Human study
87 Japanese non-diabetic healthy male participants went to LSI Sapporo Clinic, Sapporo, Japan, for a complete physical examination. The subjects underwent the 18FDG-PET/CT scan procedure, as described previously7,45. After fasting for 6–12 h, the subjects entered an air-conditioned room at 19°C with light‐clothing (usually a T‐shirt with underwear) and put their legs on an ice block intermittently (usually for 4 min after every 5 min). One hour after the mild cold condition, they were given an intravenous injection of 259 megabecquerels (MBq) fluorodeoxyglucose (FDG) and maintained under the same cold conditions. One hour after the FDG injection, whole‐body PET/CT scans were performed using a PET/CT system (Aquiduo; Toshiba Medical Systems, Tochigi, Japan) in a room at 24°C. With the CT parameters of 120 kV and real‐exposure control, unenhanced low‐dose spiral axial 2‐mm collimated images were obtained. This was used for PET attenuation correction as well as anatomic localization. Subsequently, full‐ring PET was performed in six incremental table positions, each ∼15 cm in thickness. The total time for these scans was ∼30 min.
PET and CT images were coregistered and analyzed using a VOX-BASE workstation (J‐MAC System, Sapporo, Japan). Two experienced, blinded observers assessed the FDG uptake, particularly on both sides of the neck and paravertebral regions, by visually judging the presence of radioactivity greater than that of the background. BAT activity in the neck region was quantified by calculating the maximal standardized uptake value (SUVmax), defined as the radioactivity per milliliter within the region of interest divided by the injected dose in megabecquerels per gram of body weight. Serum samples were obtained before 18FDG-PET/CT scan and used for the analysis of serum SeP level.
All participants provided written informed consent for participation in this study. All experimental protocols were approved by the Ethics Committees of Kanazawa University (approval no. 2017 − 158, UMIN000029276).
Materials
The following antibodies were used as indicated dilutions. Rabbit anti-UCP1 polyclonal antibody (cat. no. #10983; 1:1,000), rabbit anti-GPX4 monoclonal antibody (cat. no. #125066; 1:1,000), rabbit anti-GPX1 polyclonal antibody (cat. no. # 22604; 1:1,000) and rabbit anti- LRP1 monoclonal antibody (cat. no. #92544; 1:20,000) were purchased from Abcam (Cambridge, UK). Rabbit anti-p38 MAPK polyclonal antibody (cat. no. #9212; 1:1,000), rabbit anti-phospho p38 MAPK (Thr180/Tyr182) polyclonal antibody (cat. no. #9211; 1:1,000), rabbit anti-total HSL polyclonal antibody (cat. no. #4107; 1:1,000), rabbit anti-phospho HSL (Ser660) polyclonal antibody (cat. no. #4126; 1:1,000), rabbit anti-phospho-AMPK (Thr172) monoclonal antibody (cat. no. #2535; 1:1,000), and rabbit anti-total-AMPK polyclonal antibody (cat. no. #2603; 1:1,000) and beta-actin antibodies (cat. no. #4967; 1:1,000) were purchased from Cell Signaling (Danvers, MA). Rabbit anti-selenoprotein W polyclonal antibody (cat. no. #600-401-A29) was purchased from Rockland (Limerick, Ireland). Rat anti-human selenoprotein P monoclonal antibody (BD-1) was made in house46. Collagenase D (Roche Diagnostics GmbH, cat. no. #11088866001), Dispase (Roche Diagnostics GmbH, cat. no. #04942078001), Indomethacin (Sigma-Aldrich, cat. no. #I7378), IBMX (Sigma-Aldrich, cat. no. #I5879), Dexamethasone (Sigma-Aldrich, cat. no. #D1756), rosiglitazone (Sigma-Aldrich, cat. no. #R2408), T3 (Sigma-Aldrich, cat. no. #T2877), Insulin (Sigma-Aldrich, cat. no. #I9278), Methoxypolyethylene glycol maleimide (PEG-Mal) (Sigma-Aldrich, cat. no. #63187), L-norepinephrine hydrochloride (Sigma-Aldrich, cat. no. #74480), N-ethyl maleimide (Wako, cat. no. #054-02063), TECP (Thermo Scientific, cat. no. #77720), N-acetyl cysteine (Sigma-Aldrich, cat. no. #A9165), 1S 3R-RSL3 (Sigma-Aldrich, cat. no. #SML2234) and phloretin (Wako, cat. no. #160-17781) were used.
Animals
Selenop-deficient mice were produced by homologous recombination using genomic DNA cloned from an Sv-129 P1 library, as described previously47. BAT or Liver Selenop-deficient mice were maintained on a mixed B6/129 background. Mice carrying floxed alleles of Selenop (C57Bl/6 and 129/sv background) were originally obtained from R. F. Burk (Vanderbilt University School)48. Mice transgenically expressing Cre recombinase under the albumin promoter were generous gifts from Hiroshi Inoue (Kanazawa University). Mice transgenically expressing Cre recombinase under the Ucp1 promoter were purchased from The Jackson Laboratory (J:206508). We backcrossed them with C57Bl/6 mice more than five times. Liver Selenop-KO mice were generated by crossing Selenop floxed mice with Alb-Cre transgenic mice. BAT Selenop-KO mice were generated by crossing Selenop floxed mice with Ucp1-Cre transgenic mice. Because Alb-Cre transgenic mice or Ucp1-Cre transgenic mice and Selenopfl/fl mice were phenotypically indistinguishable, Selenopfl/fl mice were used as negative controls. All mice were genotyped by PCR using the following primers: 5′- TCCTAGATTGGCAGAGGATAGAATGAA − 3′ and 5′- TCAGAAACACCTTCCAACTGTAATGC − 3′ for the floxed Selenop gene and 5′-CGCCGCATAACCAGTGAAAC-3′ and 5′-ATGTCCAATTTACTGACCG-3′ for the Cre transgene.
Animals Care
All the animal studies were carried out following the Guidelines on the Care and Use of Laboratory Animals issued by Kanazawa University. The protocol was approved by the ethical committee of Kanazawa University (Approval NO. 153678). C57BL/6J mice were obtained from Sankyo Lab Service (Tokyo, Japan). The mice were fed a standard rodent food diet CRF1 that contains 0.45 mg/kg of selenium (Oriental Yeast, Tokyo, Japan) or 60% fat rodent food D12492 that contains 0.27 mg/kg of selenium (Research Diet, New Brunswick, USA). All mice used in the current study had a C57BL/6J genetic background. Because female mice had inconsistent phenotypes, only male mice were used in this study. The mice at the age of 7–21 weeks were used unless otherwise indicated.
Cold exposure and rectal temperature measurement
Six hours before cold exposure, all mice have fasted and injected intraperitoneally with PBS or NAC (1.25 mmol/kg body weight). A pair of WT and Selenop-deficient mice were put into a cage in the cold chamber at 4°C for 2 hours. Rectal temperatures were measured every 30 minutes during the period of cold exposure by using a rectal thermometer (weighing environment logger (AD-1687) & an endorectal probe for mice (AX-KO4746-100); A&D Company Limited, Tokyo, Japan). Shivering activities were assessed by video recording and manual counting at indicated time points during cold exposure. Blood glucose levels were measured before and after cold exposure by using a handheld blood glucose meter Glutest mint (Sanwa Kagaku Kenkyusho Co. Ltd., Nagoya, Japan). Serum Non-esterified fatty acid (NEFA) levels were determined by using the NEFA C Enzymatic assay kit (FUJIFILM Wako Diagnostics, USA), according to the manufacturer’s instructions. Immediately after the completion of cold exposure, the mice were sacrificed to obtain tissue samples. For urinary norepinephrine measurement, 24-hour urine samples were collected while the mice were housing at the assigned temperature. Hydrochloric acid was added into the urine sample to a final concentration of 0.1 M for the integrity of norepinephrine until analysis. Urinary norepinephrine levels were measured by Norepinephrine ELISA Kit (Abnova Corporation, Taipei, Taiwan), according to the manufacturer’s instructions. Urinary norepinephrine levels were normalized by creatinine content measured by the Creatinine colorimetric assay (Exocell, Philadelphia, PA).
Image of interscapular temperature by a thermal camera in mice
The image of mice interscapular temperature was captured using the InfRec G100EX thermal camera (Nippon Avionics, Japan) after 2 hours of cold exposure at 4°C. All the mice were fasted for 6 hours before putting into the cold chamber.
Oxygen consumption rate in mice
Six hours before the OCR measurement, all mice were fasted and injected intraperitoneally with PBS or NAC (1.25 mmol/kg body weight). After that, mice were anesthetized and put in an indirect calorimeter chamber individually (Oxymax; Columbus Instruments, Columbus, OH). After recording the baseline OCR for 30 min, the NA (1 mg/kg body weight) was injected subcutaneously and continued the recording for 44 min. VO2 was measured every 8 or 10 minutes throughout the experiment. All procedures were performed under room temperature (24–26°C).
Thiobarbituric acid reactive substances (TBARS)
Levels of TBARS in brown adipose tissue of mice were measured by using TBARS Assay Kit (Cayman Chemical) according to the manufacturer's instructions.
BAT and rectal temperature measurements
BAT and rectal temperature under the NA stimulation in mice was measured according to a procedure previously described49. All mice were fasted in the thermoneutral chamber (30°C) for 12 hours before the experiment. All mice were anesthetized and kept on the heating plate. The sensor probes were inserted under the interscapular brown adipose tissues and in the rectum of the mice. The BAT and rectal temperatures were recorded by the multi-point temperature logger system (LT-200SA-TB, Tateyama Science High Technologies Co., Ltd.). At 5-min after starting temperature recording, the NA (0.2 mg/kg body weight) was injected subcutaneously and the temperature was recorded for 30 min.
RNA isolation, cDNA synthesis, and real-time PCR analysis
Total RNA isolation, cDNA synthesis, and real-time PCR analysis were performed as previously described50. Quantitative RT-PCR was performed using TaqMan probes (Actb 4352341E; Gapdh 4352339E; 18S rRNA 4319413E; Sepp1 Mm00486048_m1; Lrp1 Mm00464608_m1; Ldlr Mm01177349_m1; Lrp2 Mm01328171_m1; Lrp8 Mm00474030_g1; Gpx1 Mm00656767_m1; Gpx4 Mm00515041_m1; Ucp1 Mm01244861_m1; Sepw1 Mm01268252_m1) and the StepOne Plus real-time PCR system (Life Technologies Corporation, Carlsbad, CA).
ELISA for mouse SeP
Ninety-six- well microtiter plates were coated for 18 hr at 4°C with 100 µl of a coating antibody against mouse SeP (made in house) in 0.05 M sodium bicarbonate buffer, pH 9.6. The wells were washed four times with 200 µl PBS containing 0.05% Tween 20 (PBS/T) and incubated at 37°C with 150 µl of blocking solution (1 mg/ml BSA in PBS) for 1 hr. After washing the wells four times, 50 µl of plasma sample (diluted 50 times with PBS/T, containing 1 mg/ml BSA) was added to each well and incubated at 37°C for 1 hr. After washing the wells four times, 50 µl of 9S4 antibody for mouse SeP (Developmental Studies Hybridoma Bank deposited by Burke, R.D., RRID: AB_2617215) labeled with the Peroxidase Labeling Kit-NH2 (DONJINDO Molecular Technologies, Kumamoto, Japan) was added and incubated at 37°C for 1 hr. Finally, the plates were washed eight times. Fifty microliters of TMB was added to each well, and the enzyme-substrate reaction was allowed to proceed for 30 min at room temperature. The color development was stopped by adding 50 µl of 0.25 mol/L sulphuric acid, and the absorbance at 450 nm was measured immediately. Because there are no commercially available mouse SeP protein standards, we compared the net value of absorbance.
Western blot studies
We performed western blotting, as previously reported25. Densitometric analysis of blotted membranes was performed using Image Lab software (Bio-Rad Laboratories, Inc.).
Assessment of sulfenylated UCP1 by gel shift
Sulfenylated UCP1 status in brown adipose tissues was measured as described previously14. In brief, mice BATs were isolated rapidly after indicated in vivo intervention and then homogenized in 100 nM NEM, 1 mM EGTA, 50 nM Tris-HCl, pH 7.4. Following incubation at 37°C for 5 min, the homogenate was further incubated with SDS (2% final) at 37°C for 10 min. Those incubation steps were performed by a thermomixer at 1,300 rpm. After that, excess NEM in the samples was removed by acetone precipitation. The pellets were then resuspended with 1 mM EGTA, 2% SDS, 10 mM TCEP, 50 mM Tris-HCl, pH 7.4 containing a 50 mM of polyethylene glycol polymer conjugated to maleimide (PEG-Mal). Resuspended samples were incubated at 37°C for 30 min, followed by second acetone precipitation to remove excess PEG-Mal. After resuspension of the pallet in RIPA lysis buffer, insolubilized debris was removed by centrifuging at 15,000 rpm for 30 minutes at 4°C. The supernatants were subjected to immunodetection by using the rabbit anti-UCP1 antibody.
Purification of SeP
SeP was purified from human plasma using conventional chromatographic methods, as previously described38. Homogeneity of purified human SeP was confirmed by analysis of both amino acid composition and sequence38.
Primary brown adipocytes
Preparation and culture of primary brown adipocyte were performed as previously reported51. For the knockdown of the target gene, completely differentiated primary brown adipocytes were transfected with a 50 nM of indicated siRNA duplex oligonucleotides with Lipofectamine RNAiMAX (Invitrogen), using the reverse transfection method as described previously52. Selenop specific siRNA (Cat. no. #MSS208936), Gpx1 specific siRNA (Cat. no. #MSS274652), Gpx4 specific siRNA (Cat. no. #MSS286702), Lrp1 specific siRNA (Cat. no. #NM008512.2), and negative control siRNAs were purchased from Invitrogen. siRNA transfection was performed for 48 hours, which was followed by the indicated intervention.
Measurement of DHE oxidation
ROS production in primary brown adipocytes was measured by the DHE oxidation method. In brief, primary brown adipocytes were plated and differentiated in clear bottom black wall 96-well plates. After completion of differentiation, the culture medium was aspirated, and the cells were washed with imaging buffer (156 mM NaCl, 3 mM KCl, 1.25 mM KH2PO4, 2 mM MgCl2, 10 mM HEPES, pH 7.4) two times. It was then replaced with fresh imaging buffer containing 1mM sodium pyruvate, 5 µM DHE (cat. no. #D23107, Invitrogen), and with or without 400 nM NA to detect NA-induced DHE oxidation. Fluorescence intensity was measured at ex355/em460 for reduced DHE and ex544/em590 for oxidized DHE using a fluorescence plate reader (Glomax-Multi + Detection System, Promega). Oxidative stress levels in each sample were described as oxidized/reduced DHE at 30 min after NA stimulation, which were normalized by their respective baseline values.
Measurement of mitochondrial ROS by MitoSOX assay
Measurement of mitochondrial specific superoxide levels was performed using MitoSOX red mitochondrial superoxide indicator (cat. no. #M36008, Invitrogen), as described by the manufacturer’s instruction. Briefly, completely differentiated primary brown adipocytes were pretreated with or without 10 µg/ml SeP for 24 hours. After that, the cells were washed with PBS 3 times, and the culture medium was changed with phenol red-free DMEM/F12 supplemented with 5 µM MitoSOX with or without 1000 nM NA. Fluorescence intensity was measured at ex510/em580 at baseline and 30 min after NA stimulation. The mitochondrial ROS levels in each sample were described after normalization with their respective baseline values.
Measurement of cellular temperature
NA-induced changes in intracellular temperature were measured in primary brown adipocytes by using Cellular Thermoprobe for Fluorescence Ratio (FDV-0005; Funakoshi, Tokyo, Japan). Primary brown adipocytes were cultured on glass-bottom dishes until fully confluent. The culture medium was then removed, and the cells were washed with a 5% glucose solution. 0.05% w/v of Cellular Thermoprobe in 5% glucose solution was then added to the cells, and the cultured dish was incubated at 25°C for 10 min. After washing with PBS three times, 100 µl of phenol red-free DMEM/F12 was added. For observation, excitation was carried out at 488 nm, and emission was monitored at 525 and 610 nm in a microscope cage incubation chamber at 37°C. Fluorescent ratio Em610/Em525 was used to evaluate temperature change. After recording baseline fluorescence intensity, the cells were stimulated with 400 nM NA (final concentration) or vehicle prepared in 100 µl of phenol red-free medium, followed by measurement of fluorescence intensity in a time-lapse manner. Fold changes in fluorescence intensity at each time point were calculated by normalization with baseline fluorescence intensity.
Glucose uptake in brown adipocytes
Glucose uptake into primary brown adipocytes was assessed by using Glucose Uptake Cell-Based assay Kit (Cayman Chemical) according to the manufacturer’s instruction. To describe in brief, after fully differentiation in 96 well plates, primary brown adipocytes were glucose and serum fasted in glucose-free DMEM (Gibco, Thermo Scientific) supplemented with 0.5% BSA for 6 hours. After that, cells were treated with glucose-free medium (with 0.5% BSA) containing 100 µg/ml 2-NBDG, 200 µM phloretin with or without 1000 nM NA for 5 minutes. At the end of the treatment, the plate was washed with ice-cold PBS 3 times to stop further glucose uptake into the cells. Then, 100 µl of Cell-Based Assay buffer was added to each well, and fluorescent intensity was measured at ex485/em535. Reading of the well treated with glucose-free medium without 2-NBDG treatment was regarded as blank.
Statistical analyses
All data were analyzed using the Statistical Package for Social Science (SPSS) Version 21 advanced model and GraphPad Prism 8 software. Experimental data were visualized as box plots with individual points by a web tool, BoxPlotR53. Statistical methods were not used to determine sample size, but the sample size was chosen based on trial experiments or experiments performed previously. We randomized neither animals nor cell samples and performed all the experiments with blinding of the investigator. All groups in the current experiments showed normal variance. Statistical differences between two groups were assessed using unpaired two-tailed Student t-tests, except paired t-tests were used for blood glucose changes before and after cold exposure (Fig. 1d and g). Data involving more than two groups were assessed by analysis of variance (ANOVA) with Tukey’s post hoc test. The AUC calculation and unpaired two-tailed Student t-tests were executed by GraphPad Prism 8 software (Fig. 2n, 3e, 3i, 4d, and 4f). By using the box-plot display tool in SPSS, we defined cases with values more than 3 times the interquartile range as outliers that were routinely excluded from all the analyses.