DOI: https://doi.org/10.21203/rs.3.rs-1549484/v1
Purpose: This study aims to compare the cytotoxic, apoptotic, and oxidative effects of preserved and preservative-free forms of brimonidine 0.15% on the human corneal epithelial cell (HCEC) line.
Methods: Time-dependent cytotoxicity studies were performed at 5 and 15 minute and 1, 6, and 24 hour with the Alamar Blue method in HCEC treated with test solutions. For apoptotic studies, Annexin-V and 7-AAD staining were performed and flow cytometry was used. To support this, mRNA expressions and protein expressions of BAX, BCL-2, and caspase-3, -9, -12, which are among the proapoptotic genes, were evaluated by qRT-PCR and Western-Blot method, respectively.
Results: Cell viability was 76.4% with the preserved solution and 36.05% with the preservative-free solution at the 5th minute. No significant difference was observed with either solution at the 15-minute mark, while cell viability did not change significantly after 1 hour. In the apoptosis evaluation, it was observed that the preservative-free solution increased the early apoptotic activity to a greater degree (2.91-fold, p<0.05). No significant difference was observed in the ROS levels of either solution compared to the control group. It was determined that the preservative-free solution more prominently triggers apoptosis by activating pro-apoptotic genes and the caspase cascade.
Conclusion: It was demonstrated that the preserved solution is less cytotoxic to the HCEC line in the early period, has less early apoptotic activity, and does not significantly increase ROS levels. Further investigations of individual components are necessary to fully understand the toxicity of these ophthalmic solutions.
Glaucoma is a chronic and multifactorial optic neuropathy characterized by progressive optic nerve damage and the second most common cause of vision loss worldwide after cataracts [1]. Although factors such as age, family history, and race contribute to the development of glaucoma, high intraocular pressure (IOP) is recognized as the greatest risk. Today, all drugs used for the medical treatment of glaucoma aim to prevent optic nerve damage by lowering IOP. Brimonidine (5-bromo-6-(2-imidazolidinylideneamino)) quinoxaline is a highly selective alpha2-adrenergic receptor agonist that lowers intraocular pressure (IOP) by reducing aqueous humor inflow and increasing uveoscleral outflow. It is frequently preferred for both short-term and long-term treatments after laser procedures due to its advantages such as effective aqueous suppression, quick onset of action, and rapid elimination [2]. While generic brimonidine tartrate was produced in 0.2% and 0.15% concentrations and contains benzalkonium chloride (BAK), a newer, better tolerated form containing 0.005% Purite® has been introduced (Alphagan P, Allergan) [3]. This was followed by preservative-free brimonidine 0.15% preparations using pureflow technology in the following years (Brimogut, Abdi Ibrahim). An important goal in formulating topical ophthalmic glaucoma medications is to maintain effective IOP reduction through effective drug delivery, while enhancing safety and tolerability [4].
Preservatives constitute an important component of ophthalmic solutions in terms of deterring microbial growth in the bottle and preventing the decomposition of the active drug [5]. Benzalkonium chloride (BAK) has become most commonly used preservative in ophthalmic solutions [6]. Due to the known toxic effects of BAK on the ocular surface, the pursuit for novel preservative molecules that minimize toxicity continues. Molecules such as stabilized oxychloro complex (Purite®), sofZia®, polyquad, sodium perborate, and sorbic acid are among the preservatives commercially used for this purpose [7]. Purite is a stabilized oxychloro complex (SOC) and has long been used in water purification systems (sodium chloride) [8]. SOC assumes its preservative effects from its oxidative properties [9]. In recent years, the manufacture of multidose preservative-free (MDPF) bottles with designs that prevent the entry of microorganisms into the bottle has become an increasing trend. However, the literature has shown that preservative-free brimonidine yields more symptoms of irritation in the early period of application compared to its preserved form [7]. As we have observed a similar situation in our clinical practice, in this study, we aimed to examine and compare the cytotoxic, apoptotic, and oxidative effects of two different forms of brimonidine on human corneal epithelial cells.
2.1. In Vitro Human Cell Culture Studies
2.1.1. Growth of Human Corneal Epithelial Cells
Healthy corneal epithelial cells (HCEC, PCS-700-010) were obtained from The American Type Culture Collection (ATCC, Rockville, MD). Cells were incubated in DMEM High Glucose medium containing 10% Fetal Bovine Serum (FBS), 2% Penicillin-Streptomycin, and 1mM L-glutamine in a 37°C, 5% CO2 incubator (BINDER, USA). DMEM High Glucose media was changed every 2 days and at 85-90% confluency cells were passaged.
2.1.2. Cytotoxicity Studies
2.1.2.1. Time-Dependent Cytotoxicity Studies
To determine the time-dependent cytotoxic effect of commercially available preserved and preservative-free Brimonidine 0.15% preparations on HCEC, cells were seeded in 96-well plates at 104 cells per well. Viability of cells incubated for 5 min, 15 min, 1 h, 6 h, and 24 h with Brimonidine and Brimonidine-purity was determined by spectrophotometer (MultiScanGO, USA) using Alamar Blue (Invitrogen, Thermo Fischer Scientific, Waltham, MA, USA). For this, a single clinical dose of both chemicals was delivered (50 µL) via pipette tips. This concentration was equivalent to the use of drops on the clinical ocular surface and a total volume of 200 µm was completed with DMEM High Glucose. Three replications were made for this experiment.
2.1.2.2. Evaluating the Effects of Preserved and Preservative-Free Brimonidine 0.15% Preparations on Cell Apoptosis and Necrosis with Flow Cytometric Methods
Flow cytometry assay was performed to determine the apoptosis and necrosis rates of Preserved and Preservative-Free Brimonidine 0.15% solutions on HCEC cells. For this, HCEC cells were first seeded in 6-well plates and Preserved and Preservative-Free Brimonidine 0.15% solutions added and incubated for 48 h at 5% CO2, 37°C. At the end of the incubation, the cells were taken into clean Eppendorf tubes and centrifuged at 1500 x g for 5 min. The pellet was dissolved with 100 µL of 1X Binding Buffer and stained with Annexin V and 7-AAD dyes. 400 µL of 1X Binding Buffer was added to the cells incubated for 20 min in the dark and analyzed with the NovoCyte Flow Cytometer System (Acea, North America). Thus, early/late apoptosis and necrosis rates were determined.
2.1.3. Detection of Reactive Oxygen
Cellular ROS Assay Kit (Abcam, ab186029) was used to measure the level of reactive oxygen species in cells. For this, cells were first cultured in 96-well plates with 104 cells/90 µL per well. Cells reaching sufficient density were treated with preserved and preservative-free 0.15% brimonidine and incubated at 5% CO2, 37°C. After incubation, 10X test buffer prepared in PBS was added to the cells and ROS production of the cells was stimulated for 15 min. ROS was determined using a fluorescent spectrophotometer at Ex/Em = 650/675 nm.
2.2. Gene Expression studies
qRT-PCR studies were performed to determine the effects of preserved and preservative-free 0.15% brimonidine preparations on mRNA expressions on HCEC cells. HCEC cells were treated with preserved and preservative-free 0.15% brimonidine preparations. Total RNA was isolated by the Trizol method [10] . The amount and purity of the RNA obtained were measured with the Bioanalyzer, and the amount of RNA to be used in cDNA synthesis was calculated. cDNAs were synthesized with the iScript™ cDNA Synthesis Kit. Quantitative Real-Time PCR was performed using 2 µL cDNA, 7.2 µL RNAase-free water, 0.4 µL forward primer, 0.4 µL reverse primer, 10 µL SYBR green, and the CFX-Connect Real-Time PCR system (Bio-Rad, USA). Then, for the reaction mixture of the PCR process, the first activation was performed at 95ºC for 30 sec, denaturation was carried out at 95ºC for 5 sec and at 56ºC for 30 sec, and the process was terminated in a total of 40 cycles. Changes in Bax, Bcl-2, Caspase-3, Caspase-9, and Caspase-12 gene expressions were determined by calculating the ratio of specific gene mRNA expressions to housekeeping genes (GAPDH) mRNA expression. The primers used were designed using Primer 3 software and their specificity was checked with NCBI (Table 1).
Table 1. Primer sequencing for selected genes
|
Gene |
Sequence (5’-3’) |
Temperature (°C) |
|
Bcl-2 |
F- GCTCTTGAGATCTCCGGTTG R- AATGCATAAGGCAACGATCC |
58 |
|
Bax |
F- CAGCTCTTTAATGCCCGTTC R- CTCAGCCCATCTTCTTCCAG |
57
|
|
Caspase-3 |
F- AGCAGCTTTGTGTGTGTGATTCT R- AGTTTCGGCTTTCCAGTCAGAC |
60 |
|
Caspase-9 |
F- CTCACCCTGCCTTATCTTGC R- TGTCGTCAATCTGGAAGCTG |
58 |
|
Caspase-12 |
F- ATGGCTGGAAATGGAAACAG R- TGGCAGTTACGGTTGTTGAA |
57 |
|
GAPDH |
F- GTCAGTGGTGGACCTGACCT R- TGCTGTAGCCAAATTCGTTG |
60 |
2.3. Protein Expression Studies
Western blot studies were performed to determine the effects of preserved and preservative-free 0.15% brimonidine preparations on GADPH (60004-1-Ig), BAX (50599-2-Ig), BCL-2 (ab182858) and Caspase-12 (55238-1-AP) expressions. For this, cells were first grown in 100 mm Petri dishes, treated with preserved and preservative-free 0.15% brimonidine, and incubated at 37°C for 48 h. After incubation, cells were removed mechanically with cold PBS using a cell scraper. Cells were taken into clean Eppendorf tubes and it was centrifuged at 4000 x g at +4°C for 5 min. The pellet was resuspended by adding Ripa buffer (10X) + ddH2O + PMSF mixture. The cells were centrifuged again at 14000 x g at +4°C for 10 min and the protein quantification was determined by making measurements at 562 nm wavelength according to the BCA method using the BSA Standard [11]. Subsequently, their effects on the expression of GAPDH, BAX, BCL-2, and Caspase-12 proteins involved in the apoptosis pathway were determined by the Western Blot technique described by Laemli [12]. According to this method, proteins were separated by SDS-Polyacrylamide Gel Electrophoresis (SDS-PAGE) by applying vertical electrophoresis and specific antibodies were used to determine the expression of each protein.
2.4. Statistical Analysis
Statistical analyses of the findings of the studies were conducted using the GraphPad Prism version 8.00 (GraphPad Software, San Diego California USA) program. The mean ± standard deviation (SD) values of all results were analyzed. The mean values were found using the Student-t-test (p <0.05 *, p <0.001 **, p <0.0001 ***)
3.1. Cytotoxicity Studies
3.1.1. Time-dependent Cytotoxicity Studies
Five minutes into the test, the number of the cells was 76.4% with the preserved preparation and 36.05% with the preservative-free preparation. When all the results were examined, it was observed that more than 50% of the cells died by the 15th minute, and cell viability did not change significantly after 60 minutes (Figure 1).
3.2. Investigation of the Effects of Preserved and Preservative-free Brimonidine 0.15% Preparations on Cell Apoptosis and Necrosis with Flow Cytometric Methods
When apoptotic and necrotic effects were evaluated with flow cytometry, it was found that 9.4% of HCEC cells treated with preserved preparation underwent early apoptosis, 7.2% underwent late apoptosis, and 1.4% underwent necrosis. Thus, preserved brimonidine 0.15% induced 1.32-fold more early apoptosis in HCEC cells than control cells (p<0.05) (Figure 2, 3). It was found that 20.7% of HCEC cells treated with preservative-free brimonidine underwent early apoptosis, 7.6% late apoptosis and 1.2% necrosis. Thus, preservative-free brimonidine drove HCEC cells to early apoptosis 2.91-fold more than control cells (p<0.05) (Figure 2, 3).
3.3. Reactive Oxygen Species
As seen in Figure 4, increased ROS levels were observed in the cells treated with these preparations compared to the negative control group, and decreased levels compared to the positive control group (p>0.05). ROS increased 1.1-fold in cells treated with preserved brimonidine and no increase was observed in cells treated with preservative-free brimonidine (p>0.05).
3.4. Gene Expression Studies
3.4.1. The Effect of Preserved and Preservative-free 0.15% Brimonidine Preparations on BAX, Bcl-2, Caspase-3, -9, and -12 Gene Expression
Compared to the control group, the preserved preparation decreased Bax gene expression to 0.62 of the control group (p>0.05), while the preservative-free preparation increased it 1.88-fold (p<0.0001). Preserved brimonidine increased gene expression of BcL-2 by 1.34-fold (p<0.001), while preservative-free brimonidine decreased it to 0.68 (p>0.05). Preservative-free brimonidine increased gene expression of Caspase-3 by 1.64-fold (p>0.05), while preserved brimonidine decreased it to 0.18 (p<0.001). Preservative-free brimonidine increased gene expression of Caspase-9 by 2.40-fold (p<0.0001), while preserved brimonidine decreased it to 0.51 (p<0001). Preserved brimonidine increased gene expression of Caspase-12 by 2.97-fold (p<0.0001), while preservative-free brimonidine increased it by 2.36-fold (p<0.0001). (Figure 5)
3.5. Protein Expression Studies
According to analyzes of the intensities of the immunoreactive protein bands (Figure 6) the preserved preparation increased Bax protein expression 1.01-fold (p>0.05), while the preservative-free preparation increased it 2.48-fold (p<0.0001). BcL-2 protein expression was decreased 0.55-fold with preserved brimonidine (p<0.0001) and 0.57-fold with preservative-free brimonidine. (p<0.0001) (Figure 7).
Various studies have shown that long term use of ocular hypotensive drugs can cause significant changes to the ocular surface [13, 14]. Since corneal epithelial cells comprise the first-line barrier of the eye, they constitute the cell group most exposed to the toxic effects of topical treatments. Problems of the ocular surface such as dry eye and allergies can be seen in a significant portion of glaucoma cases [15]. Preservative agents in antiglaucomatous preparations may exacerbate the condition and increase epithelial damage and ocular surface disease. The HCEC culture system we used in this study allows rapid evaluation of the toxic effects of ophthalmic solutions.
As previously stated by Friedlaender et al., eye drops are removed from the ocular surface within a few minutes [16]. Therefore, short-term applications are useful in terms of representing a single installation. According to the results of our cytotoxicity studies, it was observed that the preservative-free preparation had a greater cytotoxic effect at 5 minutes, there was no significant difference at 15 minutes and the following time periods (1 hour, 6 hours, 24 hours). Alamar Blue has been shown to be highly sensitive to preservative toxicity in the evaluation of metabolic activity, even after exposure as short as 5 minutes [7]. The findings of this study do not coincide with the cellular toxicity studies conducted with preserved and preservative-free preparations in the literature [17-20]. In a similar study, Xu et al.[7] reported that polyquad, Purite, sodium perborate and sorbic acid do not cause significant cytotoxicity at short exposures of 5 and 15 minutes, preservative-free solutions were shown to have the lowest toxicity among the groups. Noecker et. al [5] conducted an in vivo study by applying artificial tears carboxymethyl cellulose 0.5% containing Purite® BID, and various antiglaucomatous agents including brimonidine Purite® 0.15% BID on New Zealand rabbits. According to the results of their study, there was no significant difference between brimonidine Purite® 0.15% and artificial tears in terms of corneal damage. It was remarkable that the study demonstrated that the toxic effect of brimonidine on its own was indistinguishable from artificial tears containing Purite® as a preservative.
Evaluation of apoptosis with flow cytometric methods revealed a significant increase in early apoptotic activity (Annexin V-FITC + / 7-AAD -), especially with preservative-free brimonidine. Similar to the cytotoxicity results, early apoptotic activity was observed more excessive in unpreserved brimonidine 0.15% compared to brimonidine Purite® 0.15%.
Apoptosis has unique morphological and biochemical features, and caspases play a central role in the final phase. Alterations or anomalies in the apoptosis process contribute to the development of many diseases [21]. Apoptosis is stimulated in two different pathways, intrinsic (mitochondrial) and extrinsic [22, 23]. Apart from that, Caspase-12, while it does not play a role in the mitochondria-related apoptotic pathway, it is thought to be involved in apoptotic mechanisms triggered by ER stress [24]. In terms of ophthalmological diseases, ER stress and misfolded protein response have been shown to play a major role in retinitis pigmentosa, macular degeneration, and glaucoma, which is the area of interest of our study [25].
To the best of our knowledge, this is the first study to investigate the effects of ophthalmic solutions containing brimonidine on genes and proteins involved in apoptosis. It was determined that the preservative-free solution triggers apoptosis by activating the pro-apoptotic genes and caspase cascade more prominently than the preserved solution. In addition, it seems that caspase-12 activation may also trigger apoptosis through ER stress. However, it could be said that both solutions trigger apoptosis through the mitochondria-dependent signaling pathway by significantly reducing the expression of anti-apoptotic Bcl-2 proteins. Herein, the difference between the increase in gene expression and the level of protein encoded by the gene may pose a question mark. There are at least three known reasons for this weak correlation. First, many complicated and variable post-translational mechanisms are involved in the conversion of mRNA to protein, which have not yet been fully clarified. Second, the in vivo half-lives of proteins can vary considerably. Third, errors and noise occur in both protein and mRNA experiments, which makes it difficult to obtain a clear viewpoint [26, 27]. However, when viability findings and the results obtained from flow cytometric analysis of apoptosis are evaluated together, we gain a clearer perspective. Despite few supportive studies in the literature [15, 28, 29], our results regarding apoptosis also seem inconsistent with the strong evidence that preservatives or glaucoma drugs containing preservatives have more cytotoxic, anti-proliferative, and pro-apoptotic effects in vivo and in vitro [30-34]. However, supporting our early-term toxicity and apoptosis results, Duru et al. compared preserved and preservative-free brimonidine 0.15% solutions in terms of ocular symptoms and tear parameters in primary open-angle glaucoma or ocular hypertension cases, they found that the burning sensation was higher in the group treated with preservative-free solutions [8].
SOC is a preservative consisting of a combination of chlorine dioxide, chlorite and chlorate, that causes oxidation of intracellular lipid and glutathione and disrupts vital enzymes for cell function. It is an effective oxidizer as it has a high tendency to form free radicals. However, it rapidly decomposes on the ocular surface and converts into sodium and chloride ions, oxygen, and water. In our study, ROS levels yielded by brimonidine Purite® 0.15% were higher than the negative control group and lower than the positive control group. Although the results were not statistically significant, they appear to be consistent with the oxidative potential of purite. Considering that most glaucoma cases are of advanced age and already carry varying degrees of oxidative stress in their ocular tissues, we would like to emphasize the importance of clinician awareness of treatments that will increase oxidative stress in their treatment approach.
During our investigation of the causes of the inconsistency between our cytotoxic and apoptotic results and the literature, we found that silver ions were used in the cap design in the short product information of the preservative-free solution to provide antibacterial activity. Silver has been used in the past in the form of silver nitrate to prevent neonatal ocular infections. Today, data on silver uptake and metabolism are not well documented, but it is known to cause ocular irritation [35]. Calvery et al. [36] studied the effects of silver salts on rabbit eyes and found that all of the salts were irritative. We believe that the contamination of the preservative-free eye drops used in our study with silver ions implemented in the cap design may be related to the results we obtained. Further studies are required to gain clarification.
Use of the HCEC line was among the limitations of our study. Although this culture system allows rapid evaluation in terms of toxicity, 3D culture systems may provide results closer to real ocular tissues [37]. However, in-vivo models have the potential to provide a more accurate view of the corneal surface in terms of addressing both the interactions between epithelial and immunological cells and the relationship between epithelial cells and tear film. Despite this, in vitro models still maintain an important role in comparative drug studies, as these models also have disadvantages such as cost and difficulty in simulating chronic use. Furthermore, the presence of a clinical study parallel to our study in the literature [8] provided a perspective in terms of in vivo studies. Secondly, eye drops were used in their commercial presentation in this study. Topical formulations contain preservatives and buffers as well as active ingredients. We were unable to identify the individual effects of each of these components in this study. Toxicity is usually caused by preservatives, but other components may also increase or decrease these effects.
In conclusion, the results of our study indicate that the brimonidine 0.15% solution containing purite was less cytotoxic to HCEC in the early period, had less early apoptotic activity, and did not cause a significant increase in ROS levels compared to the preservative-free solution. Further investigations of individual components are necessary to fully understand the toxicity of these ophthalmic solutions.
Funding: The authors declare that no funds, grants, or other support were received during the preparation of this manuscript.
Competing interests: The authors have no competing interests to declare that are relevant to the content of this article.
Author Contributions: All authors contributed to the study conception and design. Material preparation, data collection and analysis were performed by Ali Küçüködük, Irem Mukaddes Durmuş, Mustafa Aksoy and Serdar Karakurt. The first draft of the manuscript was written by Ali Küçüködük and all authors commented on previous versions of the manuscript. All authors read and approved the final manuscript.
Conflict of interest: No potential conflict of interest was reported by the authors.
Acknowledgements/Disclosure
Financial Disclosures: None
Funding: None
Other Acknowledgments: None
1. Kingman, S., Glaucoma is second leading cause of blindness globally. Bull World Health Organ, 2004. 82(11): p. 887-8.
2. Oh, D.J., et al., Brimonidine tartrate for the treatment of glaucoma. Expert opinion on pharmacotherapy, 2019. 20(1): p. 115-122.
3. Dong, J.Q., et al., Effects of the preservative Purite® on the bioavailability of Brimonidine in the aqueous humor of rabbits. Journal of ocular pharmacology and therapeutics, 2004. 20(4): p. 285-292.
4. Palmer, R.M. and H.E. Kaufman, Tear film, pharmacology of eye drops, and toxicity. Current opinion in ophthalmology, 1995. 6(4): p. 11-16.
5. Noecker, R.J., L.A. Herrygers, and R. Anwaruddin, Corneal and conjunctival changes caused by commonly used glaucoma medications. Cornea, 2004. 23(5): p. 490-496.
6. Freeman, P.D. and M.Y. Kahook, Preservatives in topical ophthalmic medications: historical and clinical perspectives. Expert Review of Ophthalmology, 2009. 4(1): p. 59-64.
7. Xu, M., J.G. Sivak, and D.J. McCanna, Comparison of the effects of ophthalmic solutions on human corneal epithelial cells using fluorescent dyes. Journal of ocular pharmacology and therapeutics, 2013. 29(9): p. 794-802.
8. Duru, Z. and C. Ozsaygili, Preservative-free versus preserved brimonidine% 0.15 preparations in the treatment of glaucoma and ocular hypertension: short term evaluation of efficacy, safety, and potential advantages. Cutaneous and ocular toxicology, 2020. 39(1): p. 21-24.
9. Katz, L.J., Twelve-month evaluation of brimonidine-purite versus brimonidine in patients with glaucoma or ocular hypertension. J Glaucoma, 2002. 11(2): p. 119-26.
10. Rio, D.C., et al., Purification of RNA using TRIzol (TRI reagent). Cold Spring Harbor Protocols, 2010. 2010(6): p. pdb. prot5439.
11. Smith, P.e., et al., Measurement of protein using bicinchoninic acid. Analytical biochemistry, 1985. 150(1): p. 76-85.
12. Laemmli, U.K., Cleavage of structural proteins during the assembly of the head of bacteriophage T4. nature, 1970. 227(5259): p. 680-685.
13. Herreras, J.M., et al., Ocular surface alteration after long-term treatment with an antiglaucomatous drug. Ophthalmology, 1992. 99(7): p. 1082-8.
14. Brandt, J.D., et al., Conjunctival impression cytology in patients with glaucoma using long-term topical medication. Am J Ophthalmol, 1991. 112(3): p. 297-301.
15. Pisella, P., P. Pouliquen, and C. Baudouin, Prevalence of ocular symptoms and signs with preserved and preservative free glaucoma medication. British Journal of Ophthalmology, 2002. 86(4): p. 418-423.
16. Friedlaender, M.H., et al., The dilution of benzalkonium chloride (BAK) in the tear film. Adv Ther, 2006. 23(6): p. 835-41.
17. Ishibashi, T., N. Yokoi, and S. Kinoshita, Comparison of the short-term effects on the human corneal surface of topical timolol maleate with and without benzalkonium chloride. Journal of glaucoma, 2003. 12(6): p. 486-490.
18. Ayaki, M., A. Iwasawa, and Y. Inoue, Toxicity of antiglaucoma drugs with and without benzalkonium chloride to cultured human corneal endothelial cells. Clinical Ophthalmology (Auckland, NZ), 2010. 4: p. 1217.
19. Ayaki, M., et al., Cytotoxicity of ophthalmic solutions with and without preservatives to human corneal endothelial cells, epithelial cells and conjunctival epithelial cells. Clin Exp Ophthalmol, 2008. 36(6): p. 553-9.
20. Bron, A., et al., [Efficacy and safety of substituting a twice-daily regimen of timolol with a single daily instillation of nonpreserved beta-blocker in patients with chronic glaucoma or ocular hypertension]. J Fr Ophtalmol, 2003. 26(7): p. 668-74.
21. Kiraz, Y., et al., Major apoptotic mechanisms and genes involved in apoptosis. Tumour Biol, 2016. 37(7): p. 8471-86.
22. Elmore, S., Apoptosis: a review of programmed cell death. Toxicologic pathology, 2007. 35(4): p. 495-516.
23. Saelens, X., et al., Toxic proteins released from mitochondria in cell death. Oncogene, 2004. 23(16): p. 2861-2874.
24. Toshiyuki, N., et al., Caspase-12 mediates endoplasmicreticulum-specific apoptosis and cytotoxicity by amyloid-b. Nature, 2012. 403(6): p. 98-103.
25. Zode, G.S., et al., Reduction of ER stress via a chemical chaperone prevents disease phenotypes in a mouse model of primary open angle glaucoma. J Clin Invest, 2011. 121(9): p. 3542-53.
26. Baldi, P. and A.D. Long, A Bayesian framework for the analysis of microarray expression data: regularized t-test and statistical inferences of gene changes. Bioinformatics, 2001. 17(6): p. 509-519.
27. SZALLASI, Z., Genetic network analysis in light of massively parallel biological data acquisition. Biocomputing'99, 1999: p. 5-16.
28. Wu, K.Y., H.Z. Wang, and S.J. Hong, Cellular cytotoxicity of antiglaucoma drugs in cultured corneal endothelial cells. Kaohsiung J Med Sci, 2007. 23(3): p. 105-11.
29. Guenoun, J.M., et al., In vitro comparison of cytoprotective and antioxidative effects of latanoprost, travoprost, and bimatoprost on conjunctiva-derived epithelial cells. Invest Ophthalmol Vis Sci, 2005. 46(12): p. 4594-9.
30. Hamard, P., et al., In vitro effects of preserved and unpreserved antiglaucoma drugs on apoptotic marker expression by human trabecular cells. Graefes Arch Clin Exp Ophthalmol, 2003. 241(12): p. 1037-43.
31. Liang, H., et al., Conjunctival and corneal reactions in rabbits following short- and repeated exposure to preservative-free tafluprost, commercially available latanoprost and 0.02% benzalkonium chloride. Br J Ophthalmol, 2008. 92(9): p. 1275-82.
32. Kahook, M.Y. and R.J. Noecker, Comparison of corneal and conjunctival changes after dosing of travoprost preserved with sofZia, latanoprost with 0.02% benzalkonium chloride, and preservative-free artificial tears. Cornea, 2008. 27(3): p. 339-43.
33. Baudouin, C., et al., In vitro studies of antiglaucomatous prostaglandin analogues: travoprost with and without benzalkonium chloride and preserved latanoprost. Invest Ophthalmol Vis Sci, 2007. 48(9): p. 4123-8.
34. Yee, R.W., The effect of drop vehicle on the efficacy and side effects of topical glaucoma therapy: a review. Curr Opin Ophthalmol, 2007. 18(2): p. 134-9.
35. Hadrup, N., A.K. Sharma, and K. Loeschner, Toxicity of silver ions, metallic silver, and silver nanoparticle materials after in vivo dermal and mucosal surface exposure: A review. Regul Toxicol Pharmacol, 2018. 98: p. 257-267.
36. Calvery, H.O., H.D. Lightbody, and B. Rones, Effects of some silver salts on the eye:(Silver nitrate, silver ammonium nitrate, silver ammonium sulfate, silver ammonium lactate and a mixture of silver ammonium nitrate and silver ammonium sulfate). Archives of Ophthalmology, 1941. 25(5): p. 839-847.
37. Liang, H., et al., Toxicological evaluation of preservative-containing and preservative-free topical prostaglandin analogues on a three-dimensional-reconstituted corneal epithelium system. British Journal of Ophthalmology, 2011. 95(6): p. 869-875.