2.1. Prawn and plant extraction
M. resenbergii (20.0 ± 2.0 g) were acclimatized at 25oC with continuous aeration and fed with commercial feed at 5% of shrimp body weight per day for two weeks before treatment.
S. radix extraction was prepared following a method modified by Zhao et al. (Zhao et al 2016). Briefly, S. radix was ground into powder, then 10 g of S. radix were added to 150 mL of double-distilled water (ddH2O) and heated at 95oC for 15 min, followed by centrifugation at 4oC, 1000 g for 10 minutes. The supernatant of S. radix water extract was collected and evaporated using a freeze dryer (EYELA FDU-1100). Finally, the powder was kept at 4oC until use.
2.2. Effect of S. radix extract on immune response
The powder was dissolved in PBS at 0, 1, 5, and 10 µg/µl (T0, T1, T2, and T3, respectively) and then mixed with red food dye (Uchi Co., Ltd) in a 1:30 v/v (red dye: PBS). After fasting for 24 hours, the prawns were reversely gavage fed with 10 µl of the mixture.
Hemolymphs, mid-guts (MGs), and Hepatopancreas (HPs) were collected at 3, 6, 12, and 24 hours post-RGF. The hemolymphs were used to evaluate the immune responses, and the MGs and HPs were used to analyze the expressions of immune-related genes (section 2.3). One hundred microlitres of hemolymph were transferred to a 1.5 mL eppendorf tube containing 900 µL anticoagulant (0.34 g EDTA, 0.8 g sodium citrate, and 10 µl Tween 80 in 100 ml of distilled water, at pH 7.45 with the osmolality adjusted to 490 mOsm kg− 1 with NaCl). MGs and HPs were collected separately and immediately immersed in RNAlater (QIAGEN) and stored at − 80 oC until use.
The respiratory burst (RBs) was measured with a modified method from Song and Hsieh (Song and Hsieh 1994) using the reduction of nitroblue tetrazolium (NBT) to formazan as a measure of superoxide anion (O2−) production. RBs was expressed as the amount of NBT reduction in 100 µl of hemolymph using OD at 620 nm.
Based on the modified colorimetric hydroxamate procedure, TG activity was directly measured from hemolymph at 525 nm (Gorman and Folk 1980). Briefly, 50 µL of hemolymph was incubated with 150 µL of Tris-acetate buffer, 12.5 µL of Hydroxylamine hydrochloride 2M, and 37.5 µL of Z-glu-gly at 37ºC for 10 minutes. Then 250 µL of coloring agent (contained 15 g trichloroacetic acid and 5 g iron (III) chloride hexahydrate in 100 mL of ddH2O) was added and centrifuged at 10,000 rpm for 5 min. The supernatant was collected for the measurement of the TG activity.
Finally, lysozyme activity was measured at 450 nm using a suspension of Micrococcus lysodeikticus as a substrate in a reaction mixture (Shugar 1952). Hemolymph (10 µl) was mixed with 200 µl of M. lysodeikticus in PBS (0.02% (w/v)) at 25 oC. The OD reading was recorded with a spectrophotometer every 6 minutes after adding M. lysodeikticus. Lysozyme from white hen egg (Amresco, USA) was used as control.
2.3. Effect of S. radix extract on the immune-related genes
Total RNA was extracted from MGs and HPs using Trizol® reagent (Invitro, USA) according to the manufacturer’s instructions. The RNA samples were suspended in 30µl DECP-treated water and kept at -80ºC until use. Total RNA was qualified and quantified using Biospectrometer (Germany). According to the manufacturer’s instructions, first-strand cDNA was synthesized from 2 µg of total RNA using M-MuLV reverse transcriptase (Lucigen). The cDNA was subsequently stored at − 20°C.
Real-time PCR was performed using the ABI StepOnePlus™ Real-time PCR system (Applied Biosystem, USA). The amplification was performed in a total volume of 10 µl, containing 1 µl of cDNA template, 5 µl of SYBR Premix Ex Taq (Tli RNaseH Plus) (Takara Bio Inc), 0.2 µl of each primer, 0.2 µl of ROX reference dye (50x), and 3.4 µl of DEPC treated water. The real-time PCR program was 95oC for 1 min, followed by 40 cycles of 95oC for the 15s and 60oC for 1 minute. Dissociation and melting curves of amplification products were performed at the end of each PCR to confirm that only one PCR product was amplified and detected. The 2-ΔΔCT method was chosen as the calculation method (Livak and Schmittgen 2001).
Table 1
RT-qPCR primers of immune-related genes
Target genes
|
Genebank
|
Primer
|
Sequence (5’-3’)
|
LGBP (LPS-β-glucan Binding Protein)
|
GQ228481
|
F
|
AGGAACCGGCGGTTTCTT
|
R
|
GGTGTTGGACCAAGGCTTGT
|
PE (Peroxinectin)
|
JN572543.1
|
F
|
CACTGCTGCCTTCCGTTTC
|
R
|
AGGGCTTGTGGATTATTCTG
|
proPO (Prophenoloxidase)
|
AY947400
|
F
|
ACACTGAAGGACATAAGGCGAGAT
|
R
|
AGTAGAGTTCCAAGTCGGAGATGCT
|
Mrß-actin,
|
AY651918.1
|
F
|
CCCGACGGTCACTTGTTC
|
R
|
CGTGGATGCCGCAGGATT
|
2.5. Statistical Analysis
ANOVA (One-way analysis of variance) was applied to evaluate data obtained from the experiments. Multiple comparisons (Duncan test) were conducted to investigate significant differences among treatments using SPSS (version 17, USA). Results were displayed as the mean ± SD, p < 0.05, as the significance level for every test.