 1982, Crystal et al., 1989, Crystal, 1989).

A1ATD is a common autosomal genetic disorder(Laurell and Eriksson, 2013). Due to the formation and maintenance of polymers in the endoplasmic reticulum of liver cells, it causes liver disease in a proportion of PIS and PIZ alleles transporters(Townsend et al., 2018). A recent clinical analysis with a group of 40 showed that A1AT level increased in COVID-19 patients, which is directly proportional to the IL-6 increase and supports an anti-inflammatory function (Stoller and Aboussouan, 2012). In addition, A1AT has a regulatory role in the coagulation cascade and can prevent NET-induced Immunothrombosis by inhibiting elastase(Janciauskiene and Welte, 2016, Middleton et al., 2020). Patients with A1ATD are prone to COVID-19. For patients with A1ATD who do not have enough functional A1AT, transmembrane serine protease 2 (TMPRSS2) is more easily activated and causes SARS-CoV-2 to enter the cells. A1AT has inhibitory effects on thrombin and plasmin, so A1ATD may be associated with an increased risk of coagulation disorders. Insufficient anti-inflammatory, cell death, anti-protease, and anti-coagulation effects of A1AT, can increase the risk of severe acute lung damage. Patients with A1ATD, who are infected with SARS-CoV-2 may have more severe outcomes compared other people (Tanash et al., 2016, Yang et al., 2021). A1AT also reduces A disintegrin and metalloprotease 17 (ADAM17) activity (Bergin et al., 2010, Jedicke et al., 2014). ADAM17 is responsible for the ACE2 decomposing and the Renin–angiotensin system imbalance, which leads to inflammation, increased vascular permeability, pulmonary edema, and diffuses intravascular coagulation (DIC) (Tang et al., 2020a, Heurich et al., 2014, Gheblawi et al., 2020). Decreased A disintegrin and metalloprotease 17activity may improve inflammatory conditions in COVID-19 patients (Jose and Manuel, 2020).

In this study, samples of oropharyngeal and nasopharyngeal swabs belong to patients with COVID-19, containing viral particle as well as epithelium cells were provided. All swap were used for total human DNA and RNA of SARS-COV-2. The patients that referred to Tohid Hospital in Sanandaj as COVID-19 Medical Center voluntarily coordinate to this research were randomly selected without age and sex restrictions according to WHO Protocol. The inclusion criteria were based on the positive result of the COVID- 19 test and clinical observations. Those who did not agree to participate in the study were excluded from the study and then 3 samples of expired people were removed from the collected samples. Based on the case information, patients were classified into three study groups, including hospitalized (14 patients) outpatient (14 patients), and ICU (14 patients) .The study of DNA extracted were done with spectrophotometry method by synergy 2 Multi-Mode Reader, and then according to Table 1, primers were designed for PCR using Gene Runner software and evaluated by NCBI, the BLAST website. The important point that, most of the variants related to the A1AT gene are located in exons 2, 3, and 5, so the primers related to these exons were designed (Table 1). Electrophoresis was used to evaluate the band quality of PCR products. 42 samples with clearer bands were sent for sequencing by the Sanger method. The quality of the sequences was checked using Chroma’s software, and low-quality areas were edited, part of which is shown in Fig. 1. Clustal Omega web-based software was used to align the sequencing samples, part of which is shown in Fig. 2. Then, after confirming the sequences, in order to identify the existing polymorphisms and determine the effect of polymorphisms from the sequenced samples on protein changes, CLC software used to align their amino acid sequence with the SERPINA1 gene, part of which is shown in Figs. 3 and 4, where the alanine nucleobase is converted to glycine. After identifying all the conflicts by CLC software, the location of polymorphisms in the sequencing samples of COVID-19 patients with all RS (Reference SNP) related to the SERPINA1 gene in the following database was studied to match and check for new polymorphisms. https://www.ncbi.nlm.nih.gov/snp/term=serpina1.

Table 1

Features of specific primers
A1ATgene	primer	5́→3́ sequence	Fragment size	Gene location
Exon 2	Forward Reverse	GGACAATGCCGTCTTCTG TCTATGGGAACAGCTCAGG	687	Chromosome 14 - NC_000014.9
Exon 3	Forward Reverse	GGGATGTGTGTCGTCAAG CTTCTTGGTCACCCTCAG	424
First part of exon 5	Forward Reverse	CGACGAGAAAGGGACTGAAGC TGGGGAGAAGGGACCTGATTC	915
End part of exon 5	Forward Reverse	AATCAGGTCCCTTCTCCC CACAGAAAGCTCATAAGTGC	988

All stages of this study were performed under the supervision of the ethics committee and the written consent of the patients was obtained. In order to maintain the confidentiality of the research results, the hospital admission number of each person was considered as her identification code and the results were analyzed using these codes. The ethics code of this research is IR.MUK.REC.1399.214.

PCR optimization was performed for each of the 4 exons of the SERPINA1 gene for some samples in Fig. 5–8 to achieve a specific single band for each exon. Evaluation of the results of sequencing 4 exons of SERPINA1 gene in outpatients, inpatients, and ICU patients with COVID-19 in CLC software led to the identification of 6 new variants. Among the 6 variants identified in patients with COVID-19, only 3 polymorphisms located in exon 2 caused changes in the amino acid level of A1AT protein. In the outpatient group of patients with COVID-19, polymorphism in location 5646 with heterozygous genotype GC and frequency 35% (5 out of 14 patients in the outpatient group), which converted C to G nucleobase and caused the change of amino acid alanine (non-polar) to glycine (neutral), was observed. In the hospitalized group of patients with COVID-19, polymorphism in locus 5892 with heterozygous GA genotype and frequency of 50% (7 out of 14 patients in the hospitalized group), which converted A to G nucleobase and led to the change of amino acid glutamic acid (acidic) to glycine (neutral), was observed. In addition, the location 5895 polymorphism with the heterozygous GC genotype observed in all 14 patients in the ICU group, converted C to G again, changed the amino acid alanine (non-polar) to glycine (Table 2). Table 3 shows the frequency of polymorphisms resulting from SERPINA1 gene sequencing in all 42 samples of patients with COVID-19, which were divided into three groups of 14 patients with equal proportions of men and women.

Table 2

Frequency of non-synonymous polymorphisms in three groups: outpatient, inpatient and ICU
Exon	Frequency (%)	nucleobase change	Amino acid change	Gene location in SERPINA 1	Patient groups
2	35.71	C > G	A > G	5646	Hospitalized
2	50	A > G	E > G	5892	Outpatient
2	100	C > G	A > G	5895	ICU

Table 3

Frequency of polymorphisms in patients with COVID-19
Exon	ICU (%)	Hospitalized (%)	Outpatient (%)	nucleobase change	Gene location in SERPINA 1
2	-	-	11.9	C > G	5646
2	-	16.6	-	A > G	5892
2	33.3	-	-	C > G	5895
5	-	-	21.4	A > G	11295
5	-	23.8	23.8	A > G	11375
5	-	23.8	30.95	G > A	11485

Three non-synonymous polymorphisms have been observed that these 3 polymorphisms include location 5646 polymorphism (Nc:7698, Exon: 2, Gene: SERPINA1) with heterozygous GC genotype and a frequency of 11.9%, which includes 40% female and 60% male out of 5 patients in the outpatient group, location 5892 (Nc: 7944, Exon:2, Gene: SERPINA1) polymorphism with heterozygous GA genotype and a frequency of 16.6% of which 28.57% were female and 71.24% male of 7 patients in the hospitalized group, and location 5895 polymorphism (Nc: 7947, Exon: 2, Gene: SERPINA1) with heterozygous GC genotype and a frequency of 33. 3% of which 50% were female and 50% were male from 14 samples in the ICU group.

Also, 3 synonymous or silent polymorphisms were observed that did not cause an amino acid change in exon 5 of SERPINA1 gene, including polymorphism of location 11295 ( Nc: 13347, Exon: 5, Gene: SERPINA1) homozygous GG genotype which caused A to G nucleobase conversion and a frequency of 21.4%9, which 55.5% were female and 44.5% were male out of 9 outpatient group, polymorphism of location 11375 (Nc:13427, Exon: 5, Gene SERPINA1) with homozygous GG genotype that caused A to G nucleobase conversion with a frequency of 23.8%, which 60% were female and 40% male out of 10 patients in the outpatient group in addition, polymorphism of locus 11375 were observed in the hospitalized group with a frequency of 23.8%, of which 70% were female and 30% were male out of 10 patients in the hospitalized group, polymorphism location 11485 (Nc: 13537, Exon: 5, Gene: SERPINA1) with heterozygous GA genotype that causes G to A nucleobase conversion in the outpatient group with a frequency of 30.95%, which 53.84% were female and 46.16% male, and in the inpatient group with a frequency of 23.8%, which 50% were female and 50% male from 10 patients in this group.

SNPs can be synonymous or silent (i.e., do not cause a change in amino acid), and non-synonymous (when an amino acid changes). Synchronous SNPs have been thought to be insignificant, because the original protein sequence is preserved. Several studies have challenged this hypothesis over the past decade and shown that, synonymous mutations can also be contributed to disease. A lot of evidence shows that, synonymous SNPs can actually disrupt cellular function and create distinct clinical phenotypes. Synonymous SNPs, often can alter transcriptional stability by changing the ability of RNA-bound proteins to detect transcription through changes in mRNA structure. The secondary structure of mRNA is important in the synthesis and processing of pre-mRNA, as well as translation control. Thus, synonymous SNP, which that alters mRNA structure, can affect numerous cellular functions. Also, some synonymous mutations can turn off the effects of a harmful mutation (Higgs and Ran, 2008, Hunt et al., 2009). A1AT protein contains 394 amino acids consisting of 3 β-sheets, 9 α-helices, and a reactive center loop (Dafforn et al., 2004). Point mutations can destabilize the A β-sheet, and destroy the structure of the protein, and finally, by protein-protein interaction, and binding the residues of one serpin molecule to the β-sheet of another molecule, forms a loop-sheet polymer. These polymers accumulate within the endoplasmic reticulum of liver cells and create the inclusion bodies, which leading to several diseases such as liver cirrhosis, liver carcinoma, emphysema, and thrombosis (Green et al., 2003, James and Bottomley, 1998, Peltier et al., 2000). Milger et al., reported that a 44-year-old non-smoking woman of Turkish origin, who had suffered severe dyspnea and inspiratory pulmonary pain, a chest computed tomography scan confirmed severe bronchiectasis, severe emphysema, and pulmonary embolism. Pulmonary function tests showed severe obstruction and moderate swelling. In the patient's biochemical investigations, leukocytosis, elevated C-reactive protein, thrombocytosis, eosinophilia, respiratory failure, and low serum A1AT levels (25 mg /dl), were identified. Genotypic screening did not show any S and Z mutations in exons III and V of the SERPINA1 gene. However, after sequencing the remaining exons of the SERPINA1 gene, the insertion of a homozygous CA dinucleotide into exon II was found, which leading to a frameshift mutation in the stop codon at locus 219 (Milger et al., 2015).

Studies have also shown that A1AT directly inhibits the activity of caspase-3, an intracellular cysteine protease that plays a key role in cellular apoptosis (Petrache et al., 2006). Activation of Caspase-3 at the death time of neutrophils is well documented, recent findings provide evidence that, cut and activation of procaspsase-3 are due to the release of PR3 (protease 3) from neutrophil granules into the cytosol. Activation of caspase-3 by PR3 plays an important role in neutrophil apoptosis (Luo and Loison, 2008).

A1AT is involved in the inhibition of gelatinase B (MMP-9) in neutrophils. Neutrophils have been identified as the predominant source of MMP-9 (Gettins, 2002). MMP-9 is formed during the maturation of neutrophils, and helps neutrophil depletion and stem cell mobilization by destroying basement membrane collagens (Bradley et al., 2012). A1AT is an indirect physiological inhibitor of MMP-9, because elastase inactivates the MMP-9 activator (Opdenakker et al., 1998). Previous studies have also shown that, A1AT genetic defect can affect neutrophil elastase activity, as well as lung tissue organization, through the enzyme lysyl oxidase, which is responsible for cross-linking between tropoelastin molecules (Crystal, 1990, Janoff, 1985).

The starting ATG sequence for the 24th amino acid’s peptide signal as well as, 2 of the 3 sites of glycosylation of the SERPINA1 gene is located in exon II. Exon III has the third glycosylation site (Crystal et al., 1989, Crystal, 1989). A1AT has a variety of anti-inflammatory properties; it has been shown that, A1AT can modulate the resulting chemotaxis by binding to IL8. At physiological pH, the A1AT protein has an overall negative charge that causes an electrostatic interaction between A1AT and IL-8 with a positive charge.

A1AT oligosaccharides are critical for this anti-inflammatory function, because it has been shown that, A1AT cannot bind to IL8 without glycosylation. Binding between A1AT and IL-8 inhibits IL-8 binding to CXCR1, which negatively affects downstream signaling events in cytoskeletal rearrangement, F-actin formation, and calcium charging, and ultimately reduces neutrophil migration (Ferry et al., 1997). Significantly, disorders of inflammatory regulation and blood coagulation have been reported to be involved in varying intensities of COVID-19 (Bergin et al., 2010).

The SERPINA1 gene is part of a group of genes that include cortisol-binding globulin, alpha 1 antichymotrypsin, a protease-like inhibitor, and a protein C inhibitor, all of which are located near the locus of immunoglobulin’s, the link between the locus of immunoglobulin’s, and the locus of protease inhibitors may be the cause of SERPINA1 deficiency diseases and several inflammatory diseases(Crystal, 1989, Dafforn et al., 1999). According to our results we supposed that, due to changes of synonymous and non-synonymous polymorphisms in the structure and function of A1AT, in the entry and infection by SARS-COV2, the coagulation pathway, protease/antiprotease balance and inflammation, the severity of COVID- 19 can be changed in 3 outpatient, inpatient and ICU groups, as imagined among the non-synonymous SNPs, the 5895 C > G locus polymorphism with a frequency of 33.3% (exons 2, 14 of 42 total samples) that observed only in the ICU group, compared with the two synonymous polymorphisms at the 5646 and 5892 loci (exons 2) Causes high sensitivity to SARS-COV-2. Also, among the synonymous polymorphisms of SNP, position 11295 with a frequency of 21.4% (exons 5, 9 of 42 total samples) in the outpatient group, probably; has shown the highest resistance against COVID-19.

Possibly, changes in the structure and function of A1AT due to changes in synonymous and non-synonymous polymorphisms mediated the severity of COVID-19 among ICU patients.

Acknowledgements

The present study was supported by a grant from the Vice-chancellor for Research, Kurdistan University of Medical Sciences, and Iran (No.99/48).

Conflicts of interest

None.

Author contributions

PKh, MSH and ShN contributed in conception, data collection and manuscript drafting. MA, BN and KN and contributed data collection and manuscript drafting. All authors read and approved the final version of the paper.

Statements and Declarations

Competing interests

The authors declare that they have no competing interests.

BERGIN, D. A., REEVES, E. P., MELEADY, P., HENRY, M., MCELVANEY, O. J., CARROLL, T. P., CONDRON, C., CHOTIRMALL, S. H., CLYNES, M. & O’NEILL, S. J. 2010. α-1 Antitrypsin regulates human neutrophil chemotaxis induced by soluble immune complexes and IL-8. The Journal of clinical investigation, 120, 4236-4250.
BRADLEY, L. M., DOUGLASS, M. F., CHATTERJEE, D., AKIRA, S. & BAATEN, B. J. 2012. Matrix metalloprotease 9 mediates neutrophil migration into the airways in response to influenza virus-induced toll-like receptor signaling. PLoS pathogens, 8, e1002641.
BRANTLY, M., NUKIWA, T. & CRYSTAL, R. G. 1988. Molecular basis of alpha-1-antitrypsin deficiency. The American journal of medicine, 84, 13-31.
CARRELL, R. W., JEPPSSON, J.-O., LAURELL, C.-B., BRENNAN, S. O., OWEN, M. C., VAUGHAN, L. & BOSWELL, D. R. 1982. Structure and variation of human α1–antitrypsin. Nature, 298, 329-334.
CRYSTAL, R. G. 1989. The alpha 1-antitrypsin gene and its deficiency states. Trends Genet, 5, 411-7.
CRYSTAL, R. G. 1990. Alpha 1-antitrypsin deficiency, emphysema, and liver disease. Genetic basis and strategies for therapy. The Journal of clinical investigation, 85, 1343-1352.
CRYSTAL, R. G., BRANTLY, M. L., HUBBARD, R. C., CURIEL, D. T., STATES, D. J. & HOLMES, M. D. 1989. The alpha 1-antitrypsin gene and its mutations. Clinical consequences and strategies for therapy. Chest, 95, 196-208.
DAFFORN, T. R., MAHADEVA, R., ELLIOTT, P. R., SIVASOTHY, P. & LOMAS, D. A. 1999. A kinetic mechanism for the polymerization of α1-antitrypsin. Journal of Biological Chemistry, 274, 9548-9555.
DAFFORN, T. R., PIKE, R. N. & BOTTOMLEY, S. P. 2004. Physical characterization of serpin conformations. Methods, 32, 150-8.
DAY, M. 2020. Covid-19: identifying and isolating asymptomatic people helped eliminate virus in Italian village. BMJ: British Medical Journal (Online), 368.
DING, N., ZHAO, K., LAN, Y., LI, Z., LV, X., SU, J., LU, H., GAO, F. & HE, W. 2017. Induction of atypical autophagy by porcine hemagglutinating encephalomyelitis virus contributes to viral replication. Frontiers in cellular and infection microbiology, 7, 56.
FERRY, G., LONCHAMPT, M., PENNEL, L., DE NANTEUIL, G., CANET, E. & TUCKER, G. C. 1997. Activation of MMP-9 by neutrophil elastase in an in vivo model of acute lung injury. FEBS letters, 402, 111-115.
GETTINS, P. G. 2002. Serpin structure, mechanism, and function. Chemical reviews, 102, 4751-4804.
GHEBLAWI, M., WANG, K., VIVEIROS, A., NGUYEN, Q., ZHONG, J.-C., TURNER, A. J., RAIZADA, M. K., GRANT, M. B. & OUDIT, G. Y. 2020. Angiotensin-converting enzyme 2: SARS-CoV-2 receptor and regulator of the renin-angiotensin system: celebrating the 20th anniversary of the discovery of ACE2. Circulation research, 126, 1456-1474.
GREEN, C., BROWN, G., DAFFORN, T. R., REICHHART, J. M., MORLEY, T., LOMAS, D. A. & GUBB, D. 2003. Drosophila necrotic mutations mirror disease-associated variants of human serpins. Development, 130, 1473-8.
HEURICH, A., HOFMANN-WINKLER, H., GIERER, S., LIEPOLD, T., JAHN, O. & PÖHLMANN, S. 2014. TMPRSS2 and ADAM17 cleave ACE2 differentially and only proteolysis by TMPRSS2 augments entry driven by the severe acute respiratory syndrome coronavirus spike protein. J Virol, 88, 1293-307.
HIGGS, P. G. & RAN, W. 2008. Coevolution of codon usage and tRNA genes leads to alternative stable states of biased codon usage. Mol Biol Evol, 25, 2279-91.
HUNT, R., SAUNA, Z. E., AMBUDKAR, S. V., GOTTESMAN, M. M. & KIMCHI-SARFATY, C. 2009. Silent (synonymous) SNPs: should we care about them? Methods Mol Biol, 578, 23-39.
JAMES, E. L. & BOTTOMLEY, S. P. 1998. The mechanism of alpha 1-antitrypsin polymerization probed by fluorescence spectroscopy. Arch Biochem Biophys, 356, 296-300.
JANCIAUSKIENE, S. & WELTE, T. 2016. Well-known and less well-known functions of alpha-1 antitrypsin. Its role in chronic obstructive pulmonary disease and other disease developments. Annals of the American Thoracic Society, 13, S280-S288.
JANOFF, A. 1985. Elastases and emphysema: current assessment of the protease-antiprotease hypothesis. American Review of Respiratory Disease, 132, 417-433.
JEDICKE, N., STRUEVER, N., AGGRAWAL, N., WELTE, T., MANNS, M. P., MALEK, N. P., ZENDER, L., JANCIAUSKIENE, S. & WUESTEFELD, T. 2014. Alpha‐1‐antitrypsin inhibits acute liver failure in mice. Hepatology, 59, 2299-2308.
JOSE, R. J. & MANUEL, A. 2020. COVID-19 cytokine storm: the interplay between inflammation and coagulation. Lancet Respir Med, 8, e46-e47.
LAURELL, C.-B. & ERIKSSON, S. 2013. The electrophoretic α1-globulin pattern of serum in α1-antitrypsin deficiency. COPD: Journal of Chronic Obstructive Pulmonary Disease, 10, 3-8.
LUO, H. R. & LOISON, F. 2008. Constitutive neutrophil apoptosis: mechanisms and regulation. American journal of hematology, 83, 288-295.
MIDDLETON, E. A., HE, X.-Y., DENORME, F., CAMPBELL, R. A., NG, D., SALVATORE, S. P., MOSTYKA, M., BAXTER-STOLTZFUS, A., BORCZUK, A. C. & LODA, M. 2020. Neutrophil extracellular traps contribute to immunothrombosis in COVID-19 acute respiratory distress syndrome. Blood, 136, 1169-1179.
MILGER, K., HOLDT, L. M., TEUPSER, D., HUBER, R. M., BEHR, J. & KNEIDINGER, N. 2015. Identification of a novel SERPINA-1 mutation causing alpha-1 antitrypsin deficiency in a patient with severe bronchiectasis and pulmonary embolism. Int J Chron Obstruct Pulmon Dis, 10, 891-7.
OPDENAKKER, G., FIBBE, W. E. & VAN DAMME, J. 1998. The molecular basis of leukocytosis. Immunology today, 19, 182-189.
ORTIZ-PRADO, E., SIMBAÑA-RIVERA, K., GÓMEZ-BARRENO, L., RUBIO-NEIRA, M., GUAMAN, L. P., KYRIAKIDIS, N. C., MUSLIN, C., JARAMILLO, A. M. G., BARBA-OSTRIA, C. & CEVALLOS-ROBALINO, D. 2020. Clinical, molecular, and epidemiological characterization of the SARS-CoV-2 virus and the Coronavirus Disease 2019 (COVID-19), a comprehensive literature review. Diagnostic microbiology and infectious disease, 98, 115094.
PELTIER, M. R., GRANT, T. R. & HANSEN, P. J. 2000. Distinct physical and structural properties of the ovine uterine serpin. Biochim Biophys Acta, 1479, 37-51.
PETRACHE, I., FIJALKOWSKA, I., MEDLER, T. R., SKIRBALL, J., CRUZ, P., ZHEN, L., PETRACHE, H. I., FLOTTE, T. R. & TUDER, R. M. 2006. α-1 antitrypsin inhibits caspase-3 activity, preventing lung endothelial cell apoptosis. The American journal of pathology, 169, 1155-1166.
POTEMPA, J. 1994. The serpin superfamily of proteinase inhibitors: structure, function, and regulation. J. Biol. Chem., 269, 15957-15960.
SHAW, G. 2013. Polymorphism and single nucleotide polymorphisms (SNP s). BJU international, 112, 664-665.
STOLLER, J. K. & ABOUSSOUAN, L. S. 2012. A review of α1-antitrypsin deficiency. American journal of respiratory and critical care medicine, 185, 246-259.
TANASH, H. A., EKSTRÖM, M., WAGNER, P. & PIITULAINEN, E. 2016. Cause-specific mortality in individuals with severe alpha 1-antitrypsin deficiency in comparison with the general population in Sweden. International journal of chronic obstructive pulmonary disease, 11, 1663.
TANG, N., LI, D., WANG, X. & SUN, Z. 2020a. Abnormal coagulation parameters are associated with poor prognosis in patients with novel coronavirus pneumonia. J Thromb Haemost, 18, 844-847.
TANG, Y.-W., SCHMITZ, J. E., PERSING, D. H. & STRATTON, C. W. 2020b. Laboratory diagnosis of COVID-19: current issues and challenges. Journal of clinical microbiology, 58, e00512-20.
TOWNSEND, S., EDGAR, R., ELLIS, P., KANTAS, D., NEWSOME, P. & TURNER, A. 2018. Systematic review: the natural history of alpha‐1 antitrypsin deficiency, and associated liver disease. Alimentary pharmacology & therapeutics, 47, 877-885.
YANG, C., CHAPMAN, K. R., WONG, A. & LIU, M. 2021. α1-Antitrypsin deficiency and the risk of COVID-19: an urgent call to action. The Lancet Respiratory Medicine, 9, 337-339.
ZHANG, L.-P., WANG, M., WANG, Y., ZHU, J. & ZHANG, N. 2020. Focus on the 2019 novel coronavirus (SARS-CoV-2). Future microbiology, 15, 905-918.

No competing interests reported.

Download PDF

Version 1

posted

You are reading this latest preprint version

Evaluation of the relationship between different variants of Alpha 1 antitrypsin and the severity of COVID-19 disease

Status:

Version 1

Abstract

Figures

Introduction

Materials And Methods

Results

Discussion

Conclusion

Declarations

References

Additional Declarations

Status:

Version 1