Increased expression levels of DLX5 inhibit the development of the nervous system

doi:10.21203/rs.3.rs-1544201/v1

Download PDF

Research Article

Increased expression levels of DLX5 inhibit the development of the nervous system

https://doi.org/10.21203/rs.3.rs-1544201/v1

This work is licensed under a CC BY 4.0 License

Version 1

posted

You are reading this latest preprint version

Introduction: Preeclampsia (PE) is a hypertensive disorder of pregnancy (HDP). DLX5 plays an important role in the migration and differentiation of subglobus pallidus precursor cells.

Material and methods: We established a zebrafish line expressing high levels of DLX5 and investigated changes in behavior and development of the nervous system.

Results: The ratios of brain volume area to whole body area at 96 hpf zebrafish in the experimental group (gRNA+CasRx) were significantly lower than the WT group and the negative control group (casRx)(P<0.01). Behavioral trajectory distances and movement speeds exhibited by the 6th day of development in zebrafish in the experimental group (gRNA+CasRx) were significantly shorter (P<0.01) and lower (P<0.05) than the negative control group (gRNA+CasRx), respectively.

Conclusions: Data suggested that the increased expression levels of DLX5 can inhibit brain volume development and behavioral activities in zebrafish. Maybe the high expression levels of DLX5 in the pathological state of PE can inhibit the development of the nervous system in offspring.

Pre-eclampsia

DLX5

Nervous system

Zebrafish

Offspring

Preeclampsia (PE) is a hypertensive disorder of pregnancy (HDP). As a very common dynamic disease in the clinic, the continuous progression of PE has become one of the most important causes of maternal and perinatal morbidities and deaths. The etiology and pathogenesis of PE has yet to be elucidated. The main theories relating to this multi-factor, multi-mechanism, and multi-pathway disease include insufficient remodeling of the uterine spiral arterioles, excessive activation of inflammation and immunity, damage incurred by vascular endothelial cells, genetic factors, and a lack of nutrition ^【1】. Although the blood pressure of patients with PE can return to normal at 12 weeks post-delivery, the pathophysiological changes during pregnancy, especially cerebral vasospasm and increased permeability, can lead to brain edema, hyperemia, local ischemia, thrombosis, and hemorrhage; these conditions can exert considerable negative effects on the growth and development of the offspring^【2】. Walker CK et al.^【3】conducted a retrospective study of children who had autistic spectrum disorder (ASD) and multiple forms of growth retardation (DD). After adjusting for maternal education, parity and pre-pregnancy obesity, these researchers found that ASD children were twice as likely to be exposed to the pathological state of PE as the control group, and the risk increased with the severity of PE. In addition, placental insufficiency under the severe PE state appears to be associated with an increased risk of DD. A prospective cohort study constructed by Sun BZ et al.^【4】showed that children who were exposed to the intrauterine environment of PE were associated with an increased risk of attention deficit/hyperactivity disorder (ADHD), autism spectrum disorder (ASD), epilepsy and intellectual disability. It is suggested that in addition to the risks associated with preterm birth, full-term PE also has lasting effects on the neurodevelopment of children.

There are 6 DLX genes in mammals and three pairs of closely linked transcriptional units. DLX homeobox genes play an important role in the migration and differentiation of subglobus pallidus precursor cells^【5】. These progenitor cells produce different subtypes of γ-aminobutyric acid (GABA)-expressing forebrain neurons, including local loop cortical intermediate neurons^【6】. The abnormal development of GABAergic interneurons is associated with a variety of neurodevelopmental disorders, including epilepsy, schizophrenia, Rett syndrome and autism^【7】. The non-lethal gene DLX5 is a member of this family and is involved in the development of the central nervous system. Previous research has shown that increased expression levels of DLX5 can promote the early development and differentiation of pluripotent stem cell-neural crest cells^【8】. In a previous study, Zadora et al.^【9】found that imprinting in the placental tissue of PE patients was disordered and that expression levels of the DLX5 gene were up regulated in 69% of PE placental tissue due to the loss of imprinting. In another study, Lombare et al.^【10】reported that levels of anxiety and obsessive-compulsive repetitive exercise decreased significantly when the expression levels of the DLX5 gene were silenced in rat models. However, the correlation between increased expression levels of DLX5 and the growth and development of offspring, especially the nervous system, remains unclear. Therefore, the purpose of this study was to use the zebrafish model to investigate the relationship between increased expression levels of maternal DLX5 and dysplasia in the nervous system and abnormal behavior in the offspring.

2.1 DLX5a knock down

Selection and confirmation of CasRx target sites

The mRNA sequence for the of zebrafish zDLX5a gene was identified and downloaded from the NCBI platform (National Center for Biotechnology Information (nih.gov), and the transcript sequence of the target gene was identified on the Ensembl platform (Ensembl genome browser 104). The sequence was analyzed by Snapgene software and compared with the mRNA sequence of the target gene; we then designed a target sequence within the common region. Once the target sequence was confirmed, its specificity was verified on the Ensembl platform (Ensembl genome browser 104).

Preparation of gRNA

PCR amplification was used to bridge the double-stranded DNA template with suitable primer pairs, and then T7 RNA polymerase (NEB; cat#M0251S) was used to synthesize gRNA. Next the gRNA was digested with DNase I (NEB; cat#M0303S) for 15 min to remove the DNA template, and then purified with a Post-reaction Clean-up Kit (Sigma).

The gRNA primer pairs were as follows:

zDLX5a-CasRx-F: GAAATTAATACGACTCACTATAGGcactagtgcgaatttg cactagtctaaaac

zDLX5a-KD-gRNA-R1: ACATCTACATCACAGATAGCCAgttttagactagtgc aaa

zDLX5a-KD-gRNA-R2: TACAAGGAGACGGTCAGGATGTgttttagactagtg caaa

gRNA template synthesis

PCR reactions were prepared as described in Table1.

Table 1. Constituents of PCR reactions

Reagents	Volume/μL
2 × PCR mix	50
Forward Primer（10 μM）	16
Reverse Primer（10 μM）	16
H₂O	18
Total	100

First, we prepared 100-200 μL reactions and ensured that the concentration of DNA template obtained by recovery and purification exceeded 100 ng/μL. The template was divided equally into two tubes for PCR. The PCR program was as follows: preheating at 98 ℃ for 30 s, denaturation at 98 ℃ for 10 s, annealing at 55 ℃ for 30 s, extension at 72 ℃ for 15 s, and continuous extension at 72 ℃ for 10 min,12 ℃.

Purification of the gRNA template. First. 0.6g of Agar powder (OXOID, LP0028A) was mixed with 60 mL TAE buffer in a conical bottle and heated in microwave oven until clarified. Once the solution had cooled, added 6 μL of nucleic acid stain. The molten gel was used to create a gel for electrophoresis.

Following electrophoresis, the separated DNA bands were cut and placed in an RNase-free centrifuge tube. The gel was weighed and three times its volume of PE solution was added. Then, the gel was dissolved by placing the tube in a water bath at 56℃ until the gel was completely dissolved and preheat with RNase-free H₂O. The final solution (800-900 μL) was added to an adsorption column and left for 2 min. Then, the solution was centrifuged at 12000 rpm for 1min. The liquid was aspirated from the collecting tube, left for 2min, and then centrifuged at 12000 rpm for 1min. Then, we discarded the liquid in the collection tube and added 600 uL of rinse solution (PW). The tube was left for 2 min and then centrifuged at 12000 rpm for 1 min. The waste liquid was then discarded, and the centrifugal column was placed back into the collection tube and spun at 12000 rpm for 3min. Next, the column was transferred to an RNase-free centrifuge tube and air-dried on a clean table for 5 min. Preheated RNase-free H2O was then dripped into the middle of the adsorption film; we measured the brightness of the electrophoretic band and the volume of recovery (30-50 μL). After 5 min incubation at room temperature, the sample was centrifuged at 12000 rpm for 3 min.

Transcription and purification of gRNA in vitro. The in vitro transcription system was prepared as follows:

Table 2. The in vitro transcription system

Reagents	Volume/μL
10 × T7 Reaction Buffer	2
ATP	2
CTP	2
GTP	2
UTP	2
RNA inhibitor	0.5
Template DNA (Approx. 500 ng）	2
T7 Enzyme Mix	2
H₂O（RNase-free）	5.5

The reaction solution was incubated at 37 ℃ for 4 h.

The purification of gRNA

The prepared reaction solution was added to the same volume of LiCl solution and incubated overnight at -20 ℃. On the second day, the solution was centrifuged at 13000 rpm for 10 min at 4 ℃. Following centrifugation, the supernatant was discarded and washed twice with 75% RNase-free ethanol. The solution was then centrifuged at 13000 rpm for 5 min and the supernatant was discarded. After the liquid was thoroughly absorbed and air-dried, we added 30 μL of RNase-free water. Then, we measured the concentration and stored the gRNA at-80 ℃.

2.2 The preparation of CasRx mRNA

The pXR001 plasmid was purchased from Addgene and used as the template for CasRx. Primers were designed to amplify CasRx DNA. Capped CasRx mRNA was synthesized by a mMESSAGE mMACHINE SP6 Transcription Kit (Invitrogen) and then purified in accordance with the purification procedure described earlier (Ambion; cat#AM1344/T7 RNA polymerase; cat#AM1348/T3 RNA polymerase).

CasRx DNA template preparation

CasRx DNA reaction system and reaction conditions were as follows:

Table 3. The CasRx DNA reaction system and reaction conditions

Reagents	Volume/μL	Temperature	Time
Primer STAR	25	98℃	3 min
Primer F（10 μmol）	1	98℃	15 s	35 cycles
Primer R（10 μmol）	1	55℃	45 s
Template	1	72℃	2 min
ddH₂O	22	72℃	10 min
	50	12℃	10 min	Stored

Purification of the CasRx DNA template

The CasRx DNA template was prepared in the same manner as gRNA.

CasRx mRNA transcription in vitro

The reaction system was as shown in Table 4:

Table 4. The CasRx mRNA transcription system

Reagents	Volume/μL
10 × Reaction buffer	2
2 × NTP/CTP	10
SP6 Enzyme	2
Template（> 500 ng)	5.5
RIn	0.5

The reactions were carried out at 37 ℃ for 4 h, (hot cap 70 ℃) 1 μL DNAase, 37 ℃, digested 30 min.

The reaction system with poly A tail is shown in Table 5.

Table 5. The reaction system with poly A tail

Reagents	Volume/μL
IVT reaction solution	20.5
H₂O	36
5 × EAP Buffer	20
ATP	10
Mncl₂	10
E-PAP enzyme	3.8
Total	100

The reaction was carried out at 37 ℃ for 1 h (hot cover 70 ℃).

Purified CasRx mRNA

CasRx mRNA was purified in the same manner as gRNA.

2.3 Microinjection of zebrafish embryos

Primer design

The sequences of the primers are shown below.

F: ATCCGTCTCAGGAATCTCCAACC

R: TAATACGACTCACTATAGGGATCCGAGTGCCAACGAGTGTAA

Preparation of the linear template DNA

The PCR reactions were prepared as shown in Table 6.

Table 6. PCR reactions

Reagents	Volume
2×Taq Master Mix	50.0 μL
cDNA	4.0 μL
Forward Primer（10 μM）	6.0 μL
Reverse Primer（10 μM）	6.0 μL
Add H₂O	To 100 μL

The PCR reaction procedure as follows: 94 ℃ 5 min; 94 ℃ 10 s, 60 ℃ 15 s, 72 ℃ 42, 32 cycles; 72 ℃ 5 min. Amplicons were analyzed by 1% agarose electrophoresis detection.

Preparation and purification of the probe

The probe was prepared as described in Table 7.

Table 7. Preparation of the probe

Reagents	Volume
Linear Template DNA	To 1μg
10x Transcription buffer	1.0 μL
DTT 50 mM	1.0 μL
DIG-RNA labeling mix (UTP)	1.0 μL
RNAsein (40U/μL)	0.5 μL
T3 or T7 RNA polymerase (20U/μL)	0.5 μL
RNase free Water	To 10 μL

The reagent was mixed well and incubated in a 37 °C water bath for 3-4 hours. Then, we added 2 μL of RNAse-free DNAse I and 18 μL of RNAse-free H2O to the 10 μL reaction system; this was then incubated for 30 min at 37 °C. Next, 1 μL of 0.5M EDTA (RNAse-free) was added to terminate the reaction. A Sigma Spin Post Reaction Purification Column was placed into the collection tube and centrifuged at 2800 rpm at 4 ℃ for 15 s. The purification column was removed from the tail and lid, and then centrifuged at 2800 rpm and 4 ℃ for 2 min. The purified column was then transferred into a new RNAse-free microcentrifuge tube and mixed with RNA reaction solution before being centrifuged at 2800 rpm (4 ℃) for 4 min. The purity of the probe was evaluated by electrophoresis and the probe was stored at -80 ℃ for use.

In situ hybridization

Embryos were microinjected 0-15 min after fertilization. The egg membrane was removed after 24 hours. Zebrafish embryos that had developed to the appropriate stage were selected and fixed in 4%PFA-PBS. Pigmentation was removed by incubation in 0.5% KOH + 3% H2O2; then, the embryos were fixed overnight in methanol at-20 ℃. The preserved embryos were removed and passed through 75% methanol / 25%PBS, 50% methanol / 50%PBS, 25% methanol / 75%PBS and PBT (5 min each time). Then, the embryos were washed for 5 min with PBT (PBT; 0.1%Tween-20 in PBS). After digestion with 1 mL of 10 μg/mL protease K solution (embryos prior to the Bud stage did not need to be digested; 24 hpf embryos were digested for 10 min; 36 hpf embryos were digested for 20 min; 48 hpf embryos were digested for 30 min). Then, we removed protease K and added 4% PFA-PBS for 20 min to stop enzyme digestion. Then, the embryos were washed five times with PBT (5 min per wash). Then, we added an appropriate amount of pre-hybridization solution followed by incubation in a water bath at 70 ℃ for 3-4 hours. The probe was diluted in hybrid solution to 1 μg/mL and hybridized overnight in a water bath at 70℃. The probe was then recycled at -20℃. The embryos was incubated at 75% HM/25% 2 × SSC, 70 ℃ 10 min; 50% HM/50% 2 × SSC,70 ℃ 10 min; 25% HM/75% 2 × SSC, 70 ℃ 10 min; 2 × SSC, 70 ℃ 10 min; 0.2 × SSC, 70 ℃ 30 min; 0.2 × SSC, 70 ℃ 30 min; 75% 0.2 × SSC/25% PBT, room temperature 10 min; 50% 0.2 × SSC/50% PBT, room temperature 10 min; 25% 0.2 × SSC/75% PBT, incubated at room temperature for 10 min; PBT, incubated at room temperature for 10 min. Next, we added an appropriate amount of sealing solution to the embryos; this was followed by incubation at low speed on a shaker for 3-4 h at room temperature. An alkaline phosphatase-coupled digoxin antibody was then diluted with fresh sealing solution (the dilution ratio was 1: 5 000) and placed on a horizontal shaker overnight at 4 ℃ with gentle shaking. The antibody reaction solution was then discarded, and the embryos were rinsed six times with PBT at room temperature (15 min per wash). Next, we removed the PBT as much as possible and rinse the embryos three times with alkaline tris buffer at room temperature (5 min per wash). We removed the alkaline tris buffer, added freshly configured chromogenic solution (labeling solution) and allowed color to develop in the absence of light at room temperature or overnight at 4℃. We observed the chromogenic effects at regular intervals and terminated the chromogenic reaction when the positive signals appeared blue-purple. The chromogenic solution was then removed and an appropriate amount of terminating solution was added. The embryos were then rinsed three times at room temperature; followed by 10 min, 30 min, and 1 h. The embryos were transferred into 100% glycerol and balanced it overnight at low speed on a shaker at 4 ℃. The next day, we used an Olympus microscope to acquire photographs. The experiment was divided into two groups as follows: the CasRx control group (CasRx) and the SgRNA knock-down group (zDLX5a-sgRNA1+zDLX5a-sgRNA2+CasRx).

2.4 Detection of target gene expression by fluorescence quantitative PCR

Extraction of total RNA: Total RNA was extracted by placing the sample into a 2 mL microcentrifuge tube (RNase-free) and mixed with 1 mL of RNAiso Plus. Samples were then homogenized and placed at room temperature for 5 min. The supernatant was then transferred to a fresh 1.5 mL microcentrifuge and RNA was extracted using a conventional chloroform/ isopropanol procedure. Extracted RNA was resuspended in 30 μL RNase-free ultra-pure water and stored at-70 ℃.

The determination of RNA extraction quality: The nucleic acid concentration and A260/A280 value of RNA extracted from each sample were accurately measured and recorded by a nucleic acid concentration meter. RNA integrity was determined by 2% agarose gel electrophoresis in 1 × TBE buffer; 2 μL of total RNA was mixed with 0.5 μL of 6 × buffer and loaded onto the gel. The gel was run for 15 min at a voltage of 110V and 30-50 mA.

Reverse transcription synthesis of cDNA: The reaction system was prepared in accordance with the manufacturer’s instructions (NovoScript ®1st Strand cDNA Synthesis SuperMix).

Primer sequences: ef1 α was selected as the internal reference gene. Fluorescent PCR primers were designed for each gene using primer5 software. Following BLAST comparisons, the primers were synthesized by Fuzhou Shangya Biology Co., Ltd.

The primers are as follows:

Table 8. Primer sequences

Gene name	Primer sequence (5’-3’)	Amplified fragment length length
zDLX5a	F：TATTGTTCACCGAACTCGGGC	198 bp
	R：TGTTTCTTTTTCTTGCGGGC	198 bp
ef1α	F：CTTCTCAGGCTGACTGTGC	358 bp
	R：CCGCTAGCATTACCCTCC	358 bp
DKK1	F：TAGCACCTTGGATGGGTATTC	108 bp
	R：CCTGAGGCACAGTCTGATGAC	108 bp
BOZ	F：GGATGTACTGCTGCTGCGTT	174 bp
	R：GCTGCTCCGTCTGGTTGTCG	174 bp
OTX2	F：TGTGCTGGAGGCTTTATTCG	128 bp
	R：GACACTTTGCCCTTCGGTTT	128 bp
Wnt8a	F：TGCCACCAGAGAGACCGCCT	144 bp
	R：ACCCAACCACGACCACCCAT	144 bp
tbx6	F：AACACTGGCAGAACCGCACC	148 bp
	R：CCCCACATCAGCACATCACG	148 bp
Notch1b	F：CAGCATCCACAACTACAGGT	132 bp
	R：CAGAGGAAGTCCGAATCAAA	132 bp
deltaC	F：GAAACCTGGAACGCAGAAAC	164 bp
	R：TCGCACACGACACGATAAGA	164 bp

Fluorescence quantitative PCR. First, the specificity of the primers was verified by routine PCR. Then, a fluorescent quantitative PCR test was carried out using the ChamQ SYBR qPCR Master Mix (Q331-02) kit. The results of fluorescence PCR were determined by the 2-^△△CT method. All data were analyzed by GraphPad Prism version and differences between groups were compared by one-way analysis of variance (ANOVA). Differences were statistically significant if P < 0.05.

2.5 Brain volume measurement

Microphotography

Zebrafish were allowed to develop to 48 hpf, 72 hpf and 96 hpf after injection and then placed in methylcellulose solution in the prone position. Images of each whole fish were then acquired on an inverted microscope (Nikon, SMZ745T) at two different magnifications (3X and 7X).

Statistical methods for brain volume. Photographs were imported into Image J software and adjusted to 8 bits. Then, we used the software to circle the brain; the software automatically calculated the brain volume.

2.6 Behavior trajectory analysis

Trajectory was analyzed with Noldus EthoVision XT software. The track capture time was 10min, and the analysis index included the trajectory moving distance and the trajectory moving average speed.

2.7 Data processing

Data were statistically analyzed by SPSS version 19.0 software package and expressed as mean ± standard deviation (SD). Differences between groups were compared by one-wat analysis of variance (ANOVA); α = 0.05 and P<0.05 was statistically significant. GraphPad Prism 8 was used to plot figures.

3.1 Results of probe electrophoresis

Probe electrophoresis was performed with 1% agarose gel, and the results were shown in Fig. 1. The figure showed that 1 (DLX5a probe) was significantly lighter than that of M (control group), that was, DLX5a probe had knock-down effect.

3.2 In situ hybridization

As shown in Fig. 2, the positive binding signals arising from in situ hybridization in the WT control group and the negative control group (CasRx) were more obvious than those in the experimental group (gRNA + CasRx), thus indicating that the knock-down had been successful.

3.3 The efficacy of zDLX5a knock-down

Twenty-four hours after gene knockout, the expression levels of the zDLX5a gene in the experimental group (gRNA + CasRx) were significantly lower (P < 0.05) than those in the negative control group (CasRx), thus indicating that the target gene had been knocked down successfully (Fig. 3).

Ninety-six hours after gene knockout, the expression levels of DKK1 (P < 0.01), Wnt8a (P < 0.05), tbx6 (P < 0.001), notch1b (P < 0.01), and deltaC (P < 0.01) genes in the experimental group (zDLX5a-sgRNA + CasRx) were significantly higher than the negative control group (CasRx). Also, the expression levels of the OTX2 (P < 0.0001) gene in the experimental group (zDLX5a-sgRNA + CasRx) were significantly lower than those in the negative control group (CasRx). There was no significant difference between the two groups with regards to the expression levels of the BOZ gene (P > 0.05; Fig. 4). Figures 3 and 4 showed that the expression levels of DLX5 in the experimental group (zDLX5a-sgRNA + CasRx) were significantly higher than that in the negative control group (CasRx).

3.2 Ratios of brain volume area to whole body area

There was no significant difference in the ratios of brain volume area to whole body area in zebrafish at 48 hpf and 72 hpf when compared with the WT group, the negative control group (CasRx), and the experimental group (DLX5a) (P > 0.05). The ratios of brain volume area to whole body area in zebrafish at 96 hpf in the experimental group (DLX5a) were significantly lower than those in the WT group and the negative control group (CasRx) (P < 0.01). There was no significant difference in the ratios of brain volume area to whole body area in zebrafish at 48 hpf、72 hpf and 96 hpf when compared between the WT group and the negative control group (CasRx) (P > 0.05; Fig. 5).

3.3 Distances and speeds of the behavior trajectory

The distances associated with behavior trajectory of zebrafish on the 6th day in the experimental group (casRx mRNA + DLX5a) were significantly shorter than those in the negative control group (casRx mRNA) (P < 0.01; Figs. 6 and 7). The speeds associated with behavior trajectory in zebrafish on the 6th day in the experimental group (casRx mRNA + DLX5a) were significantly lower than those the negative control group (casRx mRNA + DLX5a) (P < 0.05; Fig. 8).

In this study, we found that the ratios of brain volume area to whole body area in zebrafish at 96 hpf in the experimental group (gRNA + CasRx) were significantly lower than those in the WT group and the negative control group (CasRx). Furthermore, the distances and speeds of the behavior trajectory in zebrafish on the 6th day in the experimental group (casRx mRNA + DLX5a) were significantly shorter and lower than those in the negative control group (casRx mRNA). Therefore, we speculate that the increased expression levels of DLX5 in the state of PE pregnancy may significantly inhibit the development of the nervous system in offspring.

Similar to our results, Wang et al.^【11】found that although the differentiation of the prenatal basal ganglia of Dlx5/6 (+/-) mice was basically intact, their forebrain developed in a malformed manner. Furthermore, the intermediate neurons of Lhx6 (+) and Mafb (+) mice were disordered and tangential migrations to the cortex were reduced. These researchers further transplanted mutant immature interneurons into WT brain and found that the deletion of DlX5 or DlX5&6 preferentially reduced the number of mature parvalbumin (+) interneurons. Moreover, the number of dendritic branches of the parvalbumin (+) interneurons increased significantly. These results suggested that DlX5 and DlX6 were necessary for the development and function of neocortical interneurons innervating parvalbumin (+).

While investigating the role of DLX5 in olfactory development, Levi et al.^【12】found that the histology of olfactory receptor neurons (ORN) in Dlx5 (-/-) mice was the same as that of WT mice, although their axons could not make contact with the olfactory bulb (OB); furthermore, the OB lacked a nerve fiber bulb, the cell layer was disordered, and the number of TH- and GAD67- positive neurons was reduced. These researchers further transplanted the OB of Dlx5 (-/-) mice into WT mice and found that the WT ORN axons could enter the mutant OB and form a neurofibroma but could not rescue the disordered cell layer and expression of TH- and GAD67. It was possible that DlX5 plays an important role in the connection of ORN axons and the differentiation of OB intermediate neurons. Based on these data, it is possible that elevated levels of DLX5 in patients with PE may inhibit the normal development of different types of neurons in the nervous system of offspring.

Many studies have confirmed that the expression levels of DLX5 gene is highly related to mental disorders. As early as 2005, Horike et al.^【13】reported a loss of imprinting in the maternal expression gene DLX5 in the lymphoblasts of patients with Rett syndrome; these researchers also indicated a reduction of imprinting for the DlX5 gene in the brains of mice. Because DLX5 regulates the production of enzymes that synthesize GABA, the loss of DLX5 imprinting may change the activity of GABA neurons, thus resulting in the clinical manifestations of Rett syndrome. Cho et al.^【14】found that the fast-spiking interneurons (FSINs) in Dlx5/6 (+/-) mice became abnormal after puberty and that this was manifested by the lack of cognitive flexibility and γ oscillations induced by external stimulation in heterozygous mice. Furthermore, it was found that inhibiting the intermediate neurons in the prefrontal cortex (PFC) of the control group could replicate these defects while stimulating them with γ frequency could restore the cognitive flexibility of adult Dlx5/6 (+/-) mice. Collectively, these available data indicated that abnormal expression levels of the DLX5 gene could mediate the abnormal biological activity of different types of neurons and that this was related to the pathogenesis of a variety of mental disorders.

This study has several advantages and limitations that need to be considered. The main advantage of the present research is that we established a zebrafish line in which the expression levels of DLX5 were elevated. We chose the zebrafish as a model because their culture cycle is short, and the culture method is simple. Technical capability for zebrafish research is very mature and the appropriate indicators are not only easy to detect and compare quantitatively, but they can also directly reflect the results. The disadvantage of our experiment is that the objects selected in this experiment are lower animals, zebrafish; the specific characteristics of this species are quite different from humans, mammals, and primates. Therefore, whether our experimental results can be directly applied to the development of human nervous system remains to be explored. In addition, in our present research, we did not classify the development of different types of neurons. Future research should aim to investigate the specific mechanisms between the increase of maternal DLX5 gene expression in PE and behavioral changes in the offspring.

Funding Information

This research was funded by the Guide Fund for the Development of Local Science and Technology from the Central Government (Reference: 2020L3019), the Joint Funds for the Innovation of Science and Technology, Fujian Province (Reference: 2020Y9134), the Fujian Medical Innovation Subject (Reference: 2021CXA034), the National Health and Family Planning Commission Science Foundation (Reference: 2019-WJ-04), Health research project of Department of Finance (Fujian finance refers to [2019] No. 827) (2020Y183)

Acknowledgements

We would like to thank the EditSprings (https://www.editsprings.cn/) for the expert linguistic services provided.

Competing interests

The authors report no conflict of interest.

Statement

This manuscript has been read and approved by all of the authors and the requirements for authorship as stated earlier in this document have been met. Each author confirms that the manuscript represents honest work and that the information has not been submitted for publication elsewhere.

Authors' Contribution

Concept, design, definition of intellectual content (Jianying Yan) and literature search (Tingting Liao, Xia Xu, Junzi Wu and Yi Xie). Experimental studies, data acquisition, data analysis and statistical analysis (Tingting Liao, Xia Xu, Junzi Wu and Yi Xie). Manuscript preparation, manuscript editing and manuscript review (Tingting Liao, Xia Xu, Junzi Wu, Yi Xie and Jianying Yan). All authors commented on previous versions of the manuscript. Tingting Liao and Xia Xu contributed equally to the article and are therefore considered as co-first authors. All authors read and approved the final manuscript.

Data availability

The datasets used and analyzed during the current study are available from the corresponding author on reasonable request.

Ethical approval

The Ethics Committee of Fujian Maternity and Child Health Hospital approved all protocols (Reference: 2021KLRD631).

Sibai BM, Stella CL. Diagnosis and management of atypical preeclampsia-eclampsia. Am J Obstet Gynecol. 2009 May;200(5):481.e1-7.
Paauw ND, Lely AT. Cardiovascular Sequels During and After Preeclampsia. Adv Exp Med Biol. 2018;1065:455-470.
Walker CK, Krakowiak P, Baker A, et al. Preeclampsia, placental insufficiency, and autism spectrum disorder or developmental delay. JAMA Pediatr. 2015 Feb;169(2):154-62.
Sun BZ, Moster D, Harmon QE, et al. Association of Preeclampsia in Term Births With Neurodevelopmental Disorders in Offspring. JAMA Psychiatry. 2020 Aug 1;77(8):823-829.
Sumiyama K, Tanave A. The regulatory landscape of the Dlx gene system in branchial arches: Shared characteristics among Dlx bigene clusters and evolution. Dev Growth Differ. 2020 Jun;62(5):355-362.
Le TN, Zhou QP, Cobos I, et al. GABAergic Interneuron Differentiation in the Basal Forebrain Is Mediated through Direct Regulation of Glutamic Acid Decarboxylase Isoforms by Dlx Homeobox Transcription Factors. J Neurosci. 2017 Sep 6;37(36):8816-8829.
Poitras L, Yu M, Lesage-Pelletier C, et al. An SNP in an ultraconserved regulatory element affects Dlx5/Dlx6 regulation in the forebrain. Development. 2010 Sep;137(18):3089-97.
hu H, Wu JY. Induction of Osteoblasts by Direct Reprogramming of Mouse Fibroblasts. Methods Mol Biol. 2020;2155:201-212. D
Zadora J, Singh M, Herse F, et al. Disturbed Placental Imprinting in Preeclampsia Leads to Altered Expression of DLX5, a Human-Specific Early Trophoblast Marker. Circulation. 2017 Nov 7;136(19):1824-1839.
de Lombares C, Heude E, Alfama G, et al. Dlx5 and Dlx6 expression in GABAergic neurons controls behavior, metabolism, healthy aging and lifespan. Aging (Albany NY). 2019 Sep 12;11(17):6638-6656.
Wang Y, Dye CA, Sohal V, et al. Dlx5 and Dlx6 regulate the development of parvalbumin-expressing cortical interneurons. J Neurosci. 2010 Apr 14;30(15):5334-45.
Levi G, Puche AC, Mantero S, et al. The Dlx5 homeodomain gene is essential for olfactory development and connectivity in the mouse. Mol Cell Neurosci. 2003 Apr;22(4):530-43.
Horike S, Cai S, Miyano M, et al. Loss of silent-chromatin looping and impaired imprinting of DLX5 in Rett syndrome. Nat Genet. 2005 Jan;37(1):31-40.
Cho KK, Hoch R, Lee AT, et al. Gamma rhythms link prefrontal interneuron dysfunction with cognitive inflexibility in Dlx5/6(+/-) mice. Neuron. 2015 Mar 18;85(6):1332-43.

No competing interests reported.

Download PDF

Version 1

posted

You are reading this latest preprint version

Increased expression levels of DLX5 inhibit the development of the nervous system

Status:

Version 1

Abstract

Figures

1 Introduction

2. Materials & Methods

3 Results

3.1 Results of probe electrophoresis

3.2 In situ hybridization

3.3 The efficacy of zDLX5a knock-down

3.2 Ratios of brain volume area to whole body area

3.3 Distances and speeds of the behavior trajectory

4. Discussion

Declarations

References

Additional Declarations

Status:

Version 1