HMGB1 recruits NK cells by CXCL12/CXCR4 axis contributing to persistent airway inﬂammation and AHR during the later stage of RSV infection

doi:10.21203/rs.3.rs-1566470/v1

PDF

Research Article

HMGB1 recruits NK cells by CXCL12/CXCR4 axis contributing to persistent airway inﬂammation and AHR during the later stage of RSV infection

https://doi.org/10.21203/rs.3.rs-1566470/v1

This work is licensed under a CC BY 4.0 License

Version 1

posted 21 Apr, 2022

You are reading this latest preprint version

Our previous studies have shown that both high-mobility group box-1 (HMGB1) and natural killer cells (NK cells) contribute to respiratory syncytial virus (RSV) induced persistent airway inflammation and airway hyperresponsiveness (AHR). Meanwhile, Chemokine (C-X-C motif) ligand 12 (CXCL12) and its receptor chemokine receptor 4 (CXCR4) were reported to play important roles in recruitment of immune cells. The relationships between them were unclear. We investigated whether HMGB1 can recruit NK cells by CXCL12/CXCR4 axis, thereby mediating RSV induced persistent airway disorders. Anti-HMGB1 neutralizing antibody and inhibitor of CXCR4 (AMD3100) were administered to observe the change of the percentage of NK cells and the airway disorders in nude mice. In the study, we found that mRNA and protein expression of HMGB1 were elevated in the later stage of RSV infection and persistent airway inflammation and AHR were diminished after administration of anti-HMGB1 antibodies with NK cells decreased significantly. At the same time, CXCL12 and CXCR4 were reduced after HMGB1 blockade. Treatment with AMD3100 was found to significantly suppress the recruitment of NK cells and alleviate the airway disorders. Therefore, HMGB1 recruits NK cells by CXCL12/CXCR4 axis contributing to persistent airway inflammation and AHR during the later stage of RSV infection.

RSV

HMGB1

NK cells

CXCL12/CXCR4

Early-life severe respiratory syncytial virus (RSV) infection is an important risk factor for recurrent wheezing [1], but the mechanism was still unclear. Our previous study has shown that high-mobility group box-1 (HMGB1) protein, an important member of the endogenous danger-associated molecular patterns (DAMP) family, promotes the persistent airway inﬂammation and airway hyperresponsiveness (AHR) during the later stage of RSV infection [2]. HMGB1 acts as an endogenous Toll-like receptor (TLR) ligand [3] and mediated nucleic acid induced innate immune responses [4]. Among the innate immune cells, natural killer cells (NK cells) play a prominent role in the development of recurrent wheezing and asthma[5, 6]. HMGB1 was reported to promote NK cell maturation, activation [3] and recruitment[7]. We had previously reported that NK cells deletion would alleviate the airway inﬂammation and AHR in Long et al’ study [8]. Whether NK cells were driven by upstream HMGB1 in the later stage of RSV need to be further clarified.

Chemokines are important for migration and positioning of immune cells. According to the location of the cysteine (C) residues at their N-terminus, Chemokines are divided into four main classes: the C-, the CC-, the CXC-, and the CX3C-chemokines. CXCL12（Chemokine (C-X-C motif) ligand 12）belongs to CXC chemokines, which can affecting the migration, localization of immune cells by binding to its specific receptor CXCR4 (Chemokine) receptor 4[9,10].HMGB1 is reported to be closely related to CXCL12, which can form a complex to enhance the combination of CXCL12 and CXCR4, and further recruit immune cells [11,12]. In addition, HMGB1 can also increase the transcription of CXCL12 [13], protect its conformational integrity [14], thereby promoting its chemotaxis. Therefore, we assume that HMGB1 recruits NK cells by CXCL12/CXCR4 axis in the later stage of RSV infection.

In the present study, nude mice were used to demonstrate that HMGB1 promoted NK cell recruitment through CXCL12/CXCR4 axis take part in RSV-associated sequela, those mice whose T cells are deficient but the innate immunity is normal with abundant NK cells in the lung tissues. These observations clearly emphasize the potential of HMGB1 as a new therapeutic target in the later stage of RSV infection.

Virus and mouse infection

The RSV A2 (ATCC, VR-1540) strain was propagated in HEp-2 cells (ATCC) as previously described [15], and the viral titer was determined by plaque assay. Female nude mice (on a BALB/c background) aged at 6-8 weeks were purchased from the Chongqing Medical University Animal Laboratory and housed in individually filtered cages under accredited specific pathogen-free conditions. The mice were infected intranasally with 100 μl of a stock suspension of 6×10⁷ PFU/ml RSV under sodium pentobarbital anesthesia. Mock-infected mice were inoculated intranasally with 100μl of culture supernatant of HEp-2 cell at the same time. The protocol was approved by the Committee on the Ethics of Animal Experiments of Chongqing Medical University (permit number SYXK-(YU) 2012-0001).

Experimental design and sample collection

Intraperitoneal injections of an anti-HMGB1 neutralizing antibody at 400 μg/kg (R&D Systems, USA) dissolved in phosphate-buffered saline (PBS) or control antibodies were performed daily from day 20 to 27 after RSV incubation in nude mice.

AMD3100 (Sigma-Aldrich, USA), specific blocker of CXCR4, was dissolved in PBS and administered subcutaneously at 20 mg/kg daily from day 20 to 27 after RSV infection in nude mice. The control group received a sham injection of PBS at the same time.

On day 28 after RSV incubation, the mice were sacrificed to collect bronchoalveolar lavage fluid (BALF) and lungs for analyses of the protein, RNA and histopathology.

Real-time quantitative PCR analysis

Total RNA was extracted from the lung tissues with the TRIZOL reagent (Invitrogen, CA), and cDNA was synthesized by a PrimeScript RT reagent kit (TaKaRa, Japan). Quantitative PCR was performed on ABI PRISM 7900 HT system (Applied Biosystems, Foster City, CA). The primers for mouse HMGB1 were: forward, 5’- CCAAGAAGTGCTCAGAGAGGTG and reverse, 5’-GTCCTTGAACTTCTTTTTGGTCTC. CXCL12 primers were: forward, 5’- TGCATCAGTGACGGTAAACCA and reverse: 5’- TTCTTCAGCCGTGCAACAATC. β-actin primers were: forward, 5’- TGGCATTGTTACCAACTGGGAC and reverse: 5’- TCACGGTTGGCCTTAGGGTTC.

ELISA analysis

The concentration of CXCL12 in the BALF were measured using mouse-specific ELISA kits (Sizhengbai, Beijing, China). The concentration of HMGB1 in the BALF were determined using an HMGB1 ELISA kit (Shino-test Corporation, Kanagawa, Japan).

Western blotting

The total protein was extracted from the lung tissues using a total protein extraction kit (KeyGEN, Nanjing, China). Samples containing equal quantities of protein were separated on 8% SDS-PAGE (sodium dodecyl sulfate polyacrylamide gel electrophoresis) gels and then transferred onto PVDF membranes (Millipore, Billerica, MA). The membranes were probed with primary antibodies against CXCR4 (1:500, Santa Cruz, USA) or β-actin (1:5,000; 4abio, China). An alkaline phosphatase-conjugated goat anti-mouse antibody (1:5000; MultiSciences, China) was used to detect the presence of the respective protein bands. Signals were quantified using Quantity One software (Bio-Rad, Hercules, CA) and normalized relative to β-actin.

Inflammatory cell counts in BALF

Briefly, mice were anesthetized with urethane at 15 mg/10 g body weight intraperitoneally. BALF was collected following six times lavage washes with 0.5 ml ice-cold PBS for inflammatory cell counting as previously described [15].

Airway resistance detection

AHR was assessed in conscious and unrestrained mice by means of whole-body plethysmography (Emca instrument, All Medicus, France). Briefly, each mouse was placed in a plastic chamber and exposed to an aerosolized PBS, following by increasing concentrations of aerosolized methacholine solution (3.125, 6.25, 12.5, 25, 50 mg/ml; Sigma, USA) dissolved in PBS at 3-min exposures. Bronchoconstriction was recorded for an additional 5 min after each dose of methacholine. The highest Penh (enhanced pauses) value obtained during each methacholine challenge was expressed as a proportion of the basal Penh value observed in response to the PBS challenge.

Lung histopathology

The left lung lobes from mice were fixed in 10% (v/v) neutral-buffered formalin for 24 hours, embedded in paraffin, cut into sections of 5μm thickness, and stained with hematoxylin and eosin (Sigma-Aldrich, Sigma MHS-16 and Sigma HT110-1-32, respectively, USA) to evaluate RSV-associated pulmonary histopathology. The infiltration of inﬂammatory cells around the airway was scored as previously described [16].

Flow cytometry

The prepared single cell suspensions were blocked with rat serum for half an hour and then stained with antibody to mouse CD45, CD3, CD19, CD49b or isotype control conjugated with PE-Cy7, PerCP-cy5.5, FITC or PE for 30 min, respectively. The indicated antibodies were obtained from eBioscience (San Diego, CA, USA). Subsequently, stained samples were measured on a flow cytometer, FACSCalibur (BD Biosciences). The data were analyzed by CellQuest software (BD Biosciences).

Expression of HMGB1 was increased in the later stage of RSV infection

To evaluate the effects of HMGB1 after RSV inoculation, the gene expression in lung tissues and protein level in BALF of HMGB1 were detected on days 5, 21, and 28 after RSV infection. The real time PCR showed mRNA levels of HMGB1 had significantly increased on day 28 after RSV infection (Fig. 1a). Likewise, protein level in BALF of HMGB1 elevated on day 28 (Fig. 1b). To further assess the effect of HMGB1 on persistent lung pathology, anti-HMGB1 neutralizing antibody (400 μg/kg, i.p. daily from day 20 to day 27 after RSV incubation) was administrated to blockade HMGB1 (Fig. 1c).

Blockade of HMGB1 alleviated the persist airway inflammation, airway hyperresponsiveness, pathological damage in the later stage of RSV infection

Histological examination of lung tissues were performed on day 28 after RSV infection. The morphological changes and the severity scores were significantly attenuated in RSV + anti-HMGB1 antibody group (Fig. 2a-d). Anti-HMGB1 antibody treated mice were significantly protected against infiltration of inflammatory cells as compared to RSV-infected mice (Fig. 2e). Next, we analyzed AHR which was evaluated by calculation of Penh values (enhanced pauses). The Penh values on day 28 and at methacholine concentrations 50 mg/ml for RSV+anti-HMGB1 antibody group were significantly attenuated compared with RSV-infected mice (Fig. 2f). Thus HMGB1 contribute to persistent lung pathology in the later stage of RSV infected nude mice.

HMGB1 contributed to NK cells recruitment into lung tissue in the later stage of RSV infection

We had previously reported CD49b⁺ NK cells were significantly increased and contributed to the persistent airway inflammation and AHR during the later stage of RSV infected nude mice [8]. Whether the recruitment of NK cell was driven by HMGB1 had not been elucidated.

To evaluate the effect of HMGB1 on the recruitment of NK cells, CD49b⁺ NK cells in the lung tissues were assessed by flow cytometry. Percentages of CD49b⁺ NK cells were markedly increased in RSV group and attenuated in the RSV+anti-HMGB1 group on days 28 after RSV infection in nude mice (Fig. 3). However, the percentages of CD3⁺ T cells and CD19⁺ B cells did not change (Supplementary Fig. 1).

Based on the exact role of CD49b+ NK cells in RSV-induced persistent airway disorders we had reported [8], we concluded the upstream molecular HMGB1 contributed to NK cells recruitment involving in persistent lung pathology in the later stage of RSV infection.

Chemokine CXCL12 and its receptor CXCR4 decreased after HMGB1 blockade in nude mice

To understand how HMGB1 recruits NK cells, chemokine CXCL12 and its receptor CXCR4 were detected. In nude mice, the protein level of CXCL12 increased with CXCR4 also elevated significantly on day 28, and both were prevented when HMGB1 was blocked (Fig. 4a-c). The role of CXCL12-CXCR4 axis in regulating migration of NK cells need to be further illustrated.

NK cells recruit to lung tissue was prevented by CXCR4 blockade in the later stage of RSV infection

To assess the effects of CXCL12-CXCR4 axis on NK cells associated persistent airway disorders, mice received subcutaneous injections of AMD3100 at 20 mg/kg daily from day 20 to 27 after RSV infection to block CXCR4 specifically. Disease parameters were assessed on day 28. Percentages of CD49b⁺ NK cells were markedly increased in RSV group and decreased in the RSV+AMD3100 group on days 28 after RSV infection (Fig. 5). And the percentages of CD3⁺ T cells and CD19⁺ B cells did not change (Supplementary Fig. 2).

Blockade of CXCR4 alleviated the persist airway inflammation, airway hyperresponsiveness, pathological damage in the later stage of RSV infection

Similar with the phenomena observed after HMGB1 blockade, the airway disorders alleviated after AMD3100 administration. A mass of inﬂammatory cells infiltrated in the peribronchiolar compartments in the RSV-infected mice, compared to those in the mock group. The morphological changes and the severity scores were significantly attenuated after AMD3100 administration (Fig. 6a-d). Treatment with AMD3100 was also found to significantly suppress the infiltration of inflammatory cells (Fig. 6e) and alleviate the AHR which was evaluated by calculation of Penh (Fig. 6f). Together, these results suggested that CXCL12-CXCR4 axis contributes to NK cells recruitment that is involved in the persistent lung pathology in RSV infected mice.

On the basis that HMGB1 and NK cells are known to be involved in the airway disorders in the later stage of RSV infection, in the current study we found that administration of anti-HMGB1 antibodies could attenuate the recruitment of NK cells, with the expression of CXCL12 and CXCR4 decreased in nude mice. AMD3100, specific blocker of CXCR4, was found to significantly suppress the recruitment of NK cells and alleviate the airway disorders. Therefore, HMGB1 recruits NK cells by CXCL12/CXCR4 axis contributing to persistent airway inﬂammation and AHR during the later stage of RSV infection. These studies may explain the role of respiratory virus infections in the development of persistent airway disorders.

We have reported that HMGB1 is involved in the persistent airway disorders in the later stage of RSV infection, when there is no replication of live virus in the lung in BALB/c mice[2]. In the current study, we draw a similar conclusion in nude mice whose T cells and the corresponding adaptive immune responses are defcient, but the innate immunity is normal or even compensatorily enhanced [17]. HMGB1 belongs to the DAMP family, was first reported to be a late mediator of endotoxin lethality in sepsis [18]. HMGB1 was highly associated with the development of airway obstructive disease. There was a positive correlation between level of HMGB1 and clinic severity in patients with asthma [19] or chronic obstructive pulmonary disease[20, 21]. HMGB1 also contribute to airway remodeling, mucus hypersecretion [22, 23], and inflammatory cells[24, 25] recruitment in asthma models induced by different allergens.

Extracellular HMGB1 works as an important inflammatory factor, which binds to TLRs [26] to activate downstream pathways, mediating nucleic acid (including dsDNA, Poly I:C and other virus nucleic acids) induced innate immune responses [4]. Among the innate immune cells, NK cells play an important role in the persistent airway disorders in the later stage of RSV infection reported as our previous study. The number of NK cells significantly increased in the later stage of RSV infection in both BALB/c mice and nude mice. Anti-asialo-GM1 antibodies, using for NK cells depletion, can obviously attenuate lung tissue damage, decrease the recruitment of inflammatory cells and relief the AHR induced by RSV infection[8]. Qiu et [3] had reported HMGB1 could promoted NK cell maturation and activation in rotavirus induced murine biliary atresia. The HMGB1-deficient tumors have an impaired ability to recruit NK cells into the treated tumor tissue [7]. Interaction between NK cells and melanoma cells can release HMGB1 capable of attracting additional activated NK cells [27] . In the present study, we found anti-HMGB1 antibodies could attenuate the recruitment of NK cells in the later stage of RSV infection. These studies reveal the link between HMGB1 and NK cells.

It is not clear whether chemokines are required to participate in the recruitment of NK cells by HMGB1 after RSV infection. In vitro, the synergistic effect of HMGB1 and CXCL12 has been confirmed to be specific, and HMGB1 does not affect the cell migration caused by other chemokines, including CXCL8, CCL2, CCL7, CCL19 and CCL21 [12]. Zhao et al [28] has reported that HMGB1 is required for maintaining CXCL12/CXCR4 expression in the developing brain both in vivo and in vitro. CXCL12/HMGB1 could be maintained in chronic inflammation[29] and may be a potential pharmacological targeting for anti-inflammatory[30]. Furthermore, binding with HMGB1 or CXCL12 and disrupting their heterocomplex can block the infiltration of CD45+ leukocytes[31]. CXCL12/HMGB1 complex is not restricted to innate immune cells but that it also applies to migration of B lymphocytes from lymphoid organs in homeostasis[32]. In our study, we found that both CXCL12 and CXCR4 decreased after HMGB1 blockade, suggesting that HMGB1 is the upstream of CXCL12/ CXCR4 pathway.

In summary, our results suggest that HMGB1 could recruit NK cells contributing to persistent airway inﬂammation and AHR during the later stage of RSV infection. It further illustrate the role of CXCL12/ CXCR4 pathway and NK cells in inflammatory response downstream of HMGB1. This provide a potential target for RSV induced persistent airway disorder.

AHR

Airway hyperresponsiveness

BALF

Bronchoalveolar lavage fluid

CXCL12

Chemokine (C-X-C motif) ligand 12

CXCR4

Chemokine receptor 4

DAMPs

Danger-associated molecular patterns

HMGB1

High mobility group box-1 protein

NK cells

Natural killer cells

PBS

Phosphate-buffered saline

RSV

Respiratory syncytial virus

TLR

Toll-like receptor ligand

Funding. This work was supported by the Natural Science Foundation of Chongqing (cstc2020jcyj-msxmX0303) and National Natural Science Foundation of China (81900008 ).

Conflict of Interest. No conflicts of interest, financial or otherwise, are declared by the authors.

Author Contributions. Enmei Liu, Sisi Chen contributed to the study conception and design. Material preparation, data collection and analysis were performed by Sisi Chen, Wei Tang, and Guangyuan Yu. The first draft of the manuscript was written by Sisi Chen and all authors commented on previous versions of the manuscript. All authors read and approved the final manuscript.

Ethics Approval. The protocol was approved by the Committee on the Ethics of Animal Experiments of Chongqing Medical University (permit number SYXK-(YU) 2012-0001).

Consent to Participate. Not applicable.

Consent for Publication. Not applicable.

Code Availability. Not applicable.

Sigurs, N., Gustafsson, P. M., Bjarnason, R., Lundberg, F., Schmidt, S., Sigurbergsson, F., and Kjellman, B. 2005. Severe respiratory syncytial virus bronchiolitis in infancy and asthma and allergy at age 13. Am J Respir Crit Care Med 171: 137–141. http://doi:10.1164/rccm.200406-730OC.
Chen, S., Yu, G., Xie, J., Tang, W., Gao, L., Long, X., Ren, L., Xie, X., Deng, Y., Fu, Z., and Liu, E. 2019. High-mobility group box-1 protein from CC10(+) club cells promotes type 2 response in the later stage of respiratory syncytial virus infection. Am J Physiol Lung Cell Mol Physiol 316: L280-l290. http://doi:10.1152/ajplung.00552.2017.
Qiu, Y., Yang, J., Wang, W., Zhao, W., Peng, F., Xiang, Y., Chen, G., Chen, T., Chai, C., Zheng, S., Watkins, D. J., and Feng, J. 2014. HMGB1-promoted and TLR2/4-dependent NK cell maturation and activation take part in rotavirus-induced murine biliary atresia. PLoS Pathog 10: e1004011. http://doi:10.1371/journal.ppat.1004011.
Yanai, H., Ban, T., Wang, Z., Choi, M. K., Kawamura, T., Negishi, H., Nakasato, M., Lu, Y., Hangai, S., Koshiba, R., Savitsky, D., Ronfani, L., Akira, S., Bianchi, M. E., Honda, K., Tamura, T., Kodama, T., and Taniguchi, T. 2009. HMGB proteins function as universal sentinels for nucleic-acid-mediated innate immune responses. Nature 462: 99–103. http://doi:10.1038/nature08512.
Mathias, C. B. 2015. Natural killer cells in the development of asthma. Curr Allergy Asthma Rep 15: 500. http://doi:10.1007/s11882-014-0500-2.
Mathias, C. B., Guernsey, L. A., Zammit, D., Brammer, C., Wu, C. A., Thrall, R. S., and Aguila, H. L. 2014. Pro-inflammatory role of natural killer cells in the development of allergic airway disease. Clin Exp Allergy 44: 589–601. http://doi:10.1111/cea.12271.
Guerriero, J. L., Ditsworth, D., Catanzaro, J. M., Sabino, G., Furie, M. B., Kew, R. R., Crawford, H. C., and Zong, W. X. 2011. DNA alkylating therapy induces tumor regression through an HMGB1-mediated activation of innate immunity. J Immunol 186: 3517–3526. http://doi:10.4049/jimmunol.1003267.
Long, X., Xie, J., Zhao, K., Li, W., Tang, W., Chen, S., Zang, N., Ren, L., Deng, Y., Xie, X., Wang, L., Fu, Z., and Liu, E. 2016. NK cells contribute to persistent airway inflammation and AHR during the later stage of RSV infection in mice. Med Microbiol Immunol 205: 459–470. http://doi:10.1007/s00430-016-0459-9.
Griffith, J. W., Sokol, C. L., and Luster, A. D. 2014. Chemokines and chemokine receptors: positioning cells for host defense and immunity. Annu Rev Immunol 32: 659–702. http://doi:10.1146/annurev-immunol-032713-120145.
Susek, K. H., Karvouni, M., Alici, E., and Lundqvist, A. 2018. The Role of CXC Chemokine Receptors 1–4 on Immune Cells in the Tumor Microenvironment. Front Immunol 9: 2159. http://doi:10.3389/fimmu.2018.02159.
Cecchinato, V., D'Agostino, G., Raeli, L., and Uguccioni, M. 2016. Chemokine interaction with synergy-inducing molecules: fine tuning modulation of cell trafficking. J Leukoc Biol 99: 851–855. http://doi:10.1189/jlb.1MR1015-457R.
Schiraldi, M., Raucci, A., Muñoz, L. M., Livoti, E., Celona, B., Venereau, E., Apuzzo, T., De Marchis, F., Pedotti, M., Bachi, A., Thelen, M., Varani, L., Mellado, M., Proudfoot, A., Bianchi, M. E., and Uguccioni, M. 2012. HMGB1 promotes recruitment of inflammatory cells to damaged tissues by forming a complex with CXCL12 and signaling via CXCR4. J Exp Med 209: 551–563. http://doi:10.1084/jem.20111739.
Penzo, M., Molteni, R., Suda, T., Samaniego, S., Raucci, A., Habiel, D. M., Miller, F., Jiang, H. P., Li, J., Pardi, R., Palumbo, R., Olivotto, E., Kew, R. R., Bianchi, M. E., and Marcu, K. B. 2010. Inhibitor of NF-kappa B kinases alpha and beta are both essential for high mobility group box 1-mediated chemotaxis. J Immunol 184: 4497–4509. http://doi:10.4049/jimmunol.0903131.
Campana, L., Bosurgi, L., Bianchi, M. E., Manfredi, A. A., and Rovere-Querini, P. 2009. Requirement of HMGB1 for stromal cell-derived factor-1/CXCL12-dependent migration of macrophages and dendritic cells. J Leukoc Biol 86: 609–615. http://doi:10.1189/jlb.0908576.
Liu, T., Zang, N., Zhou, N., Li, W., Xie, X., Deng, Y., Ren, L., Long, X., Li, S., Zhou, L., Zhao, X., Tu, W., Wang, L., Tan, B., and Liu, E. 2014. Resveratrol inhibits the TRIF-dependent pathway by upregulating sterile alpha and armadillo motif protein, contributing to anti-inflammatory effects after respiratory syncytial virus infection. J Virol 88: 4229–4236. http://doi:10.1128/jvi.03637-13.
Deng, Y., Chen, W., Zang, N., Li, S., Luo, Y., Ni, K., Wang, L., Xie, X., Liu, W., Yang, X., Fu, Z., and Liu, E. 2011. The antiasthma effect of neonatal BCG vaccination does not depend on the Th17/Th1 but IL-17/IFN-γ balance in a BALB/c mouse asthma model. J Clin Immunol 31: 419–429. http://doi:10.1007/s10875-010-9503-5.
Zhang, Z., Burnley, P., Coder, B., and Su, D. M. 2012. Insights on FoxN1 biological significance and usages of the "nude" mouse in studies of T-lymphopoiesis. Int J Biol Sci 8: 1156–1167. http://doi:10.7150/ijbs.5033.
Wang, H., Bloom, O., Zhang, M., Vishnubhakat, J. M., Ombrellino, M., Che, J., Frazier, A., Yang, H., Ivanova, S., Borovikova, L., Manogue, K. R., Faist, E., Abraham, E., Andersson, J., Andersson, U., Molina, P. E., Abumrad, N. N., Sama, A., and Tracey, K. J. 1999. HMG-1 as a late mediator of endotoxin lethality in mice. Science 285: 248–251. http://doi:10.1126/science.285.5425.248.
Shim, E. J., Chun, E., Lee, H. S., Bang, B. R., Kim, T. W., Cho, S. H., Min, K. U., and Park, H. W. 2012. The role of high-mobility group box-1 (HMGB1) in the pathogenesis of asthma. Clin Exp Allergy 42: 958–965. http://doi:10.1111/j.1365-2222.2012.03998.x.
Ferhani, N., Letuve, S., Kozhich, A., Thibaudeau, O., Grandsaigne, M., Maret, M., Dombret, M. C., Sims, G. P., Kolbeck, R., Coyle, A. J., Aubier, M., and Pretolani, M. 2010. Expression of high-mobility group box 1 and of receptor for advanced glycation end products in chronic obstructive pulmonary disease. Am J Respir Crit Care Med 181: 917–927. http://doi:10.1164/rccm.200903-0340OC.
Ko, H. K., Hsu, W. H., Hsieh, C. C., Lien, T. C., Lee, T. S., and Kou, Y. R. 2014. High expression of high-mobility group box 1 in the blood and lungs is associated with the development of chronic obstructive pulmonary disease in smokers. Respirology 19: 253–261. http://doi:10.1111/resp.12209.
Ullah, M. A., Loh, Z., Gan, W. J., Zhang, V., Yang, H., Li, J. H., Yamamoto, Y., Schmidt, A. M., Armour, C. L., Hughes, J. M., Phipps, S., and Sukkar, M. B. 2014. Receptor for advanced glycation end products and its ligand high-mobility group box-1 mediate allergic airway sensitization and airway inflammation. J Allergy Clin Immunol 134: 440–450. http://doi:10.1016/j.jaci.2013.12.1035.
Hou, C., Kong, J., Liang, Y., Huang, H., Wen, H., Zheng, X., Wu, L., and Chen, Y. 2015. HMGB1 contributes to allergen-induced airway remodeling in a murine model of chronic asthma by modulating airway inflammation and activating lung fibroblasts. Cell Mol Immunol 12: 409–423. http://doi:10.1038/cmi.2014.60.
Zhang, F., Huang, G., Hu, B., Fang, L. P., Cao, E. H., Xin, X. F., Song, Y., and Shi, Y. 2014. Anti-HMGB1 neutralizing antibody ameliorates neutrophilic airway inflammation by suppressing dendritic cell-mediated Th17 polarization. Mediators Inflamm 2014: 257930. http://doi:10.1155/2014/257930.
Lee, C. C., Lai, Y. T., Chang, H. T., Liao, J. W., Shyu, W. C., Li, C. Y., and Wang, C. N. 2013. Inhibition of high-mobility group box 1 in lung reduced airway inflammation and remodeling in a mouse model of chronic asthma. Biochem Pharmacol 86: 940–949. http://doi:10.1016/j.bcp.2013.08.003.
Vénéreau, E., Ceriotti, C., and Bianchi, M. E. 2015. DAMPs from Cell Death to New Life. Front Immunol 6: 422. http://doi:10.3389/fimmu.2015.00422.
Parodi, M., Pedrazzi, M., Cantoni, C., Averna, M., Patrone, M., Cavaletto, M., Spertino, S., Pende, D., Balsamo, M., Pietra, G., Sivori, S., Carlomagno, S., Mingari, M. C., Moretta, L., Sparatore, B., and Vitale, M. 2015. Natural Killer (NK)/melanoma cell interaction induces NK-mediated release of chemotactic High Mobility Group Box-1 (HMGB1) capable of amplifying NK cell recruitment. Oncoimmunology 4: e1052353. http://doi:10.1080/2162402x.2015.1052353.
Zhao, X., Rouhiainen, A., Li, Z., Guo, S., and Rauvala, H. 2020. Regulation of Neurogenesis in Mouse Brain by HMGB1. Cells 9: 1714. http://doi:10.3390/cells9071714.
Cecchinato, V., D'Agostino, G., Raeli, L., Nerviani, A., Schiraldi, M., Danelon, G., Manzo, A., Thelen, M., Ciurea, A., Bianchi, M. E., Rubartelli, A., Pitzalis, C., and Uguccioni, M. 2018. Redox-Mediated Mechanisms Fuel Monocyte Responses to CXCL12/HMGB1 in Active Rheumatoid Arthritis. Front Immunol 9: 2118. http://doi:10.3389/fimmu.2018.02118.
De Leo, F., Quilici, G., De Marchis, F., Mantonico, M. V., Bianchi, M. E., and Musco, G. 2020. Discovery of 5,5'-Methylenedi-2,3-Cresotic Acid as a Potent Inhibitor of the Chemotactic Activity of the HMGB1·CXCL12 Heterocomplex Using Virtual Screening and NMR Validation. Front Chem 8: 598710. http://doi:10.3389/fchem.2020.598710.
De Leo, F., Quilici, G., Tirone, M., De Marchis, F., Mannella, V., Zucchelli, C., Preti, A., Gori, A., Casalgrandi, M., Mezzapelle, R., Bianchi, M. E., and Musco, G. 2019. Diflunisal targets the HMGB1/CXCL12 heterocomplex and blocks immune cell recruitment. EMBO Rep 20: e47788. http://doi:10.15252/embr.201947788.
Spagnuolo, L., Puddinu, V., Boss, N., Spinetti, T., Oberson, A., Widmer, J., Mottas, I., Hotz, C., Bianchi, M. E., Uguccioni, M., and Bourquin, C. 2021. HMGB1 promotes CXCL12-dependent egress of murine B cells from Peyer's patches in homeostasis. Eur J Immunol 51: 1980–1991. http://doi:10.1002/eji.202049120.

No competing interests reported.

SupplementaryFigure1.tif
Supplementary Fig.1. The change of immune cells after HMGB1 blockade in the later stage of RSV-infected nude mice. CD3⁺T cells, CD19⁺B cells, CD49b⁺ NK cells in the lung tissue were analysed by flow cytometry on day 28 after treatment with anti-HMGB1 (RSV + anti-HMGB1) or control antibodies (RSV). Anti-HMGB1 neutralizing antibody (400 μg/kg, i.p. daily from day 20 to day 27 after RSV incubation) was administrated to blockade HMGB1. ** RSV compared with Mock, P < 0.01. ^ RSV+anti-HMGB1 compared to the RSV group, P <0.05. The data are representative of three independent experiments. The values are shown as the means ± SEM (n = 5-6/group).
SupplementaryFigure2.tif
Supplementary Fig. 2. The change of immune cells after CXCR4 blockade in the later stage of RSV-infected nude mice. CD3⁺T cells, CD19⁺B cells, CD49b⁺ NK cells in the lung tissue were analysed by flow cytometry on day 28 after treatment with AMD3100 (RSV +AMD3100), which is a specific blocker of CXCR4 and administered subcutaneously at 20 mg/kg daily from day 20 to 27 after RSV infection in nude mice. The control group received a sham injection of PBS at the same time. * RSV compared with Mock, P < 0.05. ^^^ RSV+AMD3100 compared to the RSV group, P <0.001. The data are representative of three independent experiments. The values are shown as the means ± SEM (n = 4-6/group).
actin1.tif
actin2.tif
cxcr41.tif
cxcr42.tif
summury.tif

PDF

Version 1

posted 21 Apr, 2022

You are reading this latest preprint version

HMGB1 recruits NK cells by CXCL12/CXCR4 axis contributing to persistent airway inﬂammation and AHR during the later stage of RSV infection

Status:

Version 1

Abstract

Figures

Introduction

Material And Methods

Results

Discussion

Abbreviations

Declarations

References

Competing Interests

Supplementary Files

Status:

Version 1