Development of Agrobacterium-mediated in planta transformation method through coleoptile in rice

doi:10.21203/rs.3.rs-1595128/v1

Download PDF

Research Article

Development of Agrobacterium-mediated in planta transformation method through coleoptile in rice

https://doi.org/10.21203/rs.3.rs-1595128/v1

This work is licensed under a CC BY 4.0 License

Version 1

posted

You are reading this latest preprint version

Genetic modification of rice is mainly carried out by Agrobacterium-mediated transformation of callus accompanied by tissue culture. It is time consuming, laborious and useless for cultivars that are unable to induce callus. In this paper, we report a novel gene transfer to pull out primary leaf followed by infection of shoot apical meristem in the coleoptile with Agrobacterium tumefaciens EHA105 culture harboring pCAMBIA1301-RD29A-AtDREB1A. Primary leaves were pulled out from rice seedlings grown in Petri dishes and soil conditions, and Agrobacterium culture were injected into the coleoptile with a micro syringe. Treated plants were co-cultured in dark condition for 48 hours and washed. These plants were regenerated into transgenic plants, and the transgene was transferred to the next generation, the transgenic plants exhibited tolerance to cold stress. This gene transfer through rice coleoptile is a simple, efficient and cultivar-free method that does not require tissue culture.

gene transfer

AtDREB1A

cold stress

coleoptile

rice

tolerance

We developed a novel gene transfer method to pull out primary leaf followed by infection of shoot apical meristem in rice coleoptile with Agrobacteriumtumefaciens EHA105 culture.

Rice (Oryza sativa L.) is a major crop plant consumed by more than half of the world's population and it is estimated that 40% more rice would be needed to meet the demand by 2030 (Khush and G.S. 2005). In order to increase food production, it is important to breed superior cultivars as well as to develop cultivation technology. Genetic modification of rice is mainly carried out by co-culture of callus with Agrobacterium, which essentially involves the tissue culture stage. However, regeneration through tissue culture in plants is time-consuming, laborious, possible only in specific species, and cause unintended changes to the genome and epigenome (Phillips et al., 1994, Zhang et al., 2014). Hence, gene transfer method independent of tissue culture has been widely developed (Maher et al., 2019; Alok et al., 2016; Raghavendra et al., 2019).

In most gene transfer independent of tissue culture, plants were regenerated from Agrobacterium-treated embryos (Zuraida et al., 2010; Zuraida et al., 2011). Tasnim et al. (2018) regenerated plants from mature embryos treated with Agrobacterium culture harboring Pea DNA Helicase 45 gene (PDH45) in Indica rice unable to induce callus. Xueqing et al. (2019) reported that transformation efficiency increased when immature embryos of maize were treated with Agrobacterium culture fluid followed by co-culture on dry filter paper. Rakesh et al. (2019) conducted a study to transform the embryos of spring bread wheat with Agrobacterium tumefaciens strain EHA105 harboring pCAMBIA3301 binary vector carrying bar and gus genes as markers. Ren et al. (2008) reported histochemical staining on nearly whole embryo tissue when the GUS gene was introduced into immature embryos of Indica rice by electroporation.

Embryo is considered to be the primary tissue of the plant and to have conditions for being a gene recipient. An important tissue in the growth of plants from embryos is shoot apical meristem (SAM), in which precursors of plant organs, including leaves and flowers, are already present, and organogenesis is mediated by different signal transductions during development (Barton et al.,2010). So far, many studies on introduction of foreign genes into shoot apical meristem have been reported. Wen-fang et al. (2018) reported 0.125% of transformation efficiency when shoot apices of cotton plants unable to induce callus were treated with EPSPS gene-bearing Agrobacterium culture. Alok et al .(2016) found that transgenic tropical maize plants could be obtained 75–90 days after young meristem cells of germinating seeds were infected with Agrobacterium tumefaciens EHA105 harboring pCAMBIA3301 carrying cry1Ab gene.

Improving cold tolerance in rice may allow to increase cultivation area northward and to reduce the amount of farming materials including plastic sheets. It has been reported that constitutive overexpression of the rice or maize DREB1A gene may regulate expression of downstream target genes associated with cold tolerance in model plant Arabidopsis (Dubouzet et al., 2003). Dubouzet et al. (2003) reported that OsDREB1A, OsDREB1B, and OsDREB1F genes are cold-stress responsive genes in rice, and that Arabidopsis and rice plants overexpressing the OsDREB1 gene strongly activate transcription of some stress-responsive genes, thereby increasing tolerance to low temperature, dehydration, and salt stress. While the introduction of OsDREB1 genes in rice has been reported to enhance cold tolerance (Dubouzet et al., 2003; Wang et al., 2008), the expression of AtDREB1A gene in rice to enhance cold tolerance has not been reported.

The aim of this study is to (i) develop a gene transfer method to inject Agrobacterium culture into shoot apical meristem inside the primary leaf-drawn coleoptile followed by co-cultivation and regeneration of plant, (ii) to transfer AtDREB1A gene into rice to breed cold-tolerant cultivars that can be cultivated in the seedling stage without plastic sheeting. The strain of Agrobacterium tumefaciens EHA105 harboring the AtDREB1A transgenic vector (pCAMBIA1301-RD29A- AtDREB1A) harboring β-glucuronidase gene (GUS) as a reporter was used. Treated shoots were regenerated into plants and after all, transgenes transmitted to the progeny. Transgenic plants exhibited significant cold tolerance and yield losses were not recorded.

2.1 Agrobacterium preparation

Single colonies of A. tumefaciens EHA105 harboring pCAMBIA1301-RD29A- DREB1A (Supplement 1) were cultured in 2 ml of LB medium containing 50 mg/L kanamycin and 30 mg/L rifampicin at 30°C for 48 h. 20µL of the culture was inoculated into LB medium containing antibiotics and incubated until A₆₀₀ = 0.8-1.0. After centrifugation at 5000 rpm for 2 min, the pellet was suspended into 2 ml of 10 mM AAM medium supplemented with 100µM acetosyringone and incubated at 30°C for 1 h. The suspension was diluted in distilled water to make a series with A₆₀₀ = 0.2 to 1 (0.2 intervals) and used.

2.2 Transformation and plant regeneration

Transformation was carried out in two ways. Mature rice grains from Japonica rice cultivar “Phyongdo 19” were soaked in water for 24 h, placed on moistened filter paper in petri dishes and germinated in a dark condition (26°C). After the primary leaves were drawn from the coleoptile of rice seedlings, 20µL of Agrobacterium culture was injected with a sterile microsyringe. After co-cultivation for 48 h in the dark condition, 20µL of MS medium supplemented with 300 mg/L cefotaxime was injected with a microsyringe and incubated for 10 min to remove residual bacterium. The seedlings were transferred to pots, grown under greenhouse conditions and regenerated into rice plants. Next, in order to verify whether genetic modifications can be introduced to seedlings grown under soil conditions, Agrobacterium culture was injected into soil-grown seedlings following above method and regenerated into rice plants.

2.3 Histochemical analysis

After injection of Agrobacterium culture through coleoptile, histochemical analysis to detect transient expression of the GUS gene was performed as following. T₀ seedlings were immersed in 0.1 mol/L sodium phosphate buffer (pH 7.0) containing 1 mg/mL X-glucuronic acid (AMRESCO), 0.5 mmol/L K₃[Fe(CN)₆], 0.5 mmol/L K₄[Fe(CN)₆], 10 mmol/L Na₂EDTA, 0.1% (V/V) Triton X-100 and 10% (V/V) methanol and incubated overnight at 37°C. After incubation, the samples were observed under a stereomicroscope (Olympus).

2.4 hpt and DREB1A gene detection

Genomic DNA was extracted from leaves of putative transgenic/genome editing plants by the CTAB method (Murray and Thompson, 1980).

Primers specific to hpt (hygromycin phosphotransferase) gene (forward: TCCGGAAGTGCTTGACATT, reverse: GTCGTCCATCACAGTTTGC) were used. PCR was performed in a Mastercycler apparatus on each sample in 20µL reaction volumes containing 2µL 10 x buffer, 0.4µL 10 mM dNTPs, 2µL 25 mM MgCl₂, 1µL primer, 0.4µL 0.1 U/µL Taq polymerase, 1µL template DNA, 13.2µL ddH₂O. PCR conditions were as follows: an initial denaturation at 94°C for 5 min, 30 cycles of denaturation at 94°C for 30 s, annealing at 55°C for 1 min, and chain extension at 72°C for 90 s, followed by a final chain extension at 72°C for 10 min.

Primers specific to the DREB1A gene (forward: TAAGCTTCTTCTGATCAATGAACTCATTCTGC, reverse: AGAATTCCTGAAACTGAATCAATTTAATTTAC) were used.

PCR was performed in a Mastercycler apparatus on each sample in 20µL reaction volumes containing 2µL 10 x buffer, 2µL 10 mM dNTPs, 2µL 25 mM MgCl₂, 1µL primer, 0.1µL 0.1 U/µL Taq polymerase, 1µL template DNA, 11.9µL ddH₂O. PCR conditions were as follows: an initial denaturation at 94°C for 5 min, 35 cycles of denaturation at 94°C for 30 s, annealing at 56°C for 1 min, and chain extension at 72°C for 90 s, followed by a final chain extension at 72°C for 10 min. Amplified fragments were run in 1% agarose gel at 80 V for 40 min in 1 x TAE buffer. After the gel was stained with ethidium bromide, it was observed by gel scanner (Geldoc-ItTM).

2.5 Expression analysis of AtDREB1A gene in T₂ rice plants

The surface-sterilized T₂ progeny seeds were germinated and grown on MS medium supplemented with hygromycin at a concentration of 100 mg/l at 27°C in darkness for a week, transferred into soil pots with a 3:1 mixture of field soil to soddy soil, and then grown in controlled environmental chambers at 27°C with a 14-h photoperiod of 4000 lx. The cold tolerance assay was conducted according to Lili et al. (2017). Cold stress treatment on the control plants and 25- day-old seedlings of the T₂ rice plants expressing OsDREB1A driven by rd29A promoter was carried out with 4°C. The tolerance assay was performed from three replications, and 20 seedlings were used for each line in each replication. The data was analyzed by SPSS 19.0.

Total RNA from transgenic and WT rice seedlings exposed to 4°C for 0, 3, and 6 h was isolated, then reversely transcribed. First-strand cDNAs were used as a template of real-time quantitative PCR amplification using a CFX96 Touch™ Real-Time PCR Detection System (Bio-Rad, Hercules, CA, USA). The primers for amplification were 5′-GGTCGTACCCAAGGTAATGT-3′ and 5′-TGAATGAGTAACCACGCTCC-3′ for actin. Relative messenger RNA (mRNA) levels were quantified based on Lili et al. (2017). The expression level of actin was made as a reference to normalize all data. For the OsDREB1A gene, the relative mRNA level of the transgenic rice line (LR05) under non-stress condition was set to one. The gene expression experiments were performed in triplicate and the mean was taken to eradicate discrepancies.

2.6 Determination of physiological and biochemical factors associated with cold tolerance

Twenty-five-day-old seedlings from transgenic and WT rice plants were treated as above mentioned. Their leaf samples were gathered from each plant to examine following five physiological or biochemical factors (soluble sugars content, free proline content, chlorophyll content, methane dicarboxylic aldehyde (MDA) content, the electrolyte leakage rate) involved in cold tolerance. Above 5 indices were determined as reported previously (Lili et al. 2017). The biochemical or physiological results were displayed as relative levels, namely the values of WT seedlings without cold treatment were quantified to one, and the remaining data were compared with it.

3.1 Agrobacterium culture infection through primary leaf-drawn coleoptile

First, we established methods to draw primary leaves from rice seedlings grown in Petri dishes and soil conditions (Fig. 1). Six days-old seedlings grown in a dark condition had primary leaves around 0.3 cm out of the coleoptile and primary leaves were drawn successfully in 85.8% of seedlings. Four days-old plants were fragile so that primary leaves were unable to be drawn, and for eight days-old plants, growth point as well as primary leaves were drawn. For soil-grown seedlings primary leaves were drawn easily when those were 0.8–1.3 cm out of coleoptile. At earlier ages, primary leaves were not drawn easily, and at later ages, coleoptile tended to be destroyed when primary leaves were drawn. On the other hand, when primary leaves were drawn when they were 0.8–1.3 cm out of coleoptile, top part of the coleoptile got dry and closed about 30 minutes later, thus providing a favorable condition for long activity of Agrobacterium culture.

To determine the concentration of Agrobacterium culture suitable for transformation, Agrobacterium culture of different concentration were injected into primary leaf-drawn coleoptile and the transformation rate was investigated. The rate of GUS positive plants increased as concentration of Agrobacterium culture increases until A₆₀₀ = 0.6 and decreased when A₆₀₀ increases above 0.6. When A₆₀₀ = 0.6, the rate of survival plants was 33.9% and the rate of GUS positive plants was 83.3%, the highest among the five treatments.

3.2 Gene transfer through rice coleoptile, transmission to the progeny

As shown in Fig. 2a, meristem showed blue staining spots by transient expression of the GUS gene since one day after Agrobacterium injection, indicating that the GUS gene could be inserted in the genome of meristem cells and expressed when Agrobacterium culture was injected through coleoptile.

The results of PCR using 2 pairs of primers specific to hpt gene and DREB1A gene as a temple of DNA extracted from 25 flag leaves of T₀ plants that survived after injection of Agrobacterium culture are shown in Fig. 2b. Here, sample 3, 4, 7, 8, 12, 18, 23, 25 and positive control plants exhibited the expected size of around 811bp corresponding to DREB1A gene, but negative control and control cultivar exhibited no DNA fragments. This suggests that the DREB1A gene can be stably integrated into the genome of T₀ plants. PCR analysis of 25 plants that survived among 95 plants infected with A. tumefaciens EHA105 (pCAMBIA1301-RD29A-DREB1A) by coleoptile injection exhibited 32% of PCR positive plants ratio and 8.4% of transformation efficiency. T₂ plants grown from seeds of DREB1A -positive plants were tested for GUS histochemical staining and DREB1A gene transmission at the young seedling stage (Fig. 2c).

3.3 Selection of elite plants according to phenotypic indices in T₁ generation

In order to select plants with superior phenotypic traits, eight DREB1A transgenic plants from T₀ were transplanted into the field, and the number of panicles, number of grains per panicle, and 1000-grain weight were compared (Table 1). None of T₁ plants exhibited growth retardation; especially ‘number 7’ and ‘number 18’ plants were selected because of their significantly higher number of panicles per plant and number of grains per panicle compared to the control “Phyongdo 19”.

Table 1

Phenotypic indices of *DREB1A* transgenic individuals
Indices ID	heading date	number of panicles per plant	height /cm	panicle length /cm	number of grains per panicle	1000-grain weight
control	8/2 ~ 8/10	9.1 ± 1.1	76.5 ± 1.3	20.3 ± 1.7	100 ± 13	32 ± 1.3
3	8/3	7	72	22	90	29.5
4	8/5	7	81	17	95	30
7	8/2	11	83	21	124	28
8	8/8	8	80	19	110	30
12	8/3	10	79	20	120	26.7
18	8/2	12	83	24	173	29
23	8/7	8	78	20	120	27.9
25	8/3	9	80	22	105	27
27	8/5	8	80	22	105	27
Transplanted on May 29th

3.4 Expression of AtDREB1A gene under cold stress in T₂ plants

Five cold stress-related parameters (liquid electrolyte leakage rate, chlorophyll, MDA, free proline and soluble sugar content) were evaluated in control and T₂ plants under both normal and cold stress conditions (Fig. 3. a-e). Under normal conditions, there were no significant differences in cold stress-related parameters between control and transgenic plants, but under cold stress, there were significant differences in expression levels. Under cold conditions, the transgenic plants had significantly higher free proline, soluble sugar and chlorophyll content than the control plants, while liquid electrolyte leakage and MDA showed significantly lower levels than the control plants (P < 0.05). This suggests that expression of AtDREB1A in rice promotes the accumulation of free proline and soluble sugars, reduces electrolyte leakage and MDA levels, and maintains a higher level of chlorophyll content compared to control plants under low temperature stress. On the other hand, quantitative real-time PCR results indicate that the expression of the AtDREB1A gene in transgenic plants contributes to cold tolerance.

3.5 Characteristics of AtDREB1A transgenic T₂ plants

We compared the growth characteristics of young seedlings of AtDREB1A transgenic plants 7–9, 12 − 3 and 18 − 6 with those of the “Phyongdo19” in non-coated field to verify how to response to cold stress.

Table 2

Young seedling growth characteristics of *DREB1A* transgenic plants at low temperature
indices ID	shooting rate/ %	shoot height / ㎝	Number of shoot leaf	Number of shoot roots	shoot root length
“Phyongdo19”	0.0	0.4 ± 0.0	0.0 ± 0.0	0.0 ± 0.0	0.2 ± 0.0
7–9	89.0	7.5 ± 0.5*	1.2 ± 0.2*	2.0 ± 0.2*	3.7 ± 0.3*
12 − 3	91.1	5.7 ± 0.2*	1.2 ± 0.2*	2.3 ± 0.2*	4.1 ± 0.4*
18 − 6	93.5	8.9 ± 0.4*	1.5 ± 0.4*	2.7 ± 0.3*	4.3 ± 0.2*
temperature: 5℃, n = 10, *P༜0.05

As shown in Table 2 and Fig. 4, under low temperature (7°C), the seedling growth characteristics of the DREB1A gene transgenic plants were remarkably better than those of the control cultivar “Phyongdo19”, including seedling height, leaf number, root number and root length. That is, the transgenic plants maintained normal growth, although growth of control cultivar plants was almost inhibited. This indicates that the transgenic lines 7–9, 12 − 3, and 18 − 6 are highly tolerant to low temperature compared to the control cultivar. In particular, among 3 transgenic lines, 18 − 6 showed the best trend for all growth parameters. Because control cultivar could hardly survive under low temperature conditions due to the significant inhibition of seedling growth, we compared the yield components of the transgenic lines grown under low temperature and those of “Phyongdo19” plants grown under normal growth temperature (cold bed condition) as shown in Table 3.

Table 3

Yield component characteristics of *DREB1A* transgenic lines grown under low temperature seedling culture conditions
indices breeds	Height/ cm	Panicles per plants	Grains per panicles	maturing rate/ %	1000 grain weight/ g	yield per hectare/ ㎏	yield index
Phyongdo-19*	71 ± 2.3	9.0 ± 0.5	110.5	83.4	32	6 369
7–9	75.6 ± 0.8	10.2 ± 0.7	100.7	89.3	28	6 164	96.8
12 − 3	77.1 ± 0.6	11.2 ± 0.4	120.3	87.3	28	7 431	116.7
18 − 6	81.9 ± 0.5	12.5 ± 0.4	120.0	90.9	29	7 651	120.1
*: Yield component of “Phyongdo 19” in fields grown at normal growth temperature (cold bed condition).

As shown in Table 3, the yield per hectare of transgenic lines 12 − 3 and 18 − 6 seedlings grown under low temperature (uncoated) conditions was 7,431 and 7,651 kg, respectively, which were 117 and 120% higher than that of “Phyongdo 19” (6,369 kg) grown under normal growth temperature (cold bed condition). Therefore, the selected transgenic lines may produce fully grown seedlings without plastic sheet coating in early April with an average daily temperature of around 7°C and yield per hectare higher than the control cultivars.

The efficiency and expression characteristics of foreign gene introduction into plants changes depending on the recipient plant and introduction method. Direct introduction of genes, such as biolistics and floral dip method, has the advantages of not requiring special manipulations and being less expensive, but has disadvantages including appearance of chimeras, requirement of expensive equipment and exhibition of low integration efficiency. A. tumefaciens-mediated transformation based on T-DNA transfer mechanisms has been widely used in plant breeding as a reliable method.

Improvement of plants by foreign gene transfer requires efficient expression of recombinant vectors and development from clones. Introduction of foreign genes through callus has the advantage of being able to perform antibiotics-mediated selection of transformation plants. However, plant regeneration and induction through callus is costly and has the disadvantage that it cannot be introduced into cultivars unable to induce callus. As efficient gene editing techniques such as CRISPR/Cas9 technology are being developed, the combination of efficient gene transfer methods can improve crop breeding.

When primary leaves are drawn from the coleoptile, the leaves that have already formed may be removed, increasing the probability of exposure of undifferentiated meristems. Abdul et al. (2011) obtained transgenic plants by cutting coleoptile of germinated wheat seedlings for the purpose of exposing meristem, and co-cultivating them with Agrobacterium culture. In this case, considering that previously differentiated leaves may interfere with Agrobacterium injection, drawing primary leaf may be considered to be a process to increase efficiency of Agrobacterium-mediated transformation. Although during primary leaf drawing, shoot apical meristem may not be directly exposed, infection due to the penetration of Agrobacterium culture into shoot apical meristem through the cell layers that make up the meristem may be possible. We illustrate the reasons underlying efficiency of this method in two ways.

One reason is that the primary leaf-drawn coleoptile may provide both spatial and temporal environment that supports the introduction foreign gene into shoot apical meristem. In previous methods, Agrobacterium culture was injected by placing Agrobacterium-coated cotton on meristem or spraying them (Wen-fang et al. 2018; Bipinchandra and Anita, 2016).In contrast, in case of Agrobacterium injection through coleoptile, Agrobacterium culture filled in coleoptile can infect meristem, maintaining activity for a relatively long time. Furthermore, infection had been mediated by wetting the shoot apical meristem and Agrobacterium culture (Bipinchandra and Anita, 2016), while our approach would have provided a spatial and temporal environment to support Agrobacterium infection.

Another reason is that wounds occur in meristem during the procedure of drawing primary leaves from coleoptile. In previous methods, shoot apical meristems were exposed artificially to be infected with Agrobacterium culture. In Wen-fang et al. (2018), Agrobacterium was treated to shoot apical meristem after cotyledon formation of cotton (Gossypium hirsutum L.), when differentiation may had already occurred. Considering that drawing primary leaves from coleoptile occurs during active cell division phase, and that sense of wound is the first step inducing Agrobacterium infection into plant cells (Yoel et al., 2012), the wound induced during primary leaf drawing may have promoted Agrobacterium infection, resulting in a high transformation efficiency.

In general, despite the fact that transformation by induction and expression regulation of genes of the same species origin is a major concern, the introduction of the AtDREB1A gene into rice has been extensively studied to improve stress tolerance. Karabi et al. (2012) found that overexpression of inserted AtDREB1A gene under the RD29A promoter may enhance drought stress tolerance compared to plants with OsDREB1A or OsDREB1B under the same promoter in rice. On the other hand, under the control of stress-induced promoters such as RD29A in transgenic plants, overexpression of the AtDREB1A gene was found to easily maintain leaf and shoot structure under stress (Karabi et al. 2012). Considering that overexpression of DREB1A transgene contributes to water balance maintenance in transgenic plants (Soumitra et al., 2015) and that the ICE1-DREB1 signaling pathway is well conserved in many plant species (Shan et al. 2014; Ding et al. 2015a, b), expression of AtDREB1A gene under RD29A stress-induced promoter may be a good way to enhance cold tolerance in rice.

In conclusion, the advantage of foreign gene transfer through coleoptile is that it is both simple and cheap method that does not interfere with the normal development of plants and does not require any equipment, depending on natural developmental status of plant. The callus induction and other direct introduction methods based on totipotence of plant cells essentially involve explant culture and introduction of foreign genes into them followed by regeneration of transgenic plant. This process is time consuming and laborious, exhibits low regeneration efficiency and causes unintended mutation. In our results, drawing primary leaves from coleoptile had no negative effect on plant development. This may be a simple method to obtain transgenic plants, increasing the efficiency of introduction and expression of foreign gene.

Acknowledgements

We thank all members who helped with vector construction, microscope sample preparation and photographing, plant regeneration and field works. This research was made possible by financial support of the Scientific and Technical Commission, D. P. R. Korea.

Author Contribution

UH and YC conceptualized and designed the study, UH and SS conducted the experiments, and MP and MK constructed the vectors, KK, TH and YC analysed the data; UH and SS collected data and wrote the first draft; and all authors contributed substantially to revisions.

Conflicts of Interest

None.

Declarations of interest

None.

Razzaq A, Hafiz IA, Mahmood I, Azhar Hussalin (2011) Development of in planta transformation protocol for wheat. Afr J Biotechnol 10(5):740–750
Alok Abhishek R, Kumari CG, Karjagi P, Kumar B, Kumar S, Dass R, Sai Kumar PW, Ramteke (2016) Tissue Culture Independent Agrobacterium tumefaciens Mediated In Planta Transformation Method for Tropical Maize (Zea mays L.). Proceedings of the National Academy of Sciences, India Section B: Biological Sciences 86(2), 375–384
Barton MK (2010) Twenty years on: the inner workings of the shoot apical meristem, a developmental dynamo. Dev Biol 341:95–113
Bipinchandra B, Kalbande AS, Patil (2016) Plant tissue culture independent Agrobacterium tumefaciens mediated In-planta transformation strategy for upland cotton (Gossypium hirsutum). J Genetic Eng Biotechnol 14(1):9–18
Ding Y, Li H, Zhang X, Xie Q, Gong Z, Yang S (2015a) OST1 kinase modulates freezing tolerance by enhancing ICE1 stability in Arabidopsis. Dev Cell 32:278–289
Ding ZT, Li C, Shi H, Wang H, Wang W (2015b) Pattern of CsICE1 expression under cold or drought treatment and functional verification through analysis of transgenic Arabidopsis. Genet Mol Res 14:11259–11270
Dubouzet JG, Sakuma Y, Ito Y, Kasuga M, Dubouzet ED, Miura S, Seki M, Shinozaki K, Yamaguchi-Shinozaki K (2003) OsDREB genes in rice, Oryza sativa L., encoded transcription activators that function in drought-, high salt- and cold-responsive gene expression. Plant J 33:751–763
Karabi Datta N, Baisakh M, Ganguly S, Krishnan K, Shinozaki, Swapan K, Datta (2012) Overexpression of Arabidopsis and Rice stress genes’inducible transcription factor confers drought and salinity tolerance to rice. Plant Biotechnol J 10:579–586
Khush GS (2005) What it will take to feed 5.0 billion rice consumers in 2030. Plant Mol Biol 59:1–6
Lili Man D, Xiang L, Wang W, Zhang X, Wang G Qi (2017) Stress-responsive gene RsICE1 from Raphanus sativus increases cold tolerance in rice. Protoplasma 254:945–956
Maher MF, Nasti RA, Vollbrecht M, Straker CG, Clark MD, Voytas DF (2019) Plant gene editing through de novo induction of meristems. Nat Biotechnol. https://doi.org/10.1038/s41587-019-0337-2
Murray MG, Thompson WF (1980) Rapid isolation of higher molecular weight plant DNA. Nucl Acids Res 8:4321–4325
Phillips RL, Kaeppler SM, Olhof P (1994) Genetic instability of plant tissue cultures: breakdown of normal controls. Proc. Natl Acad. Sci. USA 91, 5222–5226
Aminedi R, Dhatwalia D, Jain V, Ramcharan Bhattacharya (2019) High efficiency in planta transformation of Indian mustard (Brassica juncea) based on spraying of floral buds. Planr Cell Tissue Organ Cult 138(2):229–237
Kumar R, Mamrutha HM, Kaur A, Venkatesh K, Sharma D, Gyanendra Pratap Singh (2019) Optimization of Agrobacterium-mediated transformation in spring bread wheat using mature and immature embryos. Mol Biol Rep 46(2):1845–1853
Ren Yu-jun, Zhao Jie (2008) Optimization of Electroporation Parameters for Immature Embryos of indica Rice (Oryza sativa). Rice Sci 15(1):43–50
Shan W, Kuang JF, Lu WJ, Chen JY (2014) Banana fruit NAC transcription factor MaNAC1 is a direct target of MaICE1 and involved in cold stress through interacting with MaCBF1. Plant Cell Environ 37:2116–2127
Soumitra Paul D, Gayen SK, Datta, Karabi Datta (2015) Dissecting root proteome of transgenic rice cultivars unravels metabolic alterations and accumulation of novel stress responsive proteins under drought stress. Plant Sci 234:133–143
Tasnim Ahmed S, Biswas SM, Elias M, Sazzadur Rahman N, Tuteja, Zeba I, Seraj (2018) In Planta transformation for conferring salt tolerance to a tissue-culture unresponsive indica rice (Oryza sativa L.) cultivar. In Vitro Cellular & Developmental Biology – Plant, 54(2), 154–165
Wang QY, Guan YC, Wu YR, Chen HL, Chen F, Chu CC (2008) Overexpression of a rice OsDREB1F gene increase salt, drought and low temperature tolerance in both Arabidopsis and rice. Plant Mol Biol 67:589–602
Wen-fang GUO, Wang KY, Nan WANG, Jun LI, Gang-qiang LI, De-hu LIU (2018) Rapid and convenient transformation of cotton (Gossypium hirsutum L.) using in planta shoot apex via glyphosate selection. J Integr Agric 17(10):2196–2203
Xueqing Duan L, Zheng J, Sun W, Liu W, Wang, Hailong An (2019) Co-culturing on dry filter paper significantly increased the efficiency of Agrobacterium-mediated transformations of maize immature embryos. Physiol Mol Biology Plants 25(2):549–560
Shiboleth Y, Tzvi Tzfira (2012) Agrobacterium-mediated plant genetic transformation. Introduction to basic procedures in plant biotechnology. Elsevier Inc 00007–9. DOI:10.1016/B978-0-12-381466-1
Zhang D et al (2014) Tissue culture-induced heritable genomic variation in rice, and their phenotypic implications.PloS ONE9, e96879
Zuraida AR, Rahiniza K, Nurul, Hafiza MR, Suri, Roowi, Zamri Z, Sreeramanan Subramaniam (2010) Factors affecting delivery and transient expression of gusA gene in Malaysian indica rice MR 219 callus via biolistic gun system. Afr J Biotechnol 9(51):8810–8818
Zuraida A, Rahman ZA, Seman N, Basirun AL, Julkifle Z, Zainal, Sreeramanan Subramaniam (2011) Preliminary investigations of Agrobacterium-mediated transformation in indica rice MR219 embryogenic callus using gus A gene. Afr J Biotechnol 10(40):7805–7813

SupplementaryData.docx

Download PDF

Version 1

posted

You are reading this latest preprint version

Development of Agrobacterium-mediated in planta transformation method through coleoptile in rice

Status:

Version 1

Abstract

Figures

Key Message

1. Introduction

2. Materials And Methods

2.1 Agrobacterium preparation

2.2 Transformation and plant regeneration

2.3 Histochemical analysis

2.4 hpt and DREB1A gene detection

2.5 Expression analysis of AtDREB1A gene in T₂ rice plants

2.6 Determination of physiological and biochemical factors associated with cold tolerance

3. Results

3.1 Agrobacterium culture infection through primary leaf-drawn coleoptile

3.2 Gene transfer through rice coleoptile, transmission to the progeny

3.3 Selection of elite plants according to phenotypic indices in T₁ generation

3.4 Expression of AtDREB1A gene under cold stress in T₂ plants

3.5 Characteristics of AtDREB1A transgenic T₂ plants

4. Discussion

Declarations

References

Supplementary Files

Status:

Version 1

Development of Agrobacterium-mediated in planta transformation method through coleoptile in rice

Status:

Version 1

Abstract

Figures

Key Message

1. Introduction

2. Materials And Methods

2.1 Agrobacterium preparation

2.2 Transformation and plant regeneration

2.3 Histochemical analysis

2.4 hpt and DREB1A gene detection

2.5 Expression analysis of AtDREB1A gene in T2 rice plants

2.6 Determination of physiological and biochemical factors associated with cold tolerance

3. Results

3.1 Agrobacterium culture infection through primary leaf-drawn coleoptile

3.2 Gene transfer through rice coleoptile, transmission to the progeny

3.3 Selection of elite plants according to phenotypic indices in T1 generation

3.4 Expression of AtDREB1A gene under cold stress in T2 plants

3.5 Characteristics of AtDREB1A transgenic T2 plants

4. Discussion

Declarations

References

Supplementary Files

Status:

Version 1

2.5 Expression analysis of AtDREB1A gene in T₂ rice plants

3.3 Selection of elite plants according to phenotypic indices in T₁ generation

3.4 Expression of AtDREB1A gene under cold stress in T₂ plants

3.5 Characteristics of AtDREB1A transgenic T₂ plants