Cell culture and reagents
The human leukemia cell lines THP-1, Kasumi were from the Blood Research Laboratory of Qilu Hospital of Shandong University, and fetal bovine serum (LONSERA) and ampicillin and streptomycin were cultured in 1640 medium (Gibco, Los Angeles, California) at 37 ℃. 95% air and 5% CO2 in a humid atmosphere. All cell lines were used within 20 passages. Antibodies against Cdc20 were obtained from Abcam. Antibodies against LC3, p62, cleaved PARP, Akt, p-Akt, P-Erk, Erk and GAPDH were obtained from Cell Signaling Technology. Horseradish peroxidase-linked anti-mouse or anti-rabbit IgG (Nakasugi Golden Bridge).
Cell transfection
Control/Cdc20 shRNAs,pHBLV Control/Cdc20 were obtained from GK gene, transfected with leukemia cells according to the instructions, 24 hours later, the complete medium was used instead of the lentivirus-containing medium, and the appropriate concentration of purine After the mycin selection, PCR and Western blot analysis were performed to verify infection efficiency.
Si-LC3B was obtained from Boshang Bio, according to the manufacturer's instructions, and transfected into leukemia cells using Micropoly Cell transfection reagent at a concentration of 20μM for 48h. The transfection efficiency was verified by PCR.
Cell viability
Cell viability was assessed by the Cell Counting Kit 8 (CCK-8) test. THP-1 and Kasumi cells were seeded into 96-well plates. The indicated concentrations and time points were then treated with cytarabine. 10 μl of CCK-8 reagent was then added to each well and cultured for 4 hours. The relative number of viable cells was determined by measuring the optical density (O.D.) of the cell lysate at 450 nm.
Apoptosis determination
After drug treatment at the specified concentration and time, it was washed twice with PBS. The Annexin V-APC / 7AAD apoptosis detection kit was used to assess the degree of cell apoptosis by flow cytometry. Western blot analysis of c-caspase3, Bcl-2was also performed.
Real-time quantitative PCR
Total RNA was extracted from the cells using TRIzol (Invitrogen). Real-time quantitative PCR (qRT-PCR) experiments were performed using SYBR-Green reagent (Takara Bio Inc., Shiga, Japan) with gene-specific primers for Cdc20 (5'- ACGGTTTTGATGTAGAGGAAGC-3 'and reverse primers, 5'- GATACGGTCTGGCAGGGAAG -3' ) and glyceraldehyde-3-phosphate dehydrogenase (GAPDH forward primer,5' -GAAGGTGAAGGTCGGAGTC-3′ and reverse primer, 5'-GAAGATGGTGATGGGATTTC-3′). Each sample was performed in triplicate, and the control group was set to 1.
Western blot analysis
Collect the cells and lyse them in the protein extraction kit (Beyotime), then use the BCA kit (Beyotime) to determine the protein concentration. An equal amount of cell lysate was separated by SDS-PAGE and transferred to a PVDF membrane(Millipore). The membrane was blocked with 5% skim milk, and then incubated with primary antibodies (1: 1000) overnight, and then incubated with a polyclonal HRP-conjugated secondary antibody (1: 2000) 1 h at room temperature. The film is visualized by enhanced chemiluminescence. GAPDH was used as a loading control.
Transmission electron microscopy
Cells were washed with 0.1 cacodylate buffer (pH 7.4) and fixed with a solution containing 3% glutaraldehyde plus 2% paraformaldehyde in PBS. Subsequently, the rest of the procedure was conducted using the standard protocol. The thin sections were stained with uranyl acetate and lead citrate for observation under hitachi Transmission Electron Microscope .
Reactive oxygen species (ROS)
ROS produced in cells were detected by using ethidium dihydrogen (DHE). DHE can dye superoxide anions (O2 -). After the cells were treated, they were washed twice with ice-cold phosphate buffered saline (PBS), treated with DHE (10-5 M), and incubated at 37℃ for 30 minutes. After probe treatment, cells were washed at least twice with ice-cold PBS. In the vicinity of the excitation wavelength of 535 nm and the emission wavelength of 610 nm, the intracellular ROS level was measured using a flow cytometer.
Pulse tracking analysis
Lentivirus-infected leukemia cells were prepared with cycloheximide (CHX, 20 μM) or CHX (20 μM) plus MG132 (10 μM), and protein lysates were prepared at specified time points. The level of endogenous LC3B protein was detected by Western blot analysis of anti-LC3B Ab, and the results were quantified and normalized to GAPDH.
Statistical analysis
All results were presented as mean ±SD.Paired Sample T tests were used to assess statistically significant differences.Values of p<0.05 were considered as statistically significant.