The change of genetic diversity and isolation-by-distance pattern in Qinling pandas

doi:10.21203/rs.3.rs-1592086/v1

Download PDF

Article

The change of genetic diversity and isolation-by-distance pattern in Qinling pandas

https://doi.org/10.21203/rs.3.rs-1592086/v1

This work is licensed under a CC BY 4.0 License

Version 1

posted

You are reading this latest preprint version

Due to geographic isolation and habitat disturbance, Qinling pandas (Ailuropoda melanoleuca qinlingensis) were divided into six geographical subpopulations in the Fourth National Survey on Giant Pandas. The habitat fragmentation hinders giant pandas’ spread and gene flow and reduces this species’ genetic diversity. Therefore, we aim to investigate whether such geographical demarcation of Qinling panda subpopulations can be reflected on the genetic level. In this study, we conduct a microsatellite analysis with 12 loci based on 90 individuals identified via fecal samples collected from March 2017 to January 2018 in Qinling Mountains. The level of observed heterozygosity (Ho) ranges from 0.330 to 0.898 with a mean Ho of 0.578; the level of expected heterozygosity (He) is between 0.288 and 0.721 with an average value of 0.529. The analysis of isolation-by-distance (IBD) pattern finds genetic distance has a significantly positive correlation with geographic distance in close distance levels (p = 0.001). To conserve the Qinling panda’s genetic diversity, measures need to be taken to help genetic exchanges between different habitat patches, especially for those with very few individuals.

Qinling panda

genetic diversity

genetic structure

isolation-by-distance (IBD)

giant panda conservation

microsatellites

Giant panda (Ailuropoda melanoleuca) is classified as rare, endangered and a flagship species for biodiversity protection in China. Historically, giant pandas were once widely distributed in southwest China, but are only found in six isolated mountain-ranges at eastern edge of the Qinghai-Tibet Plateau^1,2. Wan et al. have shown that giant pandas distributed in Qinling Mountains are morphologically and genetically different from those in other areas, and thus they are recognized as the giant panda Qinling subspecies, a.k.a. the Qinling panda (Ailuropoda melanoleuca qinlingensis)¹. As a subspecies, there are currently about 345 wild Qinling pandas, mainly distributed on the southern slope of Qinling Mountains’ middle section³.

The Qinling panda population was divided into six geographical subpopulations in the Fourth National Survey on Giant Pandas, including subpopulation of Qingmuchuan, Taibaihe, Niuweihe-Sangyuanba, Xinglongling, Tianhuashan-Jinjiliang and Pingheliang. Each subpopulation is entirely or partially isolated with one another because of geographical barriers and/or human disturbance in the habitats. For example, deforestation and agricultural production separate the Pingheliang and Tianhuashan subpopulations; disturbance of National Highway 108 and human activities along the highway divide the Tianhuashan and Xinglongling subpopulations; the agricultural production along the Xushui River impede individuals in Niuweihe habitat connecting with those in the Xinglongling habitat. Besides, the Qingmuchuan subpopulation is geographically far away from the other subpopulation in Qingling Mountains, and thus cannot be connected with other habitat patches in Shaanxi Province⁴. Moreover, the construction of Yangxian-Taibai highway has further exacerbated the habitat fragmentation at the two sides of the highway⁵. The data from the Fourth National Survey on Giant Pandas revealed that there were only 2 individuals in the Qingmuchuan subpopulation and 3 in the Taibaihe subpopulation³. Such small subpopulations could be in acute danger of extinction due to chance demographic factors, inbreeding and well-known consequences^6–10.

To conserve the Qinling panda, its genetic diversity needs to be preserved and protected. As a major component of biodiversity, genetic diversity can reflect a species’ evolutionary potentials and its ability to adapt to changes in living environment. The loss of genetic diversity may reduce fitness of species and increase the risk of species extinction^11,12. Gene flow is a way of maintaining genetic diversity and increasing the likelihood of evolution¹³. Noticeably, human activity, river and road construction have largely blocked connection between subpopulations and have formed habitat fragmentation^5,14,15. It is predictable that Qinling pandas may be facing the threat of low genetic diversity. Previous studies have confirmed that giant pandas in Qinling Mountains had low genetic diversity^16,17, which was ascribed to a population bottleneck¹⁸.

The movement of animals affects genetic diversity through enhancing gene flow¹³ and facilitating range expansion^19,20. For giant pandas, individuals’ movement helps to maintain population viability²¹. Spatially limited dispersal take shape genetic structure of this species and create a correlation between genetic and geographic distance, which is called isolation-by-distance (IBD), a pattern of increased genetic differentiation^22,23. In addition to population genetic diversity, IBD analysis can predict genetic similarity is inversely proportional to geographic distance^23,24. Despite the prevalence of IBD in some species, to date few studies have revealed the relationship within Qinling panda population.

Therefore, we aim to detect whether geographical isolation has any impact on Qinling pandas’ genetic diversity and to what extent the genetic diversity can be reflected by geographic distance. To examine these questions, we have marked the coordinates of Qinling pandas’ feces collected, used the microsatellite marker method to identify individuals via fecal samples, built the IBD model and performed the analysis accordingly.

Sample collection and DNA preparation

The 249 fecal samples were collected from four Nature Reserves located in four counties (Foping, Yangxian, Zhouzhi and Liuba), which are within the Giant Panda National Park in the Qinling Mountains (Fig. 1). The samples were collected from March to May 2017 and from November 2017 to January 2018. The feces were collected within 14 days after excretion. The coordinates of 249 samples were recorded by GPS. The outer layer of the feces which contained mucus were peeled off and stored in ethanol. Genomic DNA was extracted with the QIAampStool Mini Kit (Qiagen), according to the manufacturer’s instructions. The obtained genomic DNA was stored at -20℃.

Microsatellite analysis

As a novel molecular marker, microsatellites can provide fast and inexpensive replicated sampling of the genome with only a few samples²⁵. The 12 microsatellite loci^16,26,27 were selected to analyze the locus polymorphism (Table 1). Primers were labeled fluorescence with 5’- TAMRA, FAM or HEX and synthesized by Sangon Biotech (Shanghai) Co., Ltd.

Table 1

Details of the 12 panda-specific microsatellite markers
Locus	Primer Sequence (5’-3’)	Motif	Product Size (bp)	References
Ame-µ10	F: ACCGTGCTCTTAATCCCCTT R: CCCATGCTTATGAGAAACAGG	(CA)₁₆	131–160	Lu et al [16]
Ame-µ11	F: CTCTTTGCATCTCAAATTCA R: TGAGATAGGAAAGAGTGGGT	(CA)₁₂	108–126	Lu et al [16] Wu et al [27]
Ame-µ13	F: GGAAGCATTAAGGAAAACATGC R: AATGATGACCATTTCAAACGC	(CA)₁₈	136–171	Lu et al [16]
Ame-µ15	F: AAGCAGTTGTTTTTGCTTAGT G R: TGTCAAAGTATTTGCCTCACA	(CA)₁₃	120–130	Lu et al [16]
Ame-µ22	F: AGGAAACATGTTGCCTTTTCA R: AGAGGGCAAATAGGAGGGAA	(CA)₁₁	127–129	Lu et al [16]
Ame-µ24	F: TATTTGTCATGGGGTTTACT R: CCTACCTCACATTCTACTCC	(CA)_n	102–122	Lu et al [16] Wu et al [27]
Ame-µ26	F: TTTTCAGGCCTCCGAAAA C R: ATTCCCAATAAAGCAAATCAG A	(CA)_complex	107–120	Lu et al [16]
Ame-µ27	F: TTTTGCAACTATGTCCCTCAGG R: TTGAAGAAGAAGGAACATTCCC	(CA)₁₂	128–150	Lu et al [16]
AY161179	F: GAGCACTCTTGGGTTTTGTTA R: TGGTGGGCAGGAATGAT	(GT)₂₀	140–160	Wu et al [27] Shen et al [28]
AY161195	F: GCATGAAAGCCAGAAAACAG R: GTAAAGAAGCCAGCCCAACT	(CAA)₁₂	138–150	Wu et al [27] Shen et al [28]
AY161213	F: CCTACCTATTTACCTACTTACCTACC R: GATGCTATTAAGCAACAGAC	(TATC)₁₁	124–132	Shen et al [28]
AY161217	F: CTCATGTGCTCATTCACT R: TAGGGAGAAACAGATACAT	(TATC)₁₀	104–120	Wu et al [27] Shen et al [28]

Modified multi-tubes polymerase chain reactions were performed in a total volume of 10 μL, containing 300 nM forward primers (5’ labelled with TAMRA, FAM or HEX), 300 nM reverse primers, 2 μL genomic DNA, 5 μL multiplex master mix (QIAGEN) and 1 μL BSA (1 μg/μL, MCE). The PCRs were amplified in thermal cycler (Applied Biosystems), beginning with 95℃ for 15 min, followed by 10 cycles consisting of 94℃ for 15 s, 60℃ (decreasing incrementally by 2℃ per two cycles) for 30 s, and 72℃ for 45 s, followed by 25 cycles at 94℃ for 15 s, 50℃ for 30 s, and 72℃ for 45 s, with a final extension at 72℃ for 10 min. Allele sizes were determined by separating the amplification products on an ABI 3730xl DNA Analyser. Fragment length was read by Gene Marker 2.2 (Soft Genetics LLC).

Genetic diversity analysis

Using the program CERVUS 3.0²⁸, the number of alleles per locus (Na), observed heterozygosity (Ho), expected heterozygosity (He), and polymorphic information content (PIC) were calculated. The number of effective alleles was conducted by GenAlEx 6.5²⁹. The linkage disequilibrium was assessed using GENEPOP 3.3, which was used to test F_IS of F-statistics for Hardy-Weinberg equilibrium³⁰.

Genetic structure analysis

The population genetic structure of Qinling giant pandas was analyzed, performed with STRUCTURE v2.3.4(Bayesian metohd)³¹. Ten independent runs were carried out for K = 1–10. The Markov Chain Monte Carlo (MCMC) iterations were set as10⁶ and burn-in iterations were set as 10⁵. The LnP(D) was calculated to identify population clustering. The program POPULATIONS 1.2.30 was used to draw a phylogenetic tree³².

Mantel test for IBD

The Mantel test was employed to verify the IBD model in Qinling giant pandas. A pairwise, individual-by-individual linear geographic distance matrix is generated from coordinates. The genetic distance between individuals was calculated using MSA V4.05³³. The Mantel analysis was performed in GenAlEx 6.5²⁹and the permutation was set as 9999.

Genetic diversity

From 249 fecal samples of giant pandas collected from four counties (Foping, Yangxian, Zhouzhi and Liuba), 94 multilocus genotypes have been obtained with 90 unique individuals being identified (Fig. 1). Parameters of population genetic variability are showed in Table 2.

Table 2

Genetic diversity parameters of Qinling pandas
Locus	Ame-µ10	Ame-µ11	Ame-µ22	AY161217	Ame-µ24	AY161179	AY161195	AY161213	Ame-µ13	Ame-µ15	Ame-µ26	Ame-µ27	Average
N	84	88	87	89	74	50	86	78	83	88	89	88	82.0
Na	7	5	2	4	5	7	5	3	6	3	4	4	4.583
Ne	2.441	3.534	1.762	2.608	2.388	3.027	1.675	1.817	1.778	1.401	3.294	1.762	2.291
Ho	0.702	0.898	0.632	0.876	0.473	0.500	0.500	0.462	0.373	0.330	0.809	0.375	0.578
He	0.594	0.721	0.435	0.620	0.585	0.676	0.405	0.453	0.440	0.288	0.700	0.435	0.529
PIC	0.519	0.671	0.339	0.558	0.538	0.640	0.346	0.381	0.404	0.263	0.638	0.400	0.475
F_IS	-0.191	-0.161	-0.458	-0.417	0.251	0.297	-0.235	0.081	0.222	0.056	-0.156	0.139	-0.048

An average of 82.0 alleles is identified for the 12 microsatellite loci. The mean number of alleles and effective number of alleles are 4.583 and 2.291, respectively. The level of Ho ranges from 0.330 to 0.898 with a mean Ho of 0.578; the level of He ranges from 0.288 to 0.721 with a mean He of 0.529 (Ho > He). The mean number of PIC for the 12 loci is 0.475 with all values higher than 0.2, indicating that all loci were moderately or highly polymorphic. The analysis of microsatellite loci markers finds that the mean Ho and He in the studied Qinling population are greater in comparison with the previous studies (Table 3). However, it is noteworthy that Ho and He may not be directly comparable between studies to reflect the change of genetic diversity as studies use different sample sizes and microsatellite loci.

Table 3

Comparison of He and Ho of Qinling panda population in various studies based on microsatellite markers
Location	Sample size	Number of loci	Na	He	Ho	References
Foping, Zhouzhi, Yangxian, Liuba	90	12	4.58	0.529	0.578	Our study
Foping, Zhouzhi, Yangxian, Taibai, Ningshan, Liuba	178	12	4.60	0.447	0.488	Ma et al.³⁴
Foping	50	12	4.25	0.452	0.435	Zhang³⁵
Yangxian	33	12	4.42	0.439	0.451	Ji³⁶
Foping, Taibai, Lliuba, Yangxian, Fengxian	32	11	3.50	0.486	0.525	Zhang et al.³⁷

Linkage disequilibrium, Hardy-Weinberg equilibrium test

In this study, no significant results are found for linkage disequilibrium test on all loci. The F-statistics shows that these giant pandas present a slight deviation from the Hardy-Weinberg equilibrium balance (F_IS = -0.048, Table 2), which indicates that individuals in this population are less related than expected under a model of random mating. Six out of the 12 loci, i.e. Ame-µ10, Ame-µ11, Ame-µ22, AY161217, AY161195 and Ame-µ26 have F_IS value lower than − 0.1, suggesting an excess of heterozygote.

Genetic structure

LnP(D) analysis shows that the most likely number of clusters is K = 1 (Fig. 2), indicating there is no genetic differentiation in these Qinling pandas.

To further confirm the accuracy of the population structure, a phylogenetic tree of giant panda individuals is constructed as shown in Fig. 3. In the adjacency tree constructed based on allelic distance between individuals, 90 individuals from four Nature Reserves are mixed together and no Qinling panda from one Nature Reserve are found to be an independent branch. The results indicate that the Qingling pandas in these subpopulations belong to one population.

IBD pattern

The Mantel test reflects genetic structure of the study area. For IBD pattern, the Mantel test performed in GenAlEx 6.5 finds a significant positive correlation at (p < 0.01) level between genetic distance and geographic distance in close distance classes of our study area (< 1 km).

The results of genetic analysis find a mean multilocus Ho of 0.578 and a mean He of 0.529 for 90 identified Qinling pandas. Although these values are greater than those in previous studies, this does not directly comparable between studies and necessarily mean that the genetic diversity of Qinling pandas has increased. This is because the number of microsatellite and sample sizes we used is different from those in previous studies.

He, namely the expected heterozygosity, refers to the proportion of expected heterozygous genotypes under Hardy-Weinberg equilibrium³⁸. It is a common statistic for evaluating genetic variation within population. When the total number of genes to be examined is fixed, the number of loci and individuals matter to estimate the average He³⁹. Ho, the observed heterozygosity, refers to the ratio of the number of observed heterozygous individuals to total number of sample individuals. Higher level of heterozygosity indicates greater genetic diversity of the species. Compared to studies^16,34,37, we find more microsatellite alleles variants. Besides, all studies differentiated in sample sizes and sampling locations. Therefore, it cannot be directly concluded that the genetic diversity of Qinling panda has grown.

However, the Na, Ho, and He value gained (Table 3) may suggest that the genetic diversity of Qinling panda is not low. Our study makes use of 12 microsatellites to conduct the genetic analysis. The Ho is found greater than the He, suggesting that the population has not been significantly affected by inbreeding. This pattern is similar to previous studies on the Qinling pandas^34,36,37, but different from Zhang³⁵, in which Ho < He. The difference may be mainly due to the variation of sampling locations - we collected samples in four counties whereas Zhang only sampled in Foping Natural Reserve.

Furthermore, compared to the previous studies which found low genetic diversity of Qinling panda^17,18 [17, 18], this study utilized microsatellite markers. Microsatellites, as co-dominant and highly polymorphic molecular markers, have basically replaced other markers in ecology and evolution research⁴⁰, and outstand in the field of population genetic analysis as the most effective molecular markers⁴¹. The genetic richness of Qinling panda is influenced by the sensitivity of molecular markers. The microsatellite markers used in this study are found higher than that of isozyme markers (e.g. used in Ref.[18]) ⁴².

The possible changes in genetic diversity may come from the increase of the population size. Neutral theory predicts that there is a positive correlation between genetic diversity and effective population size⁴³. According to the National Survey on Giant Pandas³, the number of Qinling pandas has increased from 275 (the third survey) to 345 (the fourth survey), and thus there is an increase reflected on the values.

Another fact worth mentioning is that the overall level of genetic diversity in Qinling panda population presents to be lower compared to four extant mountain populations (Qionglai, Liangshan, Daxiangling and Xiaoxiangling) in Sichuan Province^37,44,45. In small populations, random genetic drift tends to reduce genetic variability and may eventually form a homozygosity in the population. In our study, some microsatellite loci present homozygous in samples from Liuba County. Because of habitat fragmentation in Qinling Mountains, very limited Qinling panda individuals are found in some habitat patches such as Qingmuchuan subpopulation (2), Taibaihe subpopulation (3) and Pingheliang subpopulation (7)³. Whether these subpopulations have undergone genetic drift is unknown. Therefore, continuing to pay attention to the relationship between population size and genetic diversity of Qinling pandas is one of the priorities in the future.

The study also finds that Qinling pandas in the country are genetically related (data unpublished). Estimation of He will be less accurate and precise when individuals are related or inbred, owing to increased dependence among allele copies in the sample⁴⁶. Also, as we cannot determine the gender of all individuals, the parentage relationship has not been estimated. To date, the genetic relationship of wild Qinling pandas is lack of study and research addressing this issue is expected.

In this study, F_IS value shows that these Qinling pandas presented a slight deviation from the Hardy-Weinberg equilibrium balance (F_IS = -0.048). F_IS values reflect deviation from Hardy-Weinberger equilibrium genotype frequencies and indirectly reflect relative population heterozygosity. The 6 of the 12 loci have F_IS value lower than − 0.1, suggesting an excess of heterozygosity. Zhang showed that 4 loci exhibit heterozygous excess³⁵. Ji ³⁶ also found two loci deviated significantly from the Hardy-Weinberg balance at (p < 0.01) level, and two loci deviated significantly from the Hardy-Weinberg balance at (p < 0.05) level. The deviating loci do not show insufficient heterozygosity, indicating that the Qinling pandas have not been affected by inbreeding. The habitat changes have hindered genetic communication between individuals, which may be the reason why the Qinling pandas deviated from the Hardy-Weinberg equilibrium.

Geographical isolation may lead to population genetic drift and reduce gene flow. The reduction of gene flow will lead to genetic differentiation between groups, resulting in the decline or even loss of genetic diversity of isolated small populations. As aforementioned, the Pingheliang and Tianhuashan habitats are isolated due to deforestation and agricultural production; the habitats of Tianhuashan and Xinglongling are isolated due to the disturbance of national highway 108 and human activities along the national highway; the agricultural production along the Xushui River has led to the isolation of the Niuweihe habitat from the Xinglongling habitat; the Qingmuchuan habitat is far away from several habitats of the Qinling Mountains, and cannot be connected with other habitat patches in Shaanxi⁴; the construction of Yangxian-Taibai highway has further exacerbated the habitat fragmentation at the two sides of the highway⁵. Based on geographic isolation, habitat disturbance and natural roads, the Fourth National Survey on Giant Pandas has suggested that the Qinling giant panda population is composed of six subpopulations³. Moreover, since the Third National Survey on Giant Pandas, the number of tourist attractions in the main distribution area and the surrounding areas of giant pandas has increased significantly, which has caused a significant threat to the giant panda habitat⁴⁷. Although the number of Qinling pandas as well as habitat areas have increased since the third national survey, the threat to population development, population fragmentation and increased genetic pressure have not been removed⁴⁷.

Geographically restricted gene flow forms genetic structure in which IBD is generated. IBD occurs in two cases. One is a continuously distributed population in which dispersal of germ cells and/or oosperms is spatially restricted, and the other is subdivided populations in which the speed of gene exchange between subpopulations depends on the distance⁴⁸.

The development of genetic structure in different IBD models can be described by Whight’s theoretical analysis of IBD^22,49,50. IBD analyses may help understand the influence of population history which is different from persistent gene flow.On the other head, it can also test the credibility of different dispersal pathways⁵¹. Besides, the effect of geographic features or specific life-history traits on population differentiation can also be examined⁵². The Mantel test provides a approach to calculate the correlation between distance matrices⁵³ and has been widely used in ecological and evolutionary studies. In this study, Mantel test found genetic distance and genetic distance are positively correlated (p = 0.001). This echoes with Ma et al.³⁴. One reason for the result may be the dispersal mode of Qinling pandas. It is therefore indicated that the division of subpopulations in the fourth survey make sense for Qinling pandas. However, since the gender of wild giant pandas was not completely identified, our study does not have data for spatial autocorrelation analysis of giant pandas of different genders. It is also important to study the relationship between gender and IBD in the future.

For the propose of Qinling panda’s genetic diversity conservation, it is important to enhance the genetic exchange between different habitat patches in the Qinling Mountains. Subpopulations with very limited individuals (such as Qingmuchuan and Taibaihe population) should be given particular attentions.

To conclude, this study conducts microsatellite analysis based on 90 Qinling pandas and finds an average Ho of 0.578 and He of 0.529. A significantly positive correlation between genetic distance and geographic distance in close distance levels has been found. The IBD pattern of the Qinling panda studied has been identified. The results suggest that, for the propose of genetic diversity conservation, the measures should be taken to keep increasing the genetic exchange of Qinling pandas, particularly for the subpopulations with only a few giant pandas.

Acknowledgments: We wish to thank Fuwen Wei, Yibo Hu, Kang Huang and Rui Mi for experimental technical guidance and useful suggestions on the software. We are grateful to the reserve staff for collecting panda fecal samples.

Author Contributions: X.J. conceived the study. J.H. wrote the manuscript. J.H., S.H. and F.L. genomic DNA extracted, PCR amplificated and data analyzed. Q.Z. made charts. X.Z. fecal samples collected. X.J. and J.H. examined the data. This research was jointly funded by the Shaanxi Academy of Science, China, grant number 2017K-16; National Forestry and Grassland Administration, grant number Y18D013G18 and Shaanxi Academy of Forestry, grant number SXLK2021-0220. The APC was funded by the Shaanxi Academy of Science, China.

Data Availability Statement: The data presented in this study are available on request from the corresponding author.

Competing interests: The author(s) declare no competing interests.

] Wan, Q. H., Wu, H. & Fang, S. G. A new subspecies of giant panda (Ailuropoda melanoleuca) from Shaanxi, China. J Mammal 86, 397-402 (2005).
Hu, J. The biological studies of the giant panda. Journal of China West Normal University (Natural Sciences) 2, 4-12 (1987).
Tang, X. et al. Scheme Design and Main Result Analysis of The Fourth National Survey on Giant Pandas. Forest Resources Management 1, 11-16 (2015).
Tian, L. et al. Current situation of panda and their habitat conservation in Qinling Mountains. Journal of Northwest Forestry University 24, 114-117 (2009).
Zeng, Z. et al. Impact of Yangxian-Taibai Highway on the Movement of Giant Panda in the Qinling Mountains and Its Habitat Protection. Journal of Northwest Forestry University 24, 88-93 (2009).
Obrien, S. J. & Knight, J. A. The Future of the Giant Panda. Nature 325, 758-759 (1987).
Obrien, S. J. A Role for Molecular-Genetics in Biological Conservation. P Natl Acad Sci USA 91, 5748-5755 (1994).
Obrien, S. J. Genetic and Phylogenetic Analyses of Endangered Species. Annu Rev Genet 28, 467-489 (1994).
Saccheri, I. et al. Inbreeding and extinction in a butterfly metapopulation. Nature 392, 491-494 (1998).
Soule, M. E. & Mills, L. S. Population genetics - No need to isolate genetics. Science 282, 1658-1659 (1998).
Wildt, D. E. et al. Reproductive and Genetic Consequences of Founding Isolated Lion Populations. Nature 329, 328-331 (1987).
Amos, W. & Balmford, A. When does conservation genetics matter? Heredity 87, 257-265(2001).
Slatkin, M. Gene Flow and the Geographic Structure of Natural-Populations. Science 236, 787-792 (1987).
Fan, J. et al. Impact of Yangxian-Taibai Highway on landscape pattern of giant panda's habitat. Chinese Journal of Ecology 28, 2082-2087 (2009).
Zhao, W. Study on the habitat of giant panda along Xushuihe River in the Qinling Mountains. Master Thesis, Northwest A&F University, 52 pp (2010).
Lu, Z. et al. Patterns of genetic diversity in remaining giant panda populations. Conserv Biol 15, 1596-1607 (2001).
Zhang, Y. P. et al. Genetic diversity and conservation of endangered animal species. Pure Appl Chem 74, 575-584 (2002).
Su, B. et al. Genetic Diversity in the Giant Panda - Evidence from Protein Electrophoresis. Chinese Sci Bull 39, 1305-1309 (1994).
Lubina, J. A. & Levin, S. A. The Spread of a Reinvading Species - Range Expansion in the California Sea Otter. Am Nat 131, 526-543 (1988).
Kokko, H. & Lopez-Sepulcre, A. From individual dispersal to species ranges: Perspectives for a changing world. Science 313, 789-791 (2006).
Zhan, X. J. et al. Molecular analysis of dispersal in giant pandas. Mol Ecol 16, 3792-3800 (2007).
Wright, S. Isolation by Distance under Diverse Systems of Mating. Genetics 31, 39-59 (1946).
Wright, S. Isolation by distance. Genetics 28, 114-138 (1943).
Hutchison, D. W. & Templeton, A. R. Correlation of pairwise genetic and geographic distance measures: Inferring the relative influences of gene flow and drift on the distribution of genetic variability. Evolution 53, 1898-1914 (1999).
Selkoe, K. A. & Toonen, R. J. Microsatellites for ecologists: a practical guide to using and evaluating microsatellite markers. Ecol Lett 9, 615-629 (2006).
Wu, H. et al. Thirty-three microsatellite loci for noninvasive genetic studies of the giant panda (Ailuropoda melanoleuca). Conserv Genet 10, 649-652 (2009).
Shen, F. J. et al. Enrichment of Giant Panda Microsatellite Markers Using Dynal Magnet Beads. Acta Genetica Sinica 32, 457-462 (2005).
Marshall, T. C., Slate, J., Kruuk, L. E. & Pemberton, J. M. Statistical confidence for likelihood-based paternity inference in natural populations. Mol Ecol 7, 639-655 (1998).
Peakall, R. & Smouse, P. E. GenAlEx 6.5: genetic analysis in Excel. Population genetic software for teaching and research--an update. Bioinformatics 28, 2537-2539 (2012).
Raymond, M. & Rousset, F. Genepop (Version-1.2) - Population-Genetics Software for Exact Tests and Ecumenicism. J Hered 86, 248-249 (1995).
Pritchard, J. K., Stephens, M. & Donnelly, P. Inference of population structure using multilocus genotype data. Genetics 155, 945-959 (2000).
Langella, O. Populations 1.2.30: population genetic software (individuals or populations distances, phylogenetic trees). Network, doi: http://www.bioinformatics.org/〜tryphon/populations/ (2007).
Dieringer, D. & Schlotterer, C. MICROSATELLITE ANALYSER (MSA): a platform independent analysis tool for large microsatellite data sets. Mol Ecol Notes 3, 167-169 (2003).
Ma, T. et al. Walking in a heterogeneous landscape: Dispersal, gene flow and conservation implications for the giant panda in the Qinling Mountains. Evolutionary applications 11, 1859-1872 (2018).
Zhang, D. L. Analysis of genetic diversity of wild giant panda population in Qinling Mountains. Master Thesis, China West Normal University, 55 pp (2019).
Ji, J. F. Microsatellite Analysis about Genetic Diversity of Giant Panda in Liangshan and Qinling Mountains. Master Thesis, Guangxi Normal University, 40 pp (2014).
Zhang, B. et al. Genetic viability and population history of the giant panda, putting an end to the "evolutionary dead end"? Molecular biology and evolution 24, 1801-1810 (2007).
Nei, M. Analysis of gene diversity in subdivided populations. Proc Natl Acad Sci U S A 70, 3321-3323 (1973).
Nei, M. & Roychoudhury, A. K. Sampling variances of heterozygosity and genetic distance. Genetics 76, 379-390 (1974).
Desalle, R., Schierwater, B. The use of microsatellites for genetic analysis of natural populations - a critical review 1st edn, 71-86 (Birkhäuser Press, 1998).
Balloux, F. & Lugon-Moulin, N. The estimation of population differentiation with microsatellite markers. Mol Ecol 11, 155-165 (2002).
Miao, Y., Li, D., Huo, J. & Zhang, C. A review on genetic diversity and origin of Chinese buffalos. China Cattle Science 34, 16-20 (2008).
Kimura, M. The neutral theory of molecular evolution. 1 st edn, 149-304 ( Cambridge University Press, 1983).
Hu, Y. B., Zhan, X. J., Qi, D. W. & Wei, F. W. Spatial genetic structure and dispersal of giant pandas on a mountain-range scale. Conserv Genet 11, 2145-2155 (2010).
Zhu, L. F., Zhang, S. N., Gu, X. D. & Wei, F. W. Significant genetic boundaries and spatial dynamics of giant pandas occupying fragmented habitat across southwest China. Mol Ecol 20, 1122-1132 (2011).
Lande, R. Genetics and Demography in Biological Conservation. Science 241, 1455-1460 (1988).
Nan, X., Wang, R. & Zhang, X. The status quo and conservation management planning of giant panda (Ailuropoda melanoleuca) population and habitat in Qinling Mountains, Shaanxi Province. Chinese Journal of Wildlife 42, 663-674 (2021).
Hardy, O. J. & Vekemans, X. Isolation by distance in a continuous population: reconciliation between spatial autocorrelation analysis and population genetics models. Heredity 83, 145-154 (1999).
Maruyama, T. Analysis of population structure. II. Two-dimensional stepping stone models of finite length and other geographically structured populations. Annals of human genetics 35, 179-196 (1971).
Maruyama, T. Rate of decrease of genetic variability in a two-dimensional continuous population of finite size. Genetics 70, 639-651 (1972).
Slatkin, M. Ecological genetics. Real LA edn, 3-17 (Princeton University Press, 1994).
Bohonak, A. J. IBD (Isolation by Distance): a program for analyses of isolation by distance. J Hered 93, 153-154 (2002).
Jackson, D. A. & Somers, K. M. Are Probability Estimates from the Permutation Model of Mantel Test Stable. Can J Zool 67, 766-769 (1989).

No competing interests reported.

Download PDF

Version 1

posted

You are reading this latest preprint version

The change of genetic diversity and isolation-by-distance pattern in Qinling pandas

Status:

Version 1

Abstract

Figures

Introduction

Materials And Methods

Sample collection and DNA preparation

Microsatellite analysis

Genetic diversity analysis

Genetic structure analysis

Mantel test for IBD

Results

Genetic diversity

Linkage disequilibrium, Hardy-Weinberg equilibrium test

Genetic structure

IBD pattern

Discussion

Conclusions

Declarations

References

Additional Declarations

Status:

Version 1