Cells and virus
The previously reported DEV CHv strain (Gen Bank No.JQ647509) was maintained in our lab[72-73] and slightly changes. Briefly, duck embryo fibroblasts (DEFs) were propagated in Minimal Essential Medium (MEM, Gibco-BRL, Grand Island, NY, USA) provided by our lab supplemented with 10% (v/v) foetal bovine serum (FBS, Gibco-BRL, Grand Island, NY, USA) and incubated at 37°C with 5% CO2.
Analysis of sequence motifs within UL13
Putative nuclear localization signals (NLSs) within the UL13 coding sequence were identified using PSORT II Prediction (http://psort.nibb.ac.jp/form2.html) [74]. Sequence analysis using PSORT II predicted that UL13 has two potential NLSs in its arginine-rich regions, namely, RRRR at aa 4 to 7 and PGKRKTK at aa 90 to 96 (Figure S1).
Construction of recombinant plasmids
The experimental operation was carried out as described previously [75-77]. Briefly, the full-length UL13 sequence was amplified from DEV chromosomal DNA using the primers F-UL13F and F-UL13R. UL13-△NLS1 was PCR amplified from DEV chromosomal DNA using the primers △NLS1F and F-UL13R. UL13-△NLS2 was amplified by overlapping PCR from DEV chromosomal DNA using the primers F-UL13F, △NLS2R, △NLS2F, and F-UL13R. UL13-△NLS1&△NLS2 was PCR amplified from pEGFP-N1-UL13-△NLS2 DNA using the primers △NLS1F and F-UL13R (Tables 1). The PCR fragments were purified and digested with EcoRI and HindIII and ligated into the pEGFP-N1 plasmid digested with the corresponding restriction endonucleases. The ligation mixtures were introduced into CaCl2-competent E. coli DH5α cells, and transformants were selected on LB plates containing 50 µg/ml Kan. Clones were screened by PCR with the corresponding primers. The validity of the sequences was determined by sequencing. The GFP, NLS1-GFP, NLS2-GFP and NLS1&NLS2-GFP genes were amplified by PCR from pEGFP-N1 DNA using the primers GFPF and GFPR; NLS1F and GFPR; NLS2F and GFPR; and NLS1&NLS2F and GFPR, respectively (Table 1). These PCR fragments were purified and digested with EcoRI and HindIII. Then, the purified fragments were ligated into the pcDNA3.1(+) plasmid digested with the corresponding restriction endonucleases. Ligation mixtures were introduced into the CaCl2-competent E. coli DH5α strain, and transformants were selected on LB plates containing Amp at 100 µg/ml. Clones were screened by PCR with the corresponding primers. Sequencing was used for confirmation.
Table 1. Oligonucleotide primers used in this work
Oligonucleotide primer
|
Sequencea (5’-3’)
|
T-UL13F
|
GGATCCCTGGTGGCTACGGAGAG
|
T-UL13R
|
AAGCTTCCAAGGGCGTATATGTC
|
F-UL13F
|
cccAAGCTTATGGCTGGACGAAGACG
|
F-UL13R
|
ccgGAATTCTGTTATAAATCCACAATAGAG
|
△NLS1F
|
cccAAGCTTATGGCTGGAAGCCCTATTAGCGAAATG
|
△NLS2R
|
CATCTACTATCCTTTCTCTCTTTACTG
|
△NLS2F
|
GAAAGGATAGTAGATGGAGCCTGG
|
GFPF
|
cccAAGCTTATGGTGAGCAAGGGCG
|
GFPR
|
ccgGAATTCTGATTATGATCTAGAGTCG
|
NLS1F
|
cccAAGCTTATGGCTGGACGAAGACGACGAAGCCCTATGGTGAGCAAGGGCG
|
NLS2F
|
cccAAGCTTATGAAGGATCCTGGCAAACGTAAGACAAAGAGTAGAATGGTGAG CAAGGGCG
|
NLS1&NLS2F
|
cccAAGCTTATGGCTGGACGAAGACGACGAATGAAGGATCCTGGCAAAC
|
aThe sequences of restriction endonuclease sites are in italics, and lowercase letters denote protective bases.
Immunofluorescence assay
The experimental operation was carried out as described previously and slightly change[78-82]. Briefly, DEF cells were fixed with 4% paraformaldehyde at 16h post-transfection, permeabilized with 0.1% Triton X-100 and blocked with bovine serum albumin (BSA) for 1h. The cells were incubated with the rabbit anti-UL13 antiserum (1:200 dilution) for 1h at 37℃ and then with a goat anti-rabbit antibody conjugated to fluorescein isothiocyanate at a dilution of 1:200 (FITC, Zhongshan, Beijing, China) for 30 min. The nuclei were stained with DAPI. The cells were observed using a Nikon ECLIPSE 80i microscope.
Extraction and analysis of cytoplasmic/nuclear proteins
The experimental operation was carried out as described previously [83]. Briefly, confluent monolayers of DEF cells were transfected with pEGFP-N1-UL13 or pEGFP-N1-UL13-△NLS1&△NLS2 plasmids (2.5μg/well) in 6-well plates for 16h and harvested after washing twice with PBS. The cells were pelleted by centrifugation at 3,000 rpm for 5 min and resuspended in 20 μl cytosol extraction buffer (10 µl 1 M HEPES (pH 7.5); 6 µl 100% Triton X-100; 50 µl 3 M NaCl; 2 µl 0.5 M EDTA; 50 µl 200µg/ml protease inhibitor; 882 µl ddH20) and incubated for 5 min on ice. The suspension was separated into nuclear and cytoplasmic fractions by 4,000 rpm for 5 min. The nuclear fraction was resuspended in 15 µl nuclear extraction buffer (20 µl 1 M HEPES (pH 7.5); 250 µl 100% glycerol; 140 µl 3 M NaCl; 12 µl 100 mM MgCl2; 4 µl 0.5 M EDTA; 5 µl 1 M DTT; 50 µl 200µg/ml protease inhibitor; 527.1 µl ddH20) and incubated for 30 min on ice, meanwhile, strongly mixed by vertexing six times for 30 s. The supernatant was collected by centrifugation for 30 min at 14,000 rpm at 4℃. The obtained cytoplasmic/nuclear proteins were subjected to western blotting according to the protocol described above. The anti-UL13 antibody, rabbit anti-β-actin antibody (APGBIOLtd, Shanghai, China) and rabbit anti-Lamin A/C antibody (Signalway Antibody, Maryland, USA) were used as primary antibody, separately. Protein bands were visualized by using ECL Western blotting detection reagents (Bio-Rad, California, USA) according to the manufacturer’s instructions.
Analysis of pharmaceutical inhibition of nucleus/cytoplasm transport
The experimental operation was carried out as described previously [84-85]. Briefly, DEFs were cultured in MEM supplemented with 10% (v/v) FBS at 37°C with 5% CO2. Lipofectamine 2000 was used according to the manufacturer’s instructions to transfect the pEGFP-N1-UL13 or pcDNA3.1(+)-NLS1&NLS2-GFP recombinant plasmid (2.5μg per well) into DEFs in 6-well cell culture plates. Where appropriate, cells were treated with ivermectin at a final concentration of 25 µM for 1 h before imaging [86-88]. Cells were imaged live at 16h after transfection using a Nikon ECLIPSE 80i microscope. To determine the nuclear/cytoplasmic fluorescence ratio, digitized images were analysed using the Image-Pro Plus software. Statistical analysis was performed using the GraphPad Prism 6.0 software.
Construction of Recombinant Viruses DEV CHv-UL13ΔNLS
To create the DEV CHv-UL13ΔNLS virus, with both NLS1 and NLS2 of UL13 deleted, we need to create the UL13 and UL14 gene-deleted recombinant mutant, DEV CHv-ΔUL13&UL14 virus first according to the overlapping of UL13 gene and UL14 gene regions. The target segment (UL13 left arm-FRT-Kan-FRT-UL14 right arm) was PCR-amplified using the ΔUL13&UL14 F F/R primers (Table 2). Then, the infectious clone DEV CHv-ΔUL13&UL14-G was generated by employing a recombinating system based on the genetic manipulation of the DEV CHv-G infectious clone[34-37]. Briefly, the pKD46 plasmid, which encodes the recombination genes exo, beta, and gam under the tight control of a ParaB promoter, was first introduced into E. coli DH10B containing the DEV CHv-G plasmid by electrophoretic transfer. In this system, the UL13&UL14 coding sequence was replaced by the target segments amplified from the pKD4 plasmid. Next, the pCP20 plasmid was transferred into the above cells, which contain DEV CHv-ΔUL13&UL14-G and kanamycin-resistant gene cassette. Removal of the kanamycin-resistant cassette was accomplished by incubation at 30◦C for 8 h then at 42◦C overnight. Then we generated the DEV CHv-UL13ΔNLS-G and the revertant, DEV CHv-UL13ΔNLS R-G based on the same method used above but with two different target segments. Target segment of DEV CHv-UL13ΔNLS-G, UL13ΔNLS-UL14-FRT-Kan-FRT-UL14 right arm, which was fusion PCR-amplified using the UL13-ΔNLS F1X/UL13-ΔNLS R1, UL13-ΔNLS F2/ΔUL13(K179M) R and FRT-Kan F/ R primers (Table 2) with the pEGFP-N1:: UL13-△NLS1&△NLS2 plasmids, the CHv genome and the pKD4 plasmid as template, respectively; target segment of DEV CHv-UL13ΔNLS R-G, UL13-UL14-FRT-Kan-FRT-UL14 right arm, using the UL13-ΔNLS F1/ΔUL13(K179M) R and FRT-Kan F/ R primers (Table 2) with the CHv genome and the pKD4 plasmid as template, respectively. The DEV CHv-UL13ΔNLS-G and DEV CHv-UL13ΔNLS R-G infectious clones, were identified by sequencing and RFLP analysis. Finally, the DEV CHv-UL13ΔNLS and DEV CHv-UL13ΔNLS R recombinant viruses were rescued; freshly prepared DEV CHv-UL13ΔNLS -G and DEV CHv-UL13ΔNLS R-G plasmids were transfected into DEFs for one to 10 d, and the cells were examined by fluorescence microscopy until green fluorescence protein seemed sufficiently expressed, at which point, they were harvested after freeze-thawing 3 times. After amplifying the DEV CHv-UL13ΔNLS and DEV CHv-UL13ΔNLS R viruses, viral PCR identification and sequencing of the target region were performed.
Table 2. Primers used for Red recombination to construct the CHv-BAC-UL13-Δ
NLS
Oligonucleotide primer
|
Sequence (5’-3’)
|
pKD46 F
|
AAAGCCGCAGAGCAGAAGGTGG
|
pKD46 R
|
GGTAAACGGGCATTTCAGTTCAAGG
|
ΔUL13&UL14 F
|
ATATGATTTGTTTTTTCCTACTCTATTGAATAGTGCGCACTCTCGCTAACGTGTAGGCTGGAGCTGCTTC
|
ΔUL13&UL14 R
|
ACGTTTGCAGTGATGTACTGGCGATGAGCTACCATCTATATCCCCACTCATGGTAGCATATGAATATCCTCCTTAG
|
UL13-ΔNLS F1
|
CTTCACATAATACGCCACTGATC
|
UL13-ΔNLS F1X
|
GGCGAAAGGCTGCAATACG
|
UL13-ΔNLS R1
|
CCGATAGGATTCATTTCGCTAATAGGGCTTCCAGCCATTCGTTACCAGATAGTC
|
UL13-ΔNLS F2
|
GACTATCTGGTAACGAATGGCTGGAAGCCCTATTAGCGAAATG AATCCTATCGG
|
ΔUL13(K179M) R
|
TTAGTTATAAATCCACAATAGAG
|
FRT-Kan F
|
AGAAGCGCCGCTCCTCTATTGTGGATTTATAACTAAGTGTAGGCTGGAGCTGCTTC
|
FRT-Kan R
|
ACGTTTGCAGTGATGTACTGGCGATGAGCTACCATCTATATCCCCACTCATGGTAGCATATGAATATCCTCCTTAG
|
Plaque Assay
The experimental operation was carried out as described previously [89-90]. Briefly, DEFs were incubated with DEV CHv, DEV CHv-UL13ΔNLS, or DEV CHv-UL13ΔNLS R at 37◦C for 2 hours. The plates were then overlaid with an equal-parts mixture of 2 × MEM and 0.5% methylcellulose (9004-67-5, J & K SCIENTIFIC LTD., Beijing, China) after discarding unabsorbed particles. After incubation at 37◦C for 6 d, the cells were fixed with 4% paraformaldehyde and stained with 0.05% crystal violet (C3886, Haoran Bio, Beijing, China). Plaque areas were then measured by Image Pro Plus software, with 50 plaques chosen at random for each virus.
Growth Curve Assay
The experimental operation was carried out as described previously and slightly changes [91]. Briefly, duck embryo fibroblasts cells were infected with DEV CHv, DEV CHv-UL13ΔNLS, or DEV CHv-UL13ΔNLS R at 200 TCID50. The cells were maintained in MEM supplemented with 2% FBS, and samples of the cells and supernatants were separately harvested at 6, 12, 24, 48, 72, and 96 h for the growth curve assay after being freeze-thawed 3 times. The growth curve was recorded via measuring the TCID50,which was calculated with the Reed Muench method, andthe samples at different time points and triplicate experiments were performed.