Genetic manipulation in the mouse olfactory circuit reveals an intrinsic role of the circadian clock in the piriform cortex for daily changes in odor-evoked neural activity

doi:10.21203/rs.3.rs-1563083/v1

PDF

Article

Genetic manipulation in the mouse olfactory circuit reveals an intrinsic role of the circadian clock in the piriform cortex for daily changes in odor-evoked neural activity

https://doi.org/10.21203/rs.3.rs-1563083/v1

This work is licensed under a CC BY 4.0 License

Version 1

posted 11 May, 2022

You are reading this latest preprint version

In mammals, the suprachiasmatic nucleus (SCN) of the hypothalamus is generally thought to be the master circadian clock orchestrating the internal clock of the entire body. On the other hand, olfactory behavior and odor-evoked activity in the piriform cortex (PC) retain circadian rhythmicity in the absence of the SCN. How the circadian rhythm in the PC is achieved independently of the SCN, however, remains elusive. Here, to define neurons regulating the circadian rhythm of the odor-evoked activity in the PC, we knocked out the clock gene Bmal1 in a host of specific neurons along the olfactory circuit. We discovered that Bmal1 knockout (KO) in the PC largely abolishes the circadian rhythm of the odor-evoked activity. We further show that isolated PC exhibited sustained circadian rhythms of the clock gene Per2 expression. Quantitative PCR analysis revealed that expression patterns of multiple genes involved in neural activity and synaptic transmission exhibited circadian rhythm in the PC in a BMAL1-dependent manner. Our findings indicate that BMAL1 acts intrinsically in the PC to control the circadian rhythm of the odor-evoked activity in the PC, possibly through regulating expression patterns of multiple genes involved in neural activity and transmission.

Many organisms exhibit circadian rhythms in their biological processes. Recent studies showed that many neural processes exhibit circadian rhythms, including memory & learning, emotional response, and sensory activity such as audition and olfaction ^1–4. These circadian rhythms of neural activities are typically generated and maintained through a series of transcription factors called clock genes. The transcription/translation levels of these clock genes oscillate in a 24-hour manner, via negative transcription-translation feedback loop regulation ^5–7. Importantly, knocking out the core clock genes such as Bmal1 and Period1/2 (Per1/2) largely abolishes the circadian rhythms of neural activities ^8,9, underscoring their crucial roles in the circadian rhythms of neural activities.

In mammals, the suprachiasmatic nucleus (SCN) of the hypothalamus is widely believed to be the master circadian oscillator orchestrating the clock of the entire body ^10–12. Consistently, the core clock genes are abundantly expressed in the SCN ^13,14. On the other hand, a growing body of evidence suggests that the core clock genes are widely expressed in virtually all cells of the entire body, and that certain neural activities show circadian rhythms independent of the SCN ^15,16. One such example is the olfactory circuit. There, odor information is initially detected by the olfactory sensory neurons (OSNs) in the olfactory epithelium, which is relayed to the mitral/tufted cells in the olfactory bulb, and eventually processed in the pyramidal neurons of the piriform cortex (PC) ^17,18. Strikingly, the odor-evoked activity in the PC shows a circadian rhythm with the highest response at night ¹, which is paralleled by the olfactory discrimination accuracy ^19,20. Interestingly, surgical removal of the SCN spares circadian rhythmicity of the odor-evoked activity in the PC, although the oscillation phase tends to be affected ¹. These data suggest that the circadian rhythmicity of the odor-evoked activity in the PC is generated by circadian oscillators outside of the SCN. Indeed, surgical removal of the olfactory bulb in mice partially disturbs the circadian rhythm of the odor-evoked activity in the PC ¹. However, what neural population in the olfactory circuit contributes to the circadian rhythm of the odor-evoked activity in the PC remains elusive.

In this study, by combining multiple Cre recombinase-expressing mice and adeno-associated virus (AAV) transfection, we knocked out the clock gene Bmal1 in specific sets of neurons in the olfactory circuit. We show that BMAL1 in the PC is required for the circadian rhythm of the odor-evoked activity. Furthermore, the isolated PC ex vivo maintained the circadian oscillation of Per2 expression, another core clock gene. Interestingly, we found that expression levels of multiple genes related to neural activity and synaptic transmission exhibit circadian rhythms in the PC in a BMAL1-dependent manner. These findings suggest that the intrinsic molecular clock in the PC is critical for the circadian rhythm of the odor-evoked neural activity, and hint at the possibility that the intrinsic clock might exert such function through transcriptional regulation of the molecules related to neural activity and synaptic transmission.

Odor-evoked neural activity in the PC exhibits a circadian rhythm

To investigate the circadian rhythm of the odor-evoked activity in the mouse brain, we presented cedar oil to the mouse as described previously ¹, then quantified the number of c-Fos positive cells ²¹ in the PC for six timepoints throughout the day (Fig. 1a). Consistent with previous studies ^1,22, by comparing the number of c-Fos positive cells among six timepoints, we observed a peak at the subjective night CT16 (Fig. 1b, Supplemental Fig. 1a; N ≥ 3 for each timepoint, p = 0.001185, One-way ANOVA). Of note, the number of c-Fos positive cells showed no obvious correlation with other external conditions such as humidity and temperature (Supplementary Fig. 1b; R² < 0.07, R² < 0.01, respectively, Pearson’s correlation coefficient), suggesting that the circadian rhythm observed is unrelated to external stimuli, but rather regulated through an internal mechanism. Additionally, mice exposed to another neutral odorant limonene(-) showed a significantly higher number of c-Fos positive cells in the PC at CT16 compared to CT4 (Supplemental Fig. 1c; N = 4, p = 0.02857, Wilcoxon rank-sum test), comparable to the response to cedar oil. Thus, the circadian rhythm of the odor-evoked activity in the PC is not specific to cedar oil.

We next assessed whether odor-evoked neural activity might specifically fluctuate in the PC. To this end, we collected brain samples from subjective day CT4 and subjective night CT16 and quantified the number of c-Fos positive cells in serial sections spanning the whole brain. We found that the total number of c-Fos positive cells was significantly higher at CT16 compared to CT4 (Fig. 1c, d; N = 4 each, p = 0.013, Wilcoxon rank-sum test). We further quantified the number of c-Fos positive cells in each sensory cortex by mapping the c-Fos positive cells onto a reference mouse brain of the Allen Brain institute three-dimensionally ²³. As a result, while the PC showed a significantly higher number of c-Fos positive cells at CT16 (Fig. 1e; N = 4 each, p = 0.013, Wilcoxon rank-sum test), we found no significant difference between CT4 and CT16 in the primary visual cortex (V1), primary auditory cortex (A1) and gustatory cortex (Fig. 1E; N = 4 each, Wilcoxon rank-sum test). The circadian fluctuation of neural activity is thus most obvious in the PC among sensory cortices.

Circadian rhythmicity of the odor-evoked activity in the PC are intrinsically maintained independently of the SCN

Circadian rhythms of neural activities are widely thought to be generated by the SCN ^10–12 and the clock genes such as Bmal1 ^8,9. While a previous report has suggested that the circadian rhythm of the odor-evoked activity in the PC operates independent of the SCN ¹, this report solely relied on surgical removal of the SCN, which could be confounded by inevitable damages to other brain structures. We thus sought to test whether BMAL1 expression in the SCN contributes to the circadian rhythm of the odor-evoked activity in the PC with less invasive methodologies. To this end, we took advantage of the fact that the SCN is mostly comprised of GABAergic neurons, and that GABAergic neurons are required for the circadian rhythm of SCN activity ²⁴. Specifically, we conditionally knocked out the clock gene Bmal1 in GABAergic neurons by crossing Vgat-Cre mice ²⁵ against Bmal1-floxed mice in which loxP sequences are inserted in the coding region of the Bmal1 gene ²⁶. As expected, the number of BMAL1-positive cells in the SCN was significantly reduced in these conditional KO mice (“Vgat-Bmal1 KO mice”) compared to control mice (Fig. 2a; 95.8 ± 4.09% and 11.8 ± 0.60% for Bmal1-control and Vgat-Bmal1 KO, respectively, mean ± standard deviation). While control mice showed a clear circadian rhythm in locomotor activity both under the LD condition (light condition is indicated by yellow-shaded area) and the following DD condition (Fig. 2b, left), Vgat-Bmal1 KO mice failed to show a circadian rhythm under the DD condition (Fig. 2b, right), suggesting that the SCN's function in circadian rhythm was effectively disrupted in Vgat-Bmal1 KO mice. By contrast, the number of c-Fos positive cells in the PC following cedar oil presentation retained circadian rhythmicity (Fig. 2c, N ≥ 2 for each timepoint, p = 0.03224, One-way ANOVA), suggesting that BMAL1 expression in GABAergic SCN neurons is dispensable for the circadian rhythmicity of the odor-evoked activity in the PC at a statistically significant level. We note that the number of c-Fos positive cells peaked at CT4 in Vgat-Bmal1 KO mice while this number peaked at CT16 in control mice (Fig. 1d), consistent with a previous study in which SCN was surgically removed ¹. This suggests that BMAL1 in GABAergic SCN neurons might contribute not to the rhythmicity, but to the phase control of the circadian rhythm of the odor-evoked activity in the PC.

Bmal1 KO in neurons containing GCs and PC partially disrupts the circadian rhythm of the odor-evoked activity in the PC

Since we failed to detect the contribution of BMAL1 in the SCN to the circadian rhythmicity of the odor-evoked activity of the PC, we next asked whether BMAL1 functions inside the olfactory circuit. To this end, against Bmal1-floxed mice, we crossed multiple transgenic mice expressing Cre recombinase known to label specific neuronal populations along the olfactory circuit. These Cre-lines are Omp-Cre mice ²⁷, Pcdh21-CreER mice ²⁸, and Emx1-Cre mice ²⁹. To check precisely where and how efficiently Bmal1 was knocked out in these conditional KO mice (“Omp-Bmal1 KO mice”, “Pcdh21-Bmal1 KO mice”, “Emx1-Bmal1 KO mice”), we first conducted immunohistochemical analyses in the olfactory circuit including mitral/tufted cells, granule cells of the olfactory bulb, and the PC. In the mitral/tufted cell layer, we analyzed the ratio of BMAL1-positive cells against Tbx21-positive mitral/tufted cells and found that 97.6% of Tbx21-positive cells were BMAL1-positive in Bmal1-control mice while this ratio dropped to 64.9 ± 2.2 % and 7.02 ± 5.5 % in Pcdh21-Bmal1 KO mice and Emx1-Bmal1 KO mice, respectively (Fig. 3a). In the granule cell layer of the olfactory bulb, we analyzed the ratio of BMAL1-positive cells in five different depths since different granule cell types likely reside in the different depths ^30,31. As a result, while more than 0 % of Nissl-positive neurons was BMAL1-positive in Bmal1-control mice and Pcdh21-Bmal1 KO mice, this ratio was reduced in all depths of the Emx1-Bmal1 KO mice (53.5 ± 13.6, 64.1 ± 5.53, 73.9 ± 6.52, 84.6 ± 8.55, 82.1± 6.72 %, respectively; mean ± standard deviation) (Fig. 3b). In the PC, while the ratio of BMAL1-positive cells was 986 ± 0.69 % in Bmal1-control mice, this ratio was reduced to 9.2 ± 3.78 % and 5.3 ± 5.40 % in Pcdh21-Bmal1 KO mice and Emx1-Bmal1 KO mice, respectively (Fig. 3c). Thus, by utilizing the three Cre-lines, we successfully managed to knock out Bmal1 in different neuronal subsets of the olfactory circuit (Fig. 3d).

We next presented cedar oil to these mice and quantified the number of c-Fos positive cells in the PC. First, in the control group where Cre recombinase is not expressed (Bmal1-control mice), the number of c-Fos positive cells in the PC was significantly higher at CT16 compared to CT4 (Fig. 3e; N ≥ 11, p = 0.005072, Wilcoxon rank-sum test with Bonferroni correction). Similarly, the number of c-Fos positive cells in the PC was significantly higher at CT16 compared to CT4 both in Omp-Bmal1 KO mice and in Pcdh21-Bmal1 KO mice (Fig. 3e; N ≥ 9, p = 0.006549, Wilcoxon rank-sum test with Bonferroni correction; N ≥ 8, p = 0.02052, Wilcoxon rank-sum test with Bonferroni correction). By contrast, we observed no significant difference in the number of c-Fos positive cells in the PC between CT4 and CT16 in Emx1-Bmal1 KO mice (Fig. 3e; N = 9, p = 0.1615, Wilcoxon rank-sum test with Bonferroni correction). Further, Pcdh21-Bmal1 KO mice and Emx1-Bmal1 KO mice both showed rhythmic circadian locomotor activity in a constant dark condition (Supplemental Fig. 2), suggesting that the SCN-dependent circadian regulation was maintained in both KO mice. Since Bmal1 is knocked out in the mitral/tufted cells, granule cells, and the PC in Emx1-Bmal KO mice, and since Pcdh21-Bmal1 KO mice in which Bmal1 is knocked out in the mitral/tufted cells retained circadian rhythm of the odor-evoked activity in the PC, our data suggest that BMAL1 in the granule cells and/or the PC is required for the circadian rhythm of the odor-evoked activity in the PC.

AAV-mediated PC-specific Bmal1 KO abolishes the circadian rhythm of the odor-evoked activity in the PC

To further define the neural population required for the circadian rhythm of the odor-evoked activity in the PC, we limited Bmal1 KO to a specific population of the olfactory circuit by expressing Cre recombinase via adeno-associated virus (AAV) injection. Specifically, we generated AAV where Cre recombinase and red fluorescent protein mCherry are simultaneously expressed downstream of the CaMKIIα promoter. CaMKIIα is known to be expressed both in the granule cells of the olfactory bulb and in the pyramidal neurons of the PC ³²⁻³⁴. When we injected this AAV to the granule cell layers of the olfactory bulb (Fig. 4a), mCherry expression was especially strong in the deeper layers of the granule cell, and correspondingly BMAL1 expression was especially weak in deeper layers (Fig. 4b, c; N ≥ 4, 92.5 ± .81 %, 96.8 ±2.80 %, 69.3 15.8 %, 17.1± 6.82 %, 36. ± 8.85 %, respectively, mean ± standard deviation; Supplemental Fig. 3a, b). We validated that mCherry is not expressed in cells outside of the granule cell layers, i.e. mitral/tufted cells (Supplemental Fig. 3a). When we injected the AAV to the PC, 55. ± 6.14 % of Nissl-positive cells expressed mCherry (Supplemental Fig. 3c, d), and only 13. ± 8.59 % of Nissl-positive cells expressed BMAL1 (Fig. 4e, f; N ≥ 4).

We next presented cedar oil to these mice and quantified the number of c-Fos positive cells in the PC. In mice where Bmal1 was conditionally knocked out in granule cells (“GC-Bmal1 KO mice”), the number of c-Fos positive cells was significantly higher at CT16 compared to CT4 (Fig. 4g; N = 7 for each timepoint, p = 0.02394, Wilcoxon rank-sum test). On the other hand, in mice where Bmal1 was knocked out in the PC (“PC-Bmal1 KO mice”), there was no significant difference in the number of c-Fos positive cells in the PC across four timepoints (Fig. 4h; N ≥ 2 for each timepoint, p = 0.9596, One-way ANOVA), suggesting that the circadian rhythm of the odor-evoked activity in the PC was abolished in these mice. PC-Bmal1 KO mice showed rhythmic locomotor activity in a constant dark condition (Supplementary Fig. 3e), suggesting that the molecular clock in the SCN is functionally intact in PC-Bmal1 KO mice. These results indicate that BMAL1 expression in the CaMKIIα-positive pyramidal neurons of the PC is required for the circadian rhythm of the odor-evoked activity in the PC.

The PC can autonomously maintain the circadian rhythm of clock gene expression

Our data so far suggest that BMAL1 expression in the CaMKIIα-positive pyramidal neurons of the PC is responsible for the circadian rhythm of the odor-evoked activity in the PC. We reasoned that, if this is the case, the PC may be capable of self-sustaining the circadian rhythm of its clock gene expression. To test this possibility, we next conducted an ex vivo measurement of the circadian rhythm of the intrinsic clock using isolated tissues from PER2::LUC knock-in mice ³⁵, in which the firefly luciferase cDNA is inserted immediately downstream of the Per2 gene. In brief, we generated acute slice sections of the PC and measured the luminescence level for up to one week in a luciferin-containing medium (Fig. 5a). As a positive control, we first confirmed that the SCN showed a sustained circadian rhythm of luminescence (Fig. 5b; N = 4; 24.4 ± 1.10 hours; Lomb-Scargle Periodogram) as reported previously ³⁵. Importantly, we observed sustained circadian rhythm in the PC with a period of 24.45 ± 2.58 hours (Fig. 5b; N = 5, Lomb-Scargle Periodogram). There was no significant difference in the observed period between the SCN and the PC (Fig. 5c). These data indicate that the PC can intrinsically maintain the circadian rhythm of the clock gene expression in the absence of other brain regions.

Genes Related to Neural Activity Show Circadian Rhythms in the PC

Given that clock genes including Bmal1 and Per2 encode transcriptional regulators, the molecular clock in the PC is likely to regulate neural activity in a circadian manner through downstream gene expression. A previous study ³⁶ identified a set of genes acting downstream of the clock genes in the SCN, and we reasoned that at least some of these genes are likely to operate similarly in the PC. We thus extracted nine candidates from this set of genes deemed related to neural function through our gene ontology analyses (Fig. 6a). We then measured the mRNA levels of these nine genes in the PC at six timepoints throughout the day. We found that seven out of nine genes – Avpr1a, Cacna2d3, Chrnb2, Clcn4, Gad1, Snap25, and SynI – showed circadian rhythms of expression levels, and all seven peaked at CT8 (Fig. 6b; N ≥ 3 for each timepoint, p = 0.02643, 4.66e-4, 0.03215, 0.04002, 0.008654, 0.005348, 0.007951, respectively; one-way ANOVA). Next, we investigated whether the mRNA levels of these seven genes are regulated through BMAL1 transcription regulation. To this end, we collected the PC from Emx1-Bmal1 KO mice and quantified the mRNA levels of these genes. First, we confirmed that the mRNA levels of Bmal1 were significantly suppressed compared to wild-type mice (Supplemental Fig. 4a; N ≥ 3 for each timepoint and genotype, two-way ANOVA with genotype and timepoints as explanatory variables, p = 1.01e-9 for genotype). Importantly, we failed to detect circadian rhythms in the seven genes that showed circadian rhythm in the wild-type mice (Fig. 6c; N ≥ 3 for each timepoint, one-way ANOVA), suggesting that the expression of these genes is transcriptionally regulated through BMAL1 in the PC. Taken together, our data suggest that BMAL1 in the PC regulates the expression patterns of multiple target genes related to neural function in a circadian manner, which could contribute to intrinsic control of the odor-evoked neural activity of the PC.

In this study, we focused on the mouse olfactory system and showed for the first time that BMAL1 in the pyramidal neurons of the PC intrinsically regulates the circadian rhythm of the odor-evoked neural activity. This notion is supported by the following lines of evidence. Firstly, the circadian rhythm of the odor-evoked neural activity was maintained in Vgat-Bmal1 KO mice in which BMAL1 expression was largely diminished in GABAergic neurons including over 90% of SCN neurons (Fig. 2), suggesting that the clock genes in GABAergic neurons in the SCN are dispensable for the odor-evoked neural activity in the PC. Secondly, Bmal1 KO exclusively in the CaMKIIα-positive pyramidal neurons in the PC largely abolished the circadian rhythm of the odor-evoked neural activity in the PC (Fig. 3, 4). Lastly, isolated brain slices of the PC maintained the circadian rhythm of Per2 expression at least for 3 days (Fig. 5), suggesting an intrinsic control of the clock gene expressions in the PC.

The present study showed an indispensable role of BMAL1 expression in the PC for the circadian rhythm of the odor-evoked activity in the PC. However, we could not clearly test the role of BMAL1 expression in the olfactory bulb because Pcdh21-Bmal1 KO removed BMAL1 from only ~ 30% of mitral/tufted cells (Fig. 3). Notably, a previous report suggested that the olfactory bulb functions as an independent circadian system regulating circadian rhythms of the odor-evoked neural activity, as surgical removal of the olfactory bulb abolished the circadian rhythms of the odor-evoked response in the PC ¹. Since the PC receives the vast majority of afferent fibers from the olfactory bulb ^37,38, it would be important in the future to understand how the olfactory bulb and the PC interact with each other to shape the circadian rhythms of the odor-evoked activity in the PC.

The present study identified seven genes whose mRNA expressions showed circadian rhythms under the control of BMAL1 (Fig. 6). Of the seven genes identified, Avpr1a encodes a G-protein coupled arginine vasopressin receptor, and it increases intracellular Ca²⁺ levels to activate ERK/CREB ³⁹. Chrnb2 encodes a subunit of a nicotinic acetylcholine receptor that promotes cation influx to depolarize the membrane potential ⁴⁰. Clcn4 encodes a voltage-gated chloride channel. Hence the circadian rhythms of expressions of these genes may directly shape the circadian rhythm of the odor-evoked activity in the PC. Unexpectedly, other genes are associated with presynaptic, rather than postsynaptic, functions. Cacna2d3 encodes a subunit of the voltage-gated calcium channel Ca_v2.2 ⁴¹ which functions at presynaptic terminals ^42–44. Ca_v2.2 channels are known to interact with the active zone proteins including SNAP25 ^45–48. SynI encodes Synapsin I which contributes to the size control of the synaptic vesicle pool within the presynapses ⁴⁹. One possible scenario, therefore, is that BMAL1 in the PC regulates the expression of Ca_v2.2, SNAP25, and Synapsin I to regulate the circadian rhythm of the odor-evoked output from the PC.

Overall, we show in our current analyses that the molecular clockwork in the pyramidal neurons of the PC intrinsically regulates the circadian rhythm of the odor-evoked neural activity. We further show candidate genes that might contribute to the circadian rhythm of the odor-evoked neural activity under the control of the molecular clock. Since the molecular clock appears to target distinct genes in different tissues ^50,51, it is highly possible that additional genes might be transcriptionally regulated by BMAL1 and contribute to the circadian rhythms of the olfactory response in the PC. It will be thus important to understand the comprehensive sets of BMAL1-targeting genes in the PC and how the gene products could contribute to the intrinsic control of the circadian rhythm of neural activity.

Animals

All animal experiments had received approval from the Animal Care Committee at the University of Tokyo.

C57BL/6J wild-type mice were purchased from Japan SLC, Inc. Bmal1-floxed mice, Emx1-Cre mice, Vgat-Cre mice, and PER2::LUC mice were provided as a kind gift from Dr. Fukada, Omp-Cre mice, Pcdh21-CreER mice, and tdTomato-flox(Ai9) mice were purchased from The Jackson Laboratory.

Animals were group-housed, up to four animals per cage, in a temperature (23 ± 1˚C) and humidity (50 ± 20 %) controlled environment, in a 12h light, 12h dark cycle with ad libitum access to food and water, light on at 7:00 AM.

Odor Presentation Paradigm

Adult male mice (2-3 months of age) were isolated to a new cage (Japan CLEA, CL-0113-1) one week prior to odor presentation with ad libitum access to food and water. Two days prior to odor presentation, mice were transferred to a new cage and underwent a constant dark condition for more than 24 hours. On the day of the experiment, 100 µL of odorant (cedar oil, limonene(-)) was applied to a cotton swab and placed on the cage lid for 5 minutes. 50 minutes after odor presentation, mice were perfused for further histological experiments.

Immunohistochemistry

Mice were anesthetized with Isoflurane (Pfizer), then transcardially perfused with ice-cold 10 mL 0.1M phosphate buffer (pH7.4), followed by ice-cold 25 mL fixative (4 % paraformaldehyde in 0.1M phosphate buffer). Whole brains were dissected, immersed in ice-cold fixative for 6 hours. Next, brains were immersed in 0.1M PBS (pH 7.4) containing 20 % sucrose for 6 hours, then transferred to 0.1M PBS (pH 7.4) containing 30 % sucrose for 6 hours. Forty µm-thick coronal sections were cut with a sliding microtome (Yamato Kohki). Cut sections were stored in an Anti-freezing buffer (25 % glycerol (Nakalai Tesque), 30 % ethylene glycol (Nakalai Tesque), 0.1M PBS) at -30˚C.

Brain sections were incubated in blocking buffer (3 % Normal Donkey Serum (Jackson Immuno Research Laboratories), 0.05 % TritonX-100, PBS) for 2 hours at room temperature. Next, sections were incubated in primary antibody (Anti-c-Fos Rabbit pAb, Calbiochem, 1:20,000 dilution in blocking buffer; Anti-BMAL1 Rabbit Polyclonal, Novus Biologicals, 1:1,000 dilution in blocking buffer; Anti-Tbr1 Rabbit Polyclonal, Abcam, 1:1,000 dilution in blocking buffer; anti-Tbx21 guinea pig, a gift from Y Yoshihara, 1:10,000 dilution in blocking buffer) for 3 days at 4˚C. After primary antibody incubation, sections were washed with PBST for 10 minutes, 5 times at room temperature. Next, sections were incubated with a second antibody (Alexa 488-conjugated donkey anti-rabbit, Invitrogen, 1:500 in blocking buffer). Afterward, sections were washed with PBST for 10 minutes, 5 times at room temperature. Finally, for nuclear staining, sections were incubated with Nissl (Invitrogen, 1:200 in PBS) or DAPI (Sigma Aldrich, 1:2,000 in PBS) for 1hour at room temperature. Sections were mounted with Prolong Diamond (Thermo Fisher Scientific) antifade.

Microscopy and cell counting

For whole-brain 3D Mapping, brain sections were imaged by KEYENCE.

For other imaging, brain slices were imaged by confocal microscopy (Leica, SP8).

Brain sections immunostained with c-Fos antibody were quantified with the following procedures using ImageJ. First, the background signal intensity was calculated by averaging ten areas of the brain section without any cells. The background intensity was subtracted and despeckled. The signal threshold was set to 40, and the signals larger than 30µm were counted as c-Fos positive cells. For other imaging, brain slices were imaged by confocal microscopy (Leica, SP8)

Locomotor Activity Analysis

Mice were housed individually, and their spontaneous locomotor activities were recorded using an area sensor (Elekit) with an infrared detector. Locomotor activity was collected every minute and analyzed by ClockLab software (Actimetrics).

Adeno-Associated Virus Production

AAV293 cells were cultured in 10cm culture dish (1.25~1.5 x 10⁶ cells/dish) with 10 mL culture medium (DMEM (Sigma-Aldrich, D5796-500ML), 10 % FBS (GE Life Sciences, HyClone SH30396.03), Penicillin Streptomycin (gibco, 15140-122), GlutaMax (gibco, 35050-061)). After 2~3 days, cells were passaged into T-150 flasks (2.5~3.0 x 10⁶ cells/flask) with 35 mL of culture medium. After 48~72 hours, when cells reached 60~70 % confluency, 25 mL of culture medium was removed, and 9mL of fresh culture medium was added. Subsequently, plasmids were transfected via calcium phosphate co-precipitation. Briefly, three plasmids – pAAV-DJ, pHelper, plasmid including genes of interest – were added to 6 mL of 0.3 M CaCl₂. Next, 6 mL of 2x HBS (280 mM NaCl, 1.5 mM Na₂HPO₄, 50 mM Hepes) was added with thorough mixing. 3 mL of the mixed compound was applied to each flask and further cultured for 6~12 hours. Next, the culture medium was replaced with 35 mL of medium containing trichostatin A (DMEM, 2 % FBS, Penicillin, Glutamax, 100 nM trichostatin A (Wako)), and further cultured for 48~96 hours. Subsequently, the medium containing scraped cells was collected and underwent freeze-thaw three times. Finally, 1/10,000 volume of 250 U/µL TurboNuclease (Accelagen) was added and incubated for 30 minutes at 37 ˚C. The AAVs were purified with ViraPur Kit (Virapur).

Adeno-Associated Virus Injection

Mice 6-8 weeks of age were stereotaxically injected. Animals were anesthetized with isoflurane (1-2 %) and placed in a stereotaxic frame. The adeno-associated virus AAVDJ-CaMKII-iCre-T2A-mCherry (3.55~7.87 x 10¹¹ vg/mL) was injected to the olfactory bulb or the PC bilaterally using a pulled glass capillary (Drummond) by nanoliter pressure injection (Nanoject 3, Drummond)⁵². Stereotactic injection coordinates to target the olfactory bulb or PC were obtained from the Paxinos and Franklin atlas (for olfactory bulb AP:4.2mm ML:1.0mm DV:1.0mm from brain surface; for PC AP:1.8,0.5,-0.5mm ML:2.7,3.5,3.9 mm, DV:3.8,3.8,4.2 mm from brain surface). Animals were allowed to recover for at least four weeks before being used in experiments.

In silico data analysis

From the list of genes reported to show circadian fluctuations of mRNA levels in the SCN ³⁶, we manually searched the function of each gene via UniProt (https://www.uniprot.org/) and identified genes that were documented to be involved in neuronal processes.

Real-time quantitative PCR

For RNA extraction, 8-10 weeks-old mice underwent a constant dark condition for 24-48 hours. Brains were dissected, washed with HBSS, and immediately frozen with liquid nitrogen. RNA was extracted with RNeasy kit (Promega), and the cDNA library was created by first-strand reverse transcription with ReverTraAce Kit (Toyobo). For real-time quantitative PCR, cDNA samples were mixed with THUNDERBIRD SYBR qPCR Mix (Toyobo) and primers and underwent two-step PCR (95˚C 15 seconds → 60˚C 60 seconds, 40 cycles).

Primer sequences for real-time quantitative PCR were as follows:

Gene name	Forward primer (5’-3’)	Reverse primer (5’-3’)
Rps29	TGAAGGCAAGATGGGTCAC	GCACATGTTCAGCCCGTATT
Dbp	AATGACCTTTGAACCTGATCCCGCT	GCTCCAGTACTTCTCATCCTTCTGT
Bmal1	GCAGTGCCACTGACTACCAAGA	TCCTGGACATTGCATTGCAT
Rev-erba	CGTTCGCATCAATCGCAACC	GATGTGGAGTAGGTGAGGTC
Avpr1a	GCAGCGTGAAGAGCATTTCC	TCGGAATCGGTCCAAACGAAA
Clcn4	GCATTTAGAAGCACCACGCC	GGCAAGTGTTCAGCGTCATC
Chrnb2	TCCACTTGTGTTCCCTAGAAGA	GAGCCTCGCTGACACAAG
Snap25	TGGCTGATGAGTCCCTGGAA	CCATCCCTTCCTCAATGCGT
Gad1	AGGGATCGTGCAAGCAAGGAA	GTGGTCTTGGGGTCTCTACGG
Cacna2d3	CCATCCTGAGGAGAATGCAAGA	TCGCACCATAGTTGGGTTCA
Sst	CTGCGACTAGACTGACCCAC	CCAGTTCCTGTTTCCCGGTG
Syn1	ATCCCTGTCTCTGACCAATGC	TGTCAGTCGGAGAAGAGGCT
Calb2	TGATGCTGACGGAAATGGGT	TCCGCCATCTCAATTTTCCCA

COMPETING INTERESTS

The authors declare no competing interests.

DATA AVAILABILITY

All data is available from the corresponding author on reasonable request.

Granados-Fuentes, D., Tseng, A., Herzog, E.D.: A Circadian Clock in the Olfactory Bulb Controls Olfactory Responsivity. J. Neurosci. 26, 12219–12225 (2006)
Nakano, J.J., Shimizu, K., Shimba, S., Fukada, Y.: SCOP/PHLPP1β in the basolateral amygdala regulates circadian expression of mouse anxiety-like behavior. Sci. Rep. 6, 33500 (2016)
Park, J., et al.: Identification of a Circadian Clock in the Inferior Colliculus and Its Dysregulation by Noise Exposure. J. Neurosci. 36, 5509–5519 (2016)
Shimizu, K., et al.: SCOP/PHLPP1β mediates circadian regulation of long-term recognition memory. Nat. Commun. 7, 12926 (2016)
Honma, S.: The mammalian circadian system: a hierarchical multi-oscillator structure for generating circadian rhythm. J. Physiol. Sci. 68, 207–219 (2018)
Ko, C.H., Takahashi, J.S.: Molecular components of the mammalian circadian clock. Hum. Mol. Genet. 15, R271–R277 (2006)
Takahashi, J.S.: Transcriptional architecture of the mammalian circadian clock. Nat. Rev. Genet. 18, 164–179 (2017)
Bunger, M.K., et al.: Mop3 Is an Essential Component of the Master Circadian Pacemaker in Mammals. Cell 103, 1009–1017 (2000)
Zheng, B., et al.: Nonredundant Roles of the mPer1 and mPer2 Genes in the Mammalian Circadian Clock. Cell 105, 683–694 (2001)
Abe, M., et al.: Circadian Rhythms in Isolated Brain Regions. J. Neurosci. 22, 350–356 (2002)
Dibner, C., Schibler, U., Albrecht, U.: The Mammalian Circadian Timing System: Organization and Coordination of Central and Peripheral Clocks. Annu. Rev. Physiol. 72, 517–549 (2010)
Reppert, S.M., Weaver, D.R.: Coordination of circadian timing in mammals. Nature 418, 935–941 (2002)
Hastings, M.H., Maywood, E.S., Brancaccio, M.: Generation of circadian rhythms in the suprachiasmatic nucleus. Nat. Rev. Neurosci. 19, 453–469 (2018)
Reppert, S.M., Weaver, D.R.: Molecular Analysis of Mammalian Circadian Rhythms. Annu. Rev. Physiol. 63, 647–676 (2001)
Granados-Fuentes, D., Saxena, M.T., Prolo, L.M., Aton, S.J., Herzog, E.: D. Olfactory bulb neurons express functional, entrainable circadian rhythms. Eur. J. Neurosci. 19, 898–906 (2004)
Ono, D., Honma, S., Honma, K., Circadian: PER2::LUC rhythms in the olfactory bulb of freely moving mice depend on the suprachiasmatic nucleus but not on behaviour rhythms. Eur. J. Neurosci. 42, 3128–3137 (2015)
Leinwand, S.G., Chalasani, S.H.: Olfactory networks: from sensation to perception. Curr. Opin. Genet. Dev. 21, 806–811 (2011)
Mombaerts, P.: Axonal Wiring in the Mouse Olfactory System. Annu. Rev. Cell. Dev. Biol. 22, 713–737 (2006)
Herz, R.S., et al.: The Influence of Circadian Timing on Olfactory Sensitivity. Chem. Senses 43, 45–51 (2018)
Miller, J.K., et al.: Vasoactive Intestinal Polypeptide Mediates Circadian Rhythms in Mammalian Olfactory Bulb and Olfaction. J. Neurosci. 34, 6040–6046 (2014)
Krukoff, T.L.: c-fos Expression as a Marker of Functional Activity in the Brain. In: Boulton, A.A., Baker, G.B., Bateson, A.N. (eds.) Cell Neurobiology Techniques, pp. 213–230. Humana Press (1999). doi:10.1385/0-89603-510-7:213
Amir, S., Cain, S., Sullivan, J., Robinson, B., Stewart, J.: In rats, odor-induced Fos in the olfactory pathways depends on the phase of the circadian clock. Neurosci. Lett. 272, 175–178 (1999)
Song, J.H., et al.: Precise Mapping of Single Neurons by Calibrated 3D Reconstruction of Brain Slices Reveals Topographic Projection in Mouse Visual Cortex. Cell. Rep. 31, 107682 (2020)
Ono, D., Honma, K., Yanagawa, Y., Yamanaka, A., Honma, S.: GABA in the suprachiasmatic nucleus refines circadian output rhythms in mice. Commun. Biol. 2, 1–12 (2019)
Vong, L., et al.: Leptin Action on GABAergic Neurons Prevents Obesity and Reduces Inhibitory Tone to POMC Neurons. Neuron 71, 142–154 (2011)
Shimba, S., et al.: Deficient of a Clock Gene, Brain and Muscle Arnt-Like Protein-1 (BMAL1), Induces Dyslipidemia and Ectopic Fat Formation. PLOS ONE 6, e25231 (2011)
Li, J., Ishii, T., Feinstein, P., Mombaerts, P.: Odorant receptor gene choice is reset by nuclear transfer from mouse olfactory sensory neurons. Nature 428, 393–399 (2004)
Yonekura, J., Yokoi, M.: Conditional genetic labeling of mitral cells of the mouse accessory olfactory bulb to visualize the organization of their apical dendritic tufts. Mol. Cell. Neurosci. 37, 708–718 (2008)
Iwasato, T., et al.: Cortex-restricted disruption of NMDAR1 impairs neuronal patterns in the barrel cortex. Nature 406, 726–731 (2000)
Nagayama, S., Homma, R., Imamura, F.: Neuronal organization of olfactory bulb circuits. Front. Neural Circuits 8, (2014)
Takahashi, H., Yoshihara, S., Tsuboi, A.: The Functional Role of Olfactory Bulb Granule Cell Subtypes Derived From Embryonic and Postnatal Neurogenesis. Front. Mol. Neurosci. 11, (2018)
Benson, D.L., Isackson, P.J., Gall, C.M., Jones, E.G.: Contrasting patterns in the localization of glutamic acid decarboxylase and Ca2+ /calmodulin protein kinase gene expression in the rat centrat nervous system. Neuroscience 46, 825–849 (1992)
Liu, N.: Regional Distribution of Protein Kinases in Normal and Odor-deprived Mouse Olfactory Bulbs. Chem. Senses 25, 401–406 (2000)
Zou, D.-J., Greer, C.A., Firestein, S.: Expression pattern of αCaMKII in the mouse main olfactory bulb. J. Comp. Neurol. 443, 226–236 (2002)
Yoo, S.-H., et al. PERIOD2::LUCIFERASE real-time reporting of circadian dynamics reveals persistent circadian oscillations in mouse peripheral tissues. Proc. Natl. Acad. Sci. 101, 5339–5346: (2004)
Panda, S., et al.: Coordinated Transcription of Key Pathways in the Mouse by the Circadian Clock. Cell 109, 307–320 (2002)
Brunjes, P.C., Illig, K.R., Meyer, E.A.: A field guide to the anterior olfactory nucleus (cortex). Brain Res. Rev. 50, 305–335 (2005)
Wilson, D.A., Sullivan, R.M.: Cortical Processing of Odor Objects. Neuron 72, 506–519 (2011)
Zhao, N., et al.: Arginine vasopressin receptor 1a is a therapeutic target for castration-resistant prostate cancer. Sci. Transl Med. 11, eaaw4636 (2019)
Hurst, R., Rollema, H., Bertrand, D.: Nicotinic acetylcholine receptors: From basic science to therapeutics. Pharmacol. Ther. 137, 22–54 (2013)
Neely, G.G., et al.: A Genome-wide Drosophila Screen for Heat Nociception Identifies α2δ3 as an Evolutionarily Conserved Pain Gene. Cell 143, 628–638 (2010)
Hoppa, M.B., Lana, B., Margas, W., Dolphin, A.C., Ryan, T.A.: α2δ expression sets presynaptic calcium channel abundance and release probability. Nature 486, 122–125 (2012)
Scott, M.B., Kammermeier, P.J.: CaV2 channel subtype expression in rat sympathetic neurons is selectively regulated by α2δ subunits. Channels 11, 555–573 (2017)
Stephani, F., et al.: Deletion of the Ca2 + Channel Subunit α2δ3 Differentially Affects Cav2.1 and Cav2.2 Currents in Cultured Spiral Ganglion Neurons Before and After the Onset of Hearing. Front. Cell. Neurosci. 13, (2019)
Kim, D.K., Catterall, W.A. Ca2+-dependent and -independent interactions of the isoforms of the α1A subunit of brain Ca2 + channels with presynaptic SNARE proteins. Proc. Natl. Acad. Sci. 94, 14782–14786: (1997)
Rettig, J., et al. Isoform-specific interaction of the alpha1A subunits of brain Ca2 + channels with the presynaptic proteins syntaxin and SNAP-25. Proc. Natl. Acad. Sci. U. S. A. 93, 7363–7368: (1996)
Yokoyama, C.T., et al.: Mechanism of SNARE protein binding and regulation of Cav2 channels by phosphorylation of the synaptic protein interaction site. Mol. Cell. Neurosci. 28, 1–17 (2005)
Yokoyama, C.T., Sheng, Z.-H., Catterall, W.A.: Phosphorylation of the Synaptic Protein Interaction Site on N-type Calcium Channels Inhibits Interactions with SNARE Proteins. J. Neurosci. 17, 6929–6938 (1997)
Gitler, D., Augustine, G.J. Synapsins and Regulation of the Reserve Pool. in Encyclopedia of Neuroscience (ed. Squire, L. R.) 709–717: (Academic Press, 2009). doi:10.1016/B978-008045046-9.01776-9
Noya, S.B., et al.: The forebrain synaptic transcriptome is organized by clocks but its proteome is driven by sleep. Science 366, eaav2642 (2019)
Pembroke, W.G., Babbs, A., Davies, K.E., Ponting, C.P., Oliver, P.L.: Temporal transcriptomics suggest that twin-peaking genes reset the clock. eLife 4, e10518 (2015)
Togashi, K., Tsuji, M., Takeuchi, S., Nakahama, R., Koizumi, H., Emoto, K.: Adeno-associated virus-mediated single cell labeling of mitral cells in the mouse olfactory bulb: Insights into the developmental dynamics of dendrite remodeling. Front. Cell. Neurosci. 14, 572256 (2020)

There is NO Competing Interest.

2022TakeuchiCommuBiolSupplementalInformationCommunicationsBiology.pdf

PDF

Version 1

posted 11 May, 2022

You are reading this latest preprint version

Genetic manipulation in the mouse olfactory circuit reveals an intrinsic role of the circadian clock in the piriform cortex for daily changes in odor-evoked neural activity

Status:

Version 1

Abstract

Figures

Introduction

Results

Odor-evoked neural activity in the PC exhibits a circadian rhythm

The PC can autonomously maintain the circadian rhythm of clock gene expression

Genes Related to Neural Activity Show Circadian Rhythms in the PC

Discussion

Materials And Methods

Declarations

References

Competing Interests

Supplementary Files

Status:

Version 1