Drugs and chemicals
OHP, CPT, and 5-FU were purchased from NIPRO (Osaka, Japan), TOWA Pharmaceutical Co., (Kadoma, Japan), and KYOWA KIRIN (Tokyo, Japan), respectively. TFT was purchased from Tokyo Chemical Industry Co. (Tokyo, Japan) and dissolved in DMSO at a concentration of 20 mM. All drugs were diluted in culture medium immediately before use.
Cell lines and cloning of drug-resistant cells
Human CRC cell line DLD1 was purchased from Japan Health Sciences Foundation (Osaka, Japan). Human CRC cell line HCT116 was a kind gift from Dr. Yamamoto (Department of Surgery and Clinical Oncology, Osaka University Graduate School of Medicine, Osaka, Japan). These cells were authenticated by American Type Culture Collection using DNA profiling (Manassas, Virginia, USA). Cells were maintained in DMEM supplemented with 10% fetal bovine serum, 10,000 units penicillin, 10 mg/ml streptomycin, and 25 µg/ml amphotericin B. Culture media and fetal bovine serum were obtained from Life Technologies Japan (Tokyo, Japan). All cells were grown at 37°C in a humidified incubator with 5% CO2. DLD1 and HCT116 cells were co-cultured with 20 µM OHP or 10 µM OHP, respectively. Then, OHP-resistant clones were isolated by limited dilutions and named as DLD/OHP1, DLD/OHP4, and DLD/OHP5, when derived from DLD1, and HCT/OHP1, HCT/OHP3, and HCT/OHP5, when derived from HCT116.
Drug sensitivity and proliferation rate
Cells were seeded in 200 µl medium in 96-well flat-bottom plates at a density of 2 × 103 cells per well. The next day, the medium was removed and serial dilutions of OHP, (0.1 − 500 µM), 5-FU (0.1 − 500 µM), CPT (0.1 − 100 µg/ml), and TFT (0.1 − 100 µM were added to each well. After 96 h, cells were counted using a cell counting kit (Dojindo Laboratories, Kumamoto, Japan) according to the manufacturer’s instructions. Half maximal inhibitory concentration (IC50) values were calculated as the concentrations that corresponded to a 50% reduction in cellular proliferation compared with untreated cells. The proliferation rate was calculated as the doubling time of the cell number as measured by the cell counting kit. Experiments were performed independently at least three times, and data are shown as means ± standard deviations.
Animal experiments
Four-week-old female BALB/cAJcl-nu/nu mice were purchased from Japan Clea Inc. (Tokyo, Japan). Mouse care and experiments were performed under specific pathogen-free conditions at the Institute of Experimental Animal Science, Hyogo College of Medicine. All animal protocols were approved by the Institutional Animal Care and Use Committee of Hyogo College of Medicine (12–067). All animal experiments were performed in accordance with the guidelines of the Institutional Animal Care and Use Committee of Hyogo College of Medicine. Then, the study was carried out in compliance with the ARRIVE guidelines (http://www.nc3rs.org.uk/page.asp?id=1357).
To assess the tumor growth of xenografts derived from HCT116 and OHP-resistant clones, a total of 5 ⋅ 106 HCT116 cells and OHP-resistant clones (HCT/OHP1, HCT/OHP3, and HCT/OHP5 cells) were subcutaneously inoculated in the right and left flanks of seven mice, respectively. Tumor size was measured twice a week. Tumor volume was calculated as a × b2 (where a represents the tumor length and b represents its width).
To assess OHP resistance in xenografts, a total of 5 ⋅ 106 HCT116 cells and OHP-resistant clone HCT/OHP5 cells were subcutaneously inoculated in both flanks of 12 mice (24 sites). Xenograft tumors derived from HCT/OHP1 cells were minced and inoculated into both flanks of the 12 mice because the growth of HCT/OHP1-derived xenograft tumors was so slow compared with that of HCT116 and HCT/OHP5. Tumor size was measured twice a week and tumor volume was calculated as described above. When the tumor diameter was > 5 mm, the mice were randomized into no treatment (control) or drug treatment groups (5 mg/kg OHP or 10 mg/kg CPT injected intraperitoneally twice a week for a total of five weeks, four mice [eight tumors] per each group) after adjusting the mean tumor volume among the groups. The rate of TGI was calculated as follows: 1 − (increase in tumor volume in the drug treatment group)/(increase in tumor volume in the control group). TGI was assessed after the completion of drug treatment.
Microarray data analysis
A total of 1 ⋅ 106 HCT116, HCT/OHP1, HCT/OHP3, and HCT/OHP5 cells were seeded onto P10 tissue culture plates. Twenty-four hours later, total RNA was extracted using an RNeasy Mini kit (Qiagen K.K., Tokyo, Japan) according to the manufacturer’s instructions. Total RNA was also extracted from human tumor xenografts derived from HCT116, HCT/OHP1, and HCT/OHP5 without drug treatment.
Gene expression profiles were analyzed by Agilent SurePrint G3 Human GE 8x60K v2 Microarray kit (Agilent). The data set is available at Gene Expression Omnibus under accession number GSE77932 for cell experiments and GSE124808 for tumor experiments.
Signal data were imported into GeneSpring (Agilent) for analysis. Signal evaluation was performed depending on signal uniformity and the significant difference between signal and background. Signal data were normalized by the 75th percentile among arrays. Genes for which signal data were ≥ 2 in OHP resistance clones compared to HCT116 both in vitro and in vivo were selected as upregulated genes. Genes for which signal data were 0.5 ≥ in OHP resistance clones compared to HCT116 both in vitro and in vivo were selected as downregulated genes.
Validation ofFOXQ1involvement in OHP resistance
Among the upregulated and downregulated genes, FOXQ1 was selected as a candidate gene because of its association with drug resistance and tumor progression12–19. FOXQ1 expression in cells and tumors was evaluated by quantitative real-time reverse transcription PCR (qRT-PCR), as previously described17,20. The primer sequences were FOXQ1-forward: CTTCCCTCCCCCCTAAGTACAT and FOXQ1-reverse: ATGCCACATACGTACACGGATG. GAPDH was used as an internal control. ΔCT was calculated using the CT (Threshold cycle) value of FOXQ1 and that of GAPDH in each sample. Data was calculated from triplicate wells.
The influence of FOXQ1 on OHP resistance was assessed by inhibition of FOXQ1 expression by siRNA knockdown (siRNA (h): sc-60660; Santa Cruz, Dallas, USA) and control siRNA-A (sc-37007; Santa Cruz). Hily MAX was used for transfection (Dojindo). A total of 8 × 103 HCT116, HCT/OHP5, DLD1, and DLD/OHP5 cells in a volume of 200 µl medium were seeded into 96-well flat-bottom plates. The next day, the medium was removed and serial dilutions of OHP (0.1 − 100 µM), 1.2 µL Hily Max, and 20 pmol siRNA were added to each well in a total volume of 200 µl medium. The influence of FOXQ1 expression on OHP resistance was also assessed by enhancement of FOXQ1 using FOXQ1 expression plasmid and control plasmid, which were constructed previously18. Then 8 × 103 HCT116 and HCT/OHP5 cells in 200 µl medium were seeded into 96-well flat-bottom plates. The next day, the medium was removed and serial dilutions of OHP (0.1 − 100 µM), 1.2 µL Hily Max, and 0.2 µg FOXQ1 expression plasmid or control plasmid were added to each well in a total volume of 200µl medium. After 48 h of FOXQ1 expression modification, cells were counted using a cell counting kit according to the manufacturer’s instructions and IC50 was measured as described above.
Association of FOXQ1 expression with clinical features in CRC patients
Specimens were collected from 173 CRC patients who underwent surgery at our department. All protocols were approved by the ethics committee of Hyogo College of Medicine and all patients provided written informed consent (No. 0120 by the Institutional Review Board of Hyogo College of Medicine). All experiments were performed depending on the Declaration of Helsinki, the guidelines and the associated laws in Japan. The CRC specimens consisted of 155 tumors without chemotherapy, 13 tumors after chemotherapy including OHP, and five after chemoradiotherapy. The CRC specimens were obtained with adjacent normal mucosal tissues for comparison and stored at − 80°C in RNAlater before use (Qiagen K.K.). Relative FOXQ1 expression was assessed by ΔΔCT generated from difference of ΔCT values in CRC tumors and normal mucosal tissue.
Association of FOXQ1 expression with clinical features in CRC patients of TCGA data
We further assessed FOXQ1 expression in CRC samples of TCGA. RNA-seq data of colorectal adenocarcinoma were collected from TCGA PanCancer Atlas in cBioPortal for Cancer Genomics (https://www.cbioportal.org/study/summary?id=coadread_tcga_ pan_can_atlas_2018). Differences between mRNA expression z-scores of FOXQ1 relative to normal samples and those of GAPDH relative to normal scores were used to evaluate association of FOXQ1 expression with clinical features as in CRC patients of our department.
Data analysis
Differences in IC50 values and doubling times between OHP-resistant clones and parental cells were assessed by t-test. Tumor volumes of xenografts at seven weeks after inoculation were assessed between each clone and HCT116 cells by t-test. The tumor volumes by OHP treatment were also compared between the control and treatment groups using a t-test. Association of FOXQ1 expression with clinical features was assessed by t-test in case of two categories and by analysis of variance in case of more than three categories. Influence of FOXQ1 expression on overall survival was assessed by Kaplan-Meier curve and evaluated by Log-rank test. A P value of < 0.05 was considered significant for all analyses.
