Reagents and materials
Locostatin (T8823) was purchased from Topscience (Shanghai, China). SCH772984(S7101) was purchased from Selleck (Shanghai, China). RKIP antibody (ab76582) and β-actin antibody (ab8227) were purchased from Abcam (USA). ERK1/2 antibody (WL01864) and pERK1/2 (thr202/tyr204) antibody (WLP1512) were purchased from Wanleibio Company (Shenyang, China). CDK4 antibody (D9G3E) was from Cell Signaling Technology (USA).
Cell isolation and culture
The pNHBE cells were isolated from the normal bronchial tissues of patients with lung carcinoma in situ judged by three senior pathologists, the bronchial tissues were cut at the site more than 3 cm distant from the edge of lung carcinoma according to the method modified from previous studies [27, 28], pNHBE cells were cultured in BEGM medium (Lonza, USA). Human airway epithelial BEAS-2B cells were purchased from FuHeng Biology (Shanghai, China) and cultured in RPMI-1640 medium (Hyclone, USA) supplemented with 10% fetal bovine serum, 100 U/mL penicillin, and 100 ng/mL streptomycin at 37°C under a humidified atmosphere of 5% CO2/95% air, DHBE cells are identical with BEAS-2B cells. Then, using BEAS-2B, DHBE and pNHBE cells to perform the next experiments.
Western blotting
Proteins of cells or lung tissues were harvested by lysis buffer. Equal amount of protein was separated on SDS-PAGE gel and transferred to PVDF membranes. 5% non-fat milk was used to block the membranes and primary antibodies were used overnight. Subsequently, a secondary HRP-conjugated antibody was used for 1 h at room temperature.
Quantitative real-time PCR
RNA was extracted and reversed transcribed to cDNA according to kit procedures. Quantitative real-time PCR (qRT-PCR) was performed using 2 x S6 Universal SYBR qPCR Mix (EnzyArtisan, shanghai, China) with the primers listed in Table 1. Expression levels of target mRNA were calculated using 2-ΔΔCt relative to the reference gene (β-actin), then calculated as fold change relative to the media control.
Table 1 Primers used in the study
Primer
|
Sequence (5’-3’)
|
RKIP (human) F
|
GCTCTACACCTTGGTCCTGACA
|
RKIP (human) R
|
AATCGGAGAGGACTGTGCCACT
|
IL-1β (human) F
|
CCACAGACCTTCCAGGAGAATG
|
IL-1β (human) R
|
GTGCAGTTCAGTGATCGTACAGG
|
IL-18 (human) F
|
AGCAAGGAATTGTCTCCCAG
|
IL-18 (human) R
|
GAAGCGATCTGGAAGGTCTG
|
β-actin (human) F
|
CACCATTGGCAATGAGCGGTTC
|
β-actin (human) R
|
AGGTCTTTGCGGATGTCCACGT
|
IL-1β (mouse) F
|
TGGACCTTCCAGGATGAGGACA
|
IL-1β (mouse) R
|
GTTCATCTCGGAGCCTGTAGTG
|
IL-18 (mouse) F
|
AGGGTTTGTGTTCCAGAAAGATG
|
IL-18 (mouse) R
|
AGCCTCGGGTATTCTGTTATGG
|
β-actin (mouse) F
|
CATTGCTGACAGGATGCAGAAGG
|
β-actin (mouse) R
|
TGCTGGAAGGTGGACAGTGAGG
|
Immunofluorescence staining
Cells were plated in 24 well culture plates after IAV infection for 48 h. Then the cells were washed with cold phosphate-buffered saline (PBS), fixed with 4% paraformaldehyde and permeated with 0.1% Triton X-100. After being blocked with 5% BSA at room temperature for 30 min, the cells were incubated with RKIP antibody (1:100, Abcam, USA) overnight. The secondary antibody incubated at a 1:500 dilution for 1 h at room temperature. DAPI was used to visualize the nuclei and analyzed using a laser confocal microscope (Zeiss LSM880, Carl Zeiss AG).
Enzyme linked immunosorbent assay (ELISA)
The level of inflammatory cytokines IL-1β and IL-18 in supernatants of cells, serum and BALF of mice were examined by ELISA kits according to the protocol from the manufacturer.
Cell cycle assay
Cells were plated in 12 well plates and stained according to the manufacturer's instructions. The cell cycle was analyzed by using a novocyte flow cytometer (Agilent, USA).
Cell viability assay
Cells were plated at a density of 5 × 103 in 96 well plates. After cells were infected by IAV(MOI=2) for 48 h at 37°C in a humidified 5% CO2, we evaluated the cell viability by CCK-8 kit according to the manufacturer's instructions. Briefly, 10 μl of CCK-8 reagent was added into each well, then the cells were incubated at 37°C for 2 h. The absorbance at 450 nm was measured to evaluate cell viability.
EdU assay
Cells were cultured in 24 wells plate after IAV infection for 48 h. EdU kit (NO. C0075S, Beyotime Bio, Shanghai, China) was used to detect the degree of DNA damage according to the protocol. The results were analyzed by using Leica orthotopic micro-scope (Leica DM6B).
Immunohistochemistry
Briefly, lung tissue sections were incubated in primary antibody at 4°C overnight and the secondary antibody was used at room temperature for 1 h. Finally, after DAB staining, the sections were then counterstained using hematoxylin.
Animal experiment
Six-week-old C57BL/6 mice were challenged by IAV to induce airway inflammation, and were treated with locostatin respectively. Mice were randomly divided into four groups: control group, IAV group, locostatin group and IAV + locostatin group. Locostatin was pre-treatment 4 h before 100PFU of IAV in 100 μl through the oropharyngeal aspiration. 7 days later, mice were anesthetized with pentobarbital (70 mg/Kg), then serum and BALF were collected to detect the level of IL-1β and IL-18 by ELISA. Meanwhile, we detected the mRNA level of IL-1β and IL-18 in the lung tissue. HE and IHC staining were used to analyze airway inflammation and the expression of RKIP. Expression of RKIP, ERK1/2, pERK1/2, CDK4 and NLRP3 in the lung tissue were measured by western blotting.
Statistical analysis
Data were expressed as the mean ± SEM. Statistical Analysis was performed using SPSS 23.0 (IBM, Armonk, NY, USA). Differences between two groups were analyzed through Student t-test. While those among three or more groups were analyzed by one-way analysis of variance (ANOVA). P < 0.05 was considered significant.