Parasite, cells and serum samples
First stage larvae were collected from the subcutaneous tissues of infected goats at the municipal abattoir of Jammu (India), washed with PBS, and identified as per keys of Zumpt1 and stored at -80 °C for RNA isolation. E. coli cells BL21, pET32a(+) vector(Novagen) were used in expression study. For sera, blood samples were collected from field and slaughterhouse and marked as positive and negative based on larval detection by palpation in live animals and by carcass examination. Serum samples from animals testing positive for coenurosis, paratuberculosis, enterotoxaemia, oestrosis, coccidiosis, cryptosporidiosis, haemonchosis, monieziosis, fasciolosis, amphistomosis and brucellosis were used in this study.
Construction of expression cassette in pET32a(+) vector
Total RNA was isolated from L1 stage larvae of P. silenus using RNeasy mini kit (Qiagen, Germany) as per manufacturer protocol. The cDNA was synthesized from total RNA using oligodT primer following the protocol described in cDNA synthesis kit (Revert Aid First strand cDNA synthesis kit, Thermo Scientific). The HyC gene of P. silenus was amplified using HyC gene of cattle warble fly (H. lineatum) specific expression primers based on the published sequences of HyC (EMBL Accession Number X74306) (AAGGATCCATAATCAATGGATACGAAG and ATCTCGAGTTAAAATATTATACCAGTATTTTG). The gene was amplified using a 25 µL reaction mixture containing 2 µL of cDNA, 2.5 µL of 10X Ex Taq buffer (TaKaRa,USA), 1 µL each of forward and reverse primers (10 pmol/µL), 1 µL of 10 mM dNTP mix, 0.5 µL of Ex Taq DNA Polymerase (TaKaRa, USA), and 17 µL nuclease free water. PCR reaction was carried out at initial denaturation of 94 °C for 5 min followed by 35 cycles of denaturation at 94 °C for 1 min, annealing at 56°C for 1 min, extension at 72 °C for 1 min and a final extension at 72 °C for 10 mins.
The amplified PCR product was analysed by 1% agarose gel electrophoresis. The amplified product was purified using Wizard™ SV Gel and PCR Clean-Up System (Promega, USA) and directionally cloned into pET32a(+) expression vector at BamHI and XhoI restriction enzyme sites. The recombinant clone was selected on LB agar plate containing Ampicillin (100 μg/mL). The recombinant plasmid containing gene of interest was confirmed by colony PCR using gene-specific primers and restriction enzyme digestion. The recombinant plasmid was isolated using Plasmid extraction kit and sent for nucleotide sequencing to Agrigenome Pvt. Ltd (Kerala). The sequence received was primarily analysed using BioEdit software and submitted to Gen Bank. Further, the protein encoding nucleotide sequence was translated in silico using the Edit Sequence program of DNA Star (Laser gene Suite 6.0) and BLASTp (protein–protein BLAST) was performed. The sequence generated here was compared to the reference bovine sequences available in the public domain and aligned using CLC Genomics Workbench (Qiagen)39.
The deduced protein sequence of HyC originated from P. silenus was aligned with HyC of other Hypoderminae spp. viz H. lineatum, H. bovis and H. diana with accession numbers X74306, MK473847, EU999953 , respectively. The protein sequences were aligned with CLC genomics platform version 20.01 (Qiagen).
Expression and purification of recombinant protein
The recombinant HyC plasmid was transformed into BL21 host cells and further confirmed by colony PCR. The positive clone was grown in LB broth containing ampicillin and chloramphenicol at 37 °C for overnight. The fresh LB broth was inoculated with overnight culture and incubated at 37 °C at 200 rpm till the culture reached an OD600 0.4-0.6. Henceforth, the expression was induced with 1 mM IPTG and harvested 1mL culture at hourly interval up to 16 hours. The collected fraction was pelleted by centrifugation and level of expression was analysed by SDS-PAGE. The rHyC protein was produced in bulk and the pellet was resuspended into denaturing buffer (8M Urea) and sonicated at 25% amplitude with pulse of 15 seconds for 5 minutes. The lysate was clarified and the supernatant was purified by using Ni-NTA affinity chromatography under denaturing condition (8M Urea). The eluates were dialyzed with decreasing concentrations of urea 6M, 4M, 2M and finally Tris buffer, pH 8.0. The purity of the recombinant protein was analysed by 12% SDS-PAGE gel after staining with Coomassie brilliant blue R-250 stain. The concentration of the recombinant protein was quantified by Bradford protein assay kit (VWR, USA) and stored at -80 °C.
Western blotting
Purified recombinant protein was resolved under 12% SDS PAGE and blotted on nitrocellulose membrane (0.45 μm, Biorad) by Mini Trans-Blot® electrophoretic transfer cell (Bio-Rad). The membrane was blocked overnight with skimmed milk powder 5% (SMP) at 4 °C. Thereupon, the membrane was washed thrice with PBS-Tween-20 (0.05%). The individual lanes were cut and incubated with goat warble fly infected serum (1:50), negative control sera and Oestrus ovis positive sera (1:50), respectively at 37 °C for 1 hour under gentle shaking. Upon triple wash with PBS-T, the membranes were incubated with anti-goat IgG HRP (1:5000 in PBS) for 1 hour at 37 °C. The membranes were washed three times and developed with DAB substrate (VWR, USA).
Optimization of rHyC based iELISA
An indirect-ELISA using rHyC has been optimised and evaluated with known status of positive and negative GWFI sera to detect the anti-HyC antibodies. The optimum concentration of coating antigen, dilution of serum and conjugate, standard checkerboard titration was performed. A total of three different concentration of antigen i.e 0.5μg, 0.25μg and 0.125μg, three different dilutions of sera at 1:400, 1:800 and 1:1600 and two dilutions (1:5000 & 1:10000) of anti-goat IgG HRP conjugate were used in checkerboard titration analysis using 5% SMP as blocking buffer. The maximum differentiation between positive and negative sera (P/N) measured at A490was selected for further analysis.
In brief, 96-well microtiter plate (Costar 3590, Corning-USA) were coated with 100μl of rHyC (0.5μg/well) in 0.05M carbonate bicarbonate buffer (pH 9.6). The plate was incubated at 4 °C overnight. The wells were washed twice with PBS-Tween 20 (0.075%), and then once with PBS, blocked with 5% skimmed milk prepared in PBS (pH 7.4) and incubated at 37 °C for 1 h. After washing, 100 μL of known positive and negative serum sample diluted in PBS (1:400) were added and incubated at 37 °C for 1 h. After washing the plate three times, 100μL of anti-goat IgG HRP-conjugate (Sigma Aldrich, USA) at 1:10000 dilution in PBS (pH 7.4) was added to each well and incubated at 37 °C for 1 h. Following washing, 100 μL of O-phenylenediamine dihydrochloride (OPD) substrate (Sigma Aldrich, USA) dissolved in citrate-phosphate buffer (pH 5.0) with 30% H2O2 was added to individual wells. The reaction was allowed to develop for 10 min in dark and reaction was stopped by adding 50 μL of 1M H2SO4 to each well. Absorbance at 490 nm was measured by using microplate reader (iMarkmicroplate reader, Biorad).
Evaluation of rHyC based iELISA
After optimisation of the iELISA, serum samples with known status (15 positive and 25 negative) were screened for determining the cut-off value. The physicoclinical evaluation was taken as a reference to distinguish the positive and negative samples. Negative reference serum samples were received from animals that had never grazed and belongs to Punjab state of North India, where GWFI has never been reported. The cut-off value was evaluated by the Receiver Operating Characteristic (ROC) curve, using MedCalc software, Mariakerke, Belgium(40). Based on the checkerboard titration results, ROC curves and areas under the curve were plotted, and the sensitivity and specificity of iELISA were calculated using interactive dot diagrams. Cut-off value was calculated according to the Youden index (Youden = Se + Sp-1) and used for immunodiagnosis of goat warble fly. In order to rule out the cross reactivity of optimised rHyC based iELISA with other economically important parasitic and bacterial diseases of goats, known sera positive for oestrosis, monieziosis, coccidiosis, fasciolosis, haemonchosis, amphistomiosis, coenurosis, cryptosporidiosis, Johne’s disease, brucellosis and enterotoxaemia were also screened.
Screening of random samples:
A total of 421 serum samples collected from municipal slaughterhouses in Jammu and different parts of Union Territory of Jammu & Kashmir namely Jammu, Rajouri, Udhampur, Poonch, Samba,Kathua, Reasi, Kishtawar and Doda were tested by optimized rHyC based iELISA.