L. reuteri FLRE5K1 inhibits the development and progression of hepatocellular carcinoma via activating the IFN-γ/CXCL10/CXCR3 pathway

doi:10.21203/rs.3.rs-1598925/v1

Download PDF

Research Article

L. reuteri FLRE5K1 inhibits the development and progression of hepatocellular carcinoma via activating the IFN-γ/CXCL10/CXCR3 pathway

https://doi.org/10.21203/rs.3.rs-1598925/v1

This work is licensed under a CC BY 4.0 License

Version 1

posted

You are reading this latest preprint version

Symbiotic bacteria participate in the formation of the structure and function of the tissues and organs in which they live, and play an essential role in maintaining the balance between health and disease. L. reuteri FLRE5K1 was isolated from the liver of healthy mice by our group and proved to be a probiotic with anti-melanoma activity in previous studies. The relationship between hepatic symbiotic probiotics and hepatocellular carcinoma (HCC) has not been reported yet. In the present study, L. reuteri FLRE5K1 was initially confirmed to successfully enter the liver after being administered by gavage, and the efficacy of probiotic feeding on HCC and its potential mechanism of inhibiting tumor progression were investigated by an orthotopic liver cancer model established. The results showed that L. reuteri FLRE5K1 significantly reduced the tumor formation rate and inhibited tumor growth. From the perspective of mechanism, activation of the IFN-γ/CXCL10/CXCR3 pathway as well as its positive feedback on the secretion of IFN-γ, induced the polarization of Th0 cell to Th1 cell and inhibited the differentiation of Treg cell, which played a key role in the inhibitory effect of L. reuteri FLRE5K1 on the development and progression of HCC.

L. reuteri FLRE5K

HCC

IFN-γ/CXCL10/CXCR3

signaling pathway

Primary liver cancer (PLC) is the sixth most common malignant tumor and the third cause of cancer-related deaths in the world with over 900,000 new cases and 830,000 deaths in 2020 [1]. About 75%-85% of PLC patients are diagnosed with hepatocellular carcinoma (HCC) [2]. Traditional liver cancer treatments are not ideal for HCC patients [3, 4], and the 5-year overall survival rate (OSR) of patients with advanced liver cancer is only 10%-18% [5, 6]. In recent years, immune checkpoint inhibitors have become a research focus. However, the therapeutic effect of immune checkpoint inhibitor therapies is not ideal for the treatment of HCC in clinical practice, and clinical data demonstrate that only about 15%-20% of patients with HCC respond to this treatment [7].

Probiotics can activate the anti-cancer immunity of the body [8]. Compared with targeted drugs and immune checkpoint inhibitors, probioticsare cheap and less prone to drug resistance. More importantly, probiotics have no toxic and side effects on the human body, which is extremely important for HCC patients with insufficient liver functional reserve. Therefore, probiotics are promising in the future application as an adjuvant treatment for HCC immunotherapy.

Most microorganisms cannot pass through the intestinal mucosal barrier and directly enter human tissues and organs to work there under normal circumstances. Actually, most studies on probiotics involve in anatomical sites such as the oral mucosa, gastrointestinal tract, and vagina [9, 10]. Few studies on probiotics and liver cancer have been reported up to date and all of them are based on the gut-liver axis theory. The gut-liver axis theory refers to the fact that the liver is not directly in contact with the gut microbiota, but there is a close anatomical connection between the liver and the intestinal tract, i.e., nutrient-rich blood is physiologically transported from the gut to the liver via the portal vein accompanied with consequent low-level exposure to intestinal microbiota-derived metabolites and products, which may affect the liver. For instance, Endo H et al. found that probiotics reduced the risk of liver cancer by producing butyrate [11]; and Kumar et al. confirmed that Lactobacillus rhamnosus LC705 and Propionibacterium freudenreichii subsp. Shermanii mitigated the risk of liver cancer by reducing liver exposure to intestinal aflatoxin [12].

Human symbiotic bacteria participate in the formation of the structure and function of the tissues and organs they live in and play an essential role in maintaining the balance between health and disease [13]. In addition to the hollow organs such as the intestine, oral cavity, and vagina, it is successively confirmed that symbiotic bacteria exist in those which were previously considered sterile, including the blood system, adipose tissue, and breast tissue [14–16]. Lactobacillus reuteri FLRE5K1 (L. reuteri FLRE5K1) is a probiotic strain isolated and identified from the liver. Luo et al. [17] in our group have revealed in their preliminary study that L. reuteri FLRE5K1 inhibited the development and progression of melanoma. Therefore, as a symbiotic organism in the liver tissue with an inhibitory effect on the tumor, the role of L. reuteri FLRE5K1 in HCC treatment needs further study.

No studies on the relationship between hepatic symbiotic probiotics and HCC have been reported up to date. In the present study, an orthotopic HCC model in mice was established to explore the effect of L. reuteri FLRE5K1 on HCC and its underlying molecular mechanism, hopefully to provide a new possibility for HCC immunotherapy.

(1) Animal and Ethics Statement

Male C57BL/6 mice (6-8 weeks old, body weight 22 ± 2 g) were purchased from Beijing Vital River Laboratory Animal Technology Co., Ltd and housed in the animal room in the Animal Experiment Center of Nanchang University, Nanchang, China, at 22~25°C with a humidity of 56~60% and a 12h:12h light/dark cycle. Animals were fed with free access to a standard diet and water. Six SPF male nude mice (Nanchang Royo Biotech Co., Ltd., Nanchang, China) were fed and operated in an SPF animal laboratory. Animal experiments were approved by the Experimental Animal Management Committee of Jiangxi Province (license number SYXK (Gan) 2022-0001) and all animal experiments were performed according to the 3R (replacement, refinement, reduction) principle.

(2) Cell Lines and Bacterial Culture

Hepa1-6 hepatocellular carcinoma cells (Procell Life Science and Technology Co., Ltd., Wuhan, China) were cultured in standard Dulbecco's modified eagle medium (DMEM) minimal medium (Solarbio, Beijing, China) supplemented with 10 % heat-inactivated fetal bovine serum (Solarbio, Beijing, China), 100 μg/mL penicillin and 100 μg/mL streptomycin (Solarbio, Beijing, China).

L.reuteri FLRE5K1 (State Key Laboratory of Food Science and Technology, Nanchang University, Nanchang, China) was cultured in De Man Rogosa and Sharpe (MRS) broth (Solarbio, Beijing, China) at 37°C for 18hrs. Then 1mL culture was removed and inoculated into 100mL skim milk (10% wt/vol) and incubated under anaerobic conditions at 37°C for 24hrs. Fermented milk with a final density of 10⁹ CFU/mL was used for in vivo gavage assay. For in vitro co-cultivation assay, L. reuteri FLRE5K was washed three times with PBS and resuspended in DMEM medium, and the final concentration was adjusted to 10⁷ CFU/mL.

(3) In Vitro Co-culture Assay and Transcriptome Analysis

Hepa1-6 cells were seeded into a 6-well plate at a density of 3×10⁵ cells/well. After 24 hours of culture, DMEM medium containing L. reuteri FLRE5K1 at a concentration of 1 × 10⁷ CFU/mL was replaced, and the cells were incubated for an extra 3hrs and then collected. Total RNA was extracted using TRI reagent solution (Invitrogen, Carlsbad, Fournia, USA) and sent to BGI (Shenzhen, China) for high-throughput transcriptome sequencing.

(4) L.reuteri FLRE5K1 Cross-through Assay

Nude mice were randomly divided into 2 groups, i.e., the control group and the FLRE5K1 group, with 3 mice in each group. Animals in the FLRE5K1 group were intragastrically administered with 100μL L. reuteri FLRE5K1 fermented milk daily, and those in the control group were intragastrically administered with 100μL skim milk daily. Three days later, the liver was collected in an ultra-clean cabinet. Liver samples from the two groups of mice were added to the MRS plates and cultured in an anaerobic incubator at 37°C for 48hrs. 16S rDNA was amplified by Colony PCR and sequenced (SANGON biotech, Shanghai, China) for strain identification.

(5) Orthotopic Liver Cancer Modeling and Administration of L.reuteri FLRE5K1

Male C57BL/6 mice were divided into 2 groups, i.e., the control group and the FLRE5K1 group, with 8 mice in each group. Mice in the FLRE5K1 group were given 100μL 10⁹CFU/ mLL.reuteri FLRE5K1 fermented milk by gavage, and those in the control group were given the same amount of skim milk. On Day 8, these mice were anesthetized by intraperitoneal injection of 0.1mL 10% chloral hydrate (Solarbio, Beijing, China) and placed in a supine position with limbs fixed on the operating board. The chest and abdomen hair was carefully shaved with scissors and disinfected with Anerdian. The abdomen was opened layer by layer along the abdominal white line to expose the abdominal cavity. The chest of the mice was gently pressed to extrude the liver from the abdominal cavity, and the liver lobe closest to the body surface was selected for tumor implant. The syringe needle was obliquely inserted into the liver for about 1cm and the piston was gently pushed to slowly inject the cell suspension (20μL, about 5 × 10⁶ hepa1-6 cells). The needle was slowly withdrawn. After being gently pressed with a sterile cotton swab for a moment, the liver was gently put back into the abdominal cavity and the abdomen was closed layer by layer. After the operation, the mice in the two groups continued to be treated by gavage. On Day 38 day after inoculation, animals were euthanized by cervical dislocation and tumors, peripheral blood and spleens were collected. Tumor formation rate and tumor volume were measured. Tumor volume was calculated using the improved ellipsoid formula: (length × Width²)/2. Diseases or discomfort symptoms were monitored for the mice during the experiment.

(6) Real-time RT-PCR

Total RNA was extracted from Hepa1-6 cells and liver cancer tissues using TRI reagent (Servicebio, Wuhan, China) and DNase I (Servicebio, Wuhan, China) according to the instructions provided by the manufacturer (Sigma). RNA was then reverse transcribed into cDNA using the SweScript RT I First Strand cDNA Synthesis Kit (Servicebio, Wuhan, China). Quantitative real-time (qT) PCR was performed on ABI 7500 HT rapid real-time PCR system (Applied Biosystems, Foster City, CA) and RT 2 SYBR Green qPCR Mastermix (Sigma). Primers used were purchased from Generay Biotech (SANGON biotech, Shanghai, China) and are shown in Table 1. GADPH was used as a control, and the relative expression of these genes was calculated by the 2-ΔCT method.The primer sequences used are shown in Table 1

Table 1 Primer sequences
Primer information	Gene name	Primer sequence (5ʹ→3ʹ)	Lengh /bp
NM_008084.2	GAPDH	F:CCTCGTCCCGTAGACAAAATG	133
	GAPDH	R:TGAGGTCAATGAAGGGGTCGT
NM_011333.3	CCL2	F:CAGGTCCCTGTCATGCTTCT	91
	CCL2	R:GTGGGGCGTTAACTGCATCT
NM_001159738.1	CCL20	F:GTGGGTTTCACAAGACAGATGG	119
	CCL20	R:ACAGCCCTTTTCACCCAGTTC
NM_021274.2	CXCL10	F:AAGCGTTTAGCCAAAAAAGGTC	121
	CXCL10	R:ACTGGGTAAAGGGGAGTGATGG
NM_008176.3	CXCL1	F:CACCCAAACCGAAGTCATAGC	109
	CXCL1	R:GGGGACACCTTTTAGCATCTTT
NM_009141.3	CXCL5	F:GCTGGCATTTCTGTTGCTGTT	184
	CXCL5	R:TATGACTTCCACCGTAGGGCA
NM_203320.3	CXCL3	F:CCTACCAAGGGTTGATTTTGAGAC	88
	CXCL3	R:AGTGGCTATGACTTCTGTCTGGGT

(7) Western Blot Analysis

Mouse liver cancer tissue samples were ground into a powder under liquid nitrogen. The powder was then dissolved in protein loading buffer in a ratio of 1:10 (tissue/buffer) and boiled for 5 minutes. After cooling to room temperature, the supernatant was used for Western blot and data analysis. The protein concentration of the samples was detected using a Bicinchoninic acid (BCA) protein analysis kit (Thermo Scientific, Waltham, Massachusetts, USA). Antibodies used included CXCL10 (DF6417, 1:1000, Affinity Bioscience) and CXCR3 (DF4858, 1:1000, Affinity Bioscience)

(8) ELISA

Peripheral blood of mice was placed in a refrigerator at 4℃ for 12hrs, and then centrifuged at 2800×g for 10mins.The serum supernatant was collected and interferon-γ (IFN-γ) and interleukin-10 (IL-10) were determined by biotin-labeled double antibody sandwich ELISA using ELISA kits (Boster Biological Technology, Wuhan, China).

(9) Immunohistochemistry

Liver sections were deparaffinized and hydrated, and treated with 3% H₂O₂ to block endogenous peroxidase activity. EDTA buffer (pH 8.0) was used for antigen retrieval. Each section was blocked with 1% albumin from bovine serum (BSA) and incubated for 30mins. The sections were then incubated with diluted primary antibodies CXCL10 (DF6417, 1:100, Affinity Bioscience) or CXCR3 (DF4858, 1:200, Affinity Bioscience) for 1hr at 37ºC and then transferred from the incubator to 4ºC overnight. The next day, the sections were warmed to room temperature and the HRP-conjugated goat anti-rabbit secondary antibody (GB23303, 1:200, Servicebio, Wuhan, China) was added to each section. After incubated at 37ºC for 1hr, the sections were rinsed with Diaminobenzidine (DBA) reagent, stained with hematoxylin, and mounted with neutral gel.

Reactions were visualized using the Aipathwell system (Servicebio, Wuhan, China). Quantification of CXCL10 and CXCR3 for each sample was performed by pathologists using a modified H-score: H-Score (H-SCORE=∑（pi×i）=(percentage of weak intensity area ×1)+(percentage of moderate intensity area ×2)+(percentage of strong intensity area ×3), where pi denotes the percentage of the pixel area of positive signal, and i denotes the grade of positivity). H-score was a value between 0-300, and a larger value indicated a stronger comprehensive positive intensity [18].

(10)Double immunofluorescent staining

The sections were deparaffinized and hydrated, and then antigen retrieval was conducted with EDTA antigen retrieval buffer at 95-100ºC for 20mins. Each section was blocked with 3% BSA at room temperature for 30mins. Then the sections were incubated with two diluted antibodies derived from different species at 37ºC for 1hr and then at 4ºC overnight. The next day, the sections were incubated with species-specific fluorescein-conjugated secondary antibody at 37ºC for 1hr. Primary antibodies used included CD4(GB13064-2，1:1000，Servicebio，wuhan，China), IFN-γ (AF5183，1:200, Affinity Bioscience), IL-10(GB11108，1:200，Servicebio，wuhan，China), and FOXP3 (GB112325, 1:500, Servicebio, wuhan, China), and secondary antibodies used included Cy3-labeled goat-anti rabbit IgG (H + L) (gb21303, 1:500, Servicebio, Wuhan, China) and FITC-labeled goat anti-rabbit IgG (H + L) (gb22303, 1:100, Servicebio, Wuhan, China). DAPI (g1012, Servicebio, Wuhan, China) was used to observe the nucleus in some tumors.

The integrated optical density (IOD) and area were determined using the Aipathwell system (Servicebio, Wuhan, China) for the selected image, and protein expression of INF-γ and IL-10 was expressed as the cumulative optical density IOD value for positive area/tissue area [19]. CD4+IFN-γ+T cells were classified as Th1 cells and CD4+FOXP3+T cells as Treg cells. Th1 (CD4+IFN-γ+) and Treg (CD4+FOXP3+) double fluorescent co-expression cells were yellow in color after superposition and the percentage of these cells was calculated as Th1 (CD4+IFN-γ+) or Treg (CD4+FOXP3+) / total CD4+ T cells.

(11) Statistical Analysis

SPSS 13.0 (IBM Corp., Armonk, NY) was used for statistical analysis. Plots were drawn using Graphpad Prism 5 (GraphPad Inc., San Diego, CA), and a t-test was used to determine the differences between the experimental group and the control group. One-way ANOVA was applied to compare the differences between groups. P<0.05 was considered statistically significant.

(1) L.reuteri FLRE5K1 crossed through the gastrointestinal tract to the liver after intragastric administration

Ground liver solution of male SPF mice in the control group and the FLRE5K1 group was added to the MRS plate and cultured in an anaerobic environment for 48hrs. As shown in Figs. 1a and b, no colonies were found in the Control group. Colonies with consistent morphology were observed in the FLRE5K1 group. 30 colonies were randomly selected for colony PCR and the amplified products were identified as L.reuteri FLRE5K1 by nucleotide sequence.

(2) Oral administration of L.reuteri FLRE5K1 fermented milk inhibited the development and progression of orthotopic liver cancer in mice

The inhibitory effect of L.reuteri FLRE5K1 on HEPA1-6-induced orthotopic liver cancer was evaluated. As shown in Fig. 2a, C57BL/6 mice were given live fermented milk containing 10⁹ CFU/ mL L.reuteri FLRE5K1 daily for 7 days, and animals in the control group were given the same amount of skim milk. On Day 8, 5×10⁶ HEPA1-6 cells were injected into the liver (Fig. 2a). On Day 38 after inoculation, the animals were euthanized by cervical dislocation and the tumors were collected (Fig. 2b). No signs of diseases or discomfort were observed during the experiment. Oral administration of L.reuteri FLRE5K1 resulted in a statistically significant reduction in tumor formation rate (Fig. 2c) as well as tumor size (Fig. 2d) compared to the animals that received skim milk alone during the same time period

(3) L.reuteri FLRE5K1 induced the transcription and expression of immune-related chemokines in Hepa1-6 cells, especially CXCL10

In order to explore the immunomodulatory effect of L.reuteri FLRE5K1 on HCC, the bacteria were co-incubated with Hepa1-6 cells, and the transcription profile of L.reuteri FLRE5K1-stimulated Hepa1-6 cells was analyzed by transcriptomic methods. As shown in Fig. 3a, 610 genes were up-regulated and 94 genes were down regulated in Hepa1-6 cells after co-incubated with L.reuteri FLRE5K1 (log2 (F/C) ≥ 1, P < 0.05). Many of these transcriptionally upregulated genes were related to immune regulation. As shown in Fig. 3b, compared with the control group, the expression of various chemokine factors and receptors in these cancer cells was significantly up-regulated in the L.reuteri FLRE5K1 group. Notably, the most significantly increased transcription was observed for CXCL10, with mRNA expression increased from 134 to 1545 (log2 (F/C) = 3.53), showing that L.reuteri FLRE5K1 significantly increased the transcription level of CXCL10 in Hepa1-6 cells. These results were further confirmed by Q-PCR data (Fig. 3c). Differentially expressed genes involved in the main metabolic and signaling pathways were described using the Kyoto Encyclopedia of genes and genes (KEGG) enrichment pathways (Fig. 3b), and it was found that the CXCL10 gene involved various signaling pathways, such as IL-17, TNF and cytokine - cytokine receptor interaction signal pathways, which were closely related to the activation of immune function.

(4) Oral administration of L.reuteri FLRE5K1 fermented milk up-regulated the expression of CXCL10 and CXCR3 in liver cancer tissues

In order to assess the effect of L.reuteri FLRE5K1 on the expression of CXCL10 and CXCR3 in liver cancer tissues, the transcription and protein expression of CXCL10 and CXCR3 in tumor tissues was determined. The Q-PCR results (Fig. 4a) showed that the transcription levels of CXCL10 and CXCR3 in tumor tissues of the L.reuteri FLRE5K1 group were significantly increased compared with those of the control group (P < 0.05). Western blot analysis (Fig. 4b) showed that the protein expression of CXCL10 and CXCR3 in the FLRE5K1 group was also significantly increased compared with those of the control group. Immunohistochemical staining results also confirmed that the intake of L.reuteri FLRE5K1 fermented milk up-regulated the expression of CXCL10 and CXCR3 in tumor tissues (Fig. 4c).

(5) L.reuteri FLRE5K1 fermented milk up-regulated IFN-γ in the peripheral blood

Cytokines in peripheral blood and liver cancer tissue of mice were evaluated to investigate the effect of L.reuteri FLRE5K1 fermented milk on these cytokines by enzyme-linked immunosorbent assay (ELISA). 38 days after the animals were inoculated with Hepa1-6 cells, IFN-γ in peripheral blood significantly increased in the L.reuteri FLRE5K1 group (Fig. 5a), but no statistically significant difference in IL-10 level was noted between the two groups (Fig. 5b).

(6) Oral administration of L.reuteri FLRE5K1 fermented milk stimulated the secretion of IFN-γ and reduced the level of IL-10 in the tumor tissue

The liver cancer tissue was removed from the animals, fixed and sliced, and observed after staining with appropriate antibodies. The results of fluorescence immunohistochemistry showed that IFN-γ was increased (Fig. 6a) and IL-10 was decreased (Fig. 6c) in the tumor tissue of mice in the FLRE5K1 group compared with those of the control group.

(7) L.reuteri FLRE5K1 fermented milk increased Th1 cells and decreased Treg cells in tumor tissues

Infiltration levels of Th1 and Treg cells in tumor tissues were evaluated by double immunofluorescent staining. The collected tumor tissues were deparaffinized and dehydrated with gradient ethanol. After antigen retrieval and blocking, immune effector cells were stained by double fluorescent antibodies. Compared with the control group, the number of Th1 (CD4 + IFN-γ+)cells increased significantly (Fig. 7a), while the number of Treg (CD4 + Foxp3+) cells decreased (Fig. 7b).

The key and fundamental issue that needed to be addressed in the present study was how L.reuteri FLRE5K1 entered the liver as a liver symbiotic bacterium. Lactobacillus is less resistant to gastrointestinal digestion[20], and fermented milk, however, can relieve gastric acid and serve as an excellent carrier for gastric administration to maintain bacterial vitality [21]. Therefore, a high-concentration of L.reuteri FLRE5K1 with defatted milk as the protective carrier was used in this study to ensure enough live bacteria cross the gastrointestinal barrier. It was confirmed in a gavage experiment in nude mice that the live L.reuteri FLRE5K1 could successfully enter the liver tissue from the gastrointestinal tract, which provided a basis for the study of L.reuteri FLRE5K1 and HCC.

In this study, L.reuteri FLRE5K1 was delivered by gavage with a high concentration of fermented milk to an orthotopic liver cancer model system to successfully establish a real L.reuteri FLRE5K1-HCC coexistence model in the liver of mice. Compared with the current studies on the indirect and remote effect of probiotics on subcutaneous liver cancer via the intestinal-liver circulation [11, 12, 22], this symbiotic mode exerted a more direct impact on HCC in the liver.

In this study, it was observed that administration of L.reuteri FLRE5K1 reduced the tumor formation rate of HEPA1-6 in a syngeneic mouse tumor model, and analysis of the tumorigenic model showed that the tumor volume was decreased by L.reuteri FLRE5K1. In order to reveal the potential molecular mechanism of the antitumor effect of L.euteri FLRE5K1, the changes in the transcriptome profile of HEPA1-6 cell after L.euteri FLRE5K1 intervention was investigated. RNA-seq analysis showed that the transcriptional levels of chemotaxis- and immune regulation-related genes in Hepa1-6 cells were most significantly up-regulated after L. ruteri FLRE5K1 treatment, suggesting that immune regulation was an essential mechanism involved in the anti-tumor effect of L. ruteri FLRE5K1. CXCL10 was the most significantly up-regulated one among other immunomodulatory genes.

CXCL10 is a member of the CXC chemokine family and is strongly induced by IFN- γ [23]. CXCL10 binds to the CXCR3 receptor to exert its biological effects. CXCL10 is of critical importance in tumor eradication, and its tumor inhibition effect has been noticed for a long time [24, 25]. CXCR3 is a chemokine receptor expressed on the surface of tumor cells and can be activated by IFN-γ-induced ligands, especially CXCL10[26]. CXCR3 receptor plays a dual role, i.e., CXCR3 receptor expressed in tumor cells leads to tumor metastasis to the whole body, while that expressed in immune cells often promotes anti-tumor immune response [27]. We found that CXCL10 mRNA increased significantly in Hepa1-6 cells after L.reuteri FLRE5K1 treatment, CXCR3 mRNA, however, was hardly detected, indicating that this bacterium failed to promote the expression of CXCR3 in Hepa1-6 cells. Immunohistochemistry and Western blot assays found that the expression of both CXCR3 and CXCL10 proteins was up-regulated in liver cancer tissue of mice treated with L.reuteri FLRE5K1 compared with the control group. Studies in recent years have demonstrated that the expression of the CXCL10/CXCR3 pathway is closely related to the efficacy and prognosis of HCC. Zhang J et al. [28] found that the higher expression of CXCL10 and CXCR3 was positively correlated with the better clinical outcome of HCC patients through The Cancer Genome Atlas (TCGA). Hirano s et al. [29] and Chew V et al. [30] also confirmed that the high expression of CXCL10 in HCC patients could activate and enhance antitumor immunity and inhibit tumor metastasis and recurrence, which are favorable to the prognosis of HCC patients.

Activation of the CXCL10/CXCL10 pathway may induce a series of immunomodulatory responses, and the accumulation of cytokines and effector cells in tumors is a key step of anti-tumor immunity. It was found in the present study that L. reuteri FLRE5K1 significantly increased the level of IFN-γ in the mouse circulatory system and the liver cancer tissue. IFN-γ is an effector molecule with multiple pluripotent effects that can promote Th1 differentiation via positive feedback loops, leading to the differentiation, development, and targeted intratumor migration of specific immune effector cell populations, such as CD8 + T cells and NK cells [31, 32]. In addition to interacting with immune cells, IFN-γ also targets tumor cells to up-regulate the expression of Fas and Fas receptors and induce apoptosis of these cells [33]. Moreover, IFN-γ promotes the production of chemokines and their receptors, such as CXCL10 and CXCR3.

In response to IFN-γ, CXCL10 binds and activates the receptor CXCR3 to regulate the differentiation of primitive Th0 cells to Th1 (T helper 1, Th1) cells and guides the migration of immune cells to the tumor, while the differentiation of Th0 to Th2 and Treg is inhibited [26]. Double immunofluorescence labeling of effector T cells in liver cancer tissues showed that the number of Th1 cells increased and the number of Treg decreased in the liver tissue of L. reuteri FLRE5K1-treated mice.

Th1 cells enhance the anti-tumor immune effects by stimulating CTL, NK cells, NKT cells, and macrophages to produce IFN-γ, TNF-α, and IL-2 [34, 35], while IFN-γ secreted by the activated Th1 cells and NK cells promotes the expression of CXCL10 and consequently up-regulates the expression of receptor CXCR3. The CXCR3 receptor is activated to enhance the polarization of Th1 and inhibit the differentiation of Th0 cells into Treg cells, thus forming an IFN-γ-induced CXCL10/ CXCR3 pathway to enhance the positive feedback regulation of antitumor immunity. The expression level of the CXCL10 gene in HCC tissues is positively correlated with the infiltration of Th1, CD8 + T cells and natural killer-like T cells [36, 37]. In addition, Yan et al. [34] found that CXCL10/CXCR3 pathway activation effectively enhances the migration of Th1, CD8 + T, NK and NKT cells, promotes the secretion of IFN-γ, and inhibits the growth of HCC.

Regulatory T cells (Tregs)can express a characteristic transcription factor Foxp3 [35], which plays a crucial role in impeding anti-cancer immune surveillance and the development of effective anti-tumor immunity [36]. It has been reported that the frequency of Tregs in peripheral blood and tumor microenvironment increased in HCC patients, and Treg in HCC patients can inhibit the proliferation and perforation expression of autologous T cells in vitro [37–39]. Qiang G et al. [40] demonstrated that Treg is an independent predictor of HCC recurrence and survival. Fu J et al. [41] found that CD4 + CD25 + Foxp3 + Treg in the peripheral blood is numerically correlated with disease progression and can serve as a predictor of poor survival in HCC patients. Therefore, how to reduce the aggregation of Tregs in tumor tissues is critical in the prognosis of HCC. Highly expressed CXCL9 and CXCL10 can effectively inhibit Tregs and myeloid-derived suppressor cells (MDSCs) in the tumor microenvironment [42–44]. In the present study, it was found that the activation of the CXCL10/CXCR3 pathway in the tumor tissue of the L.reuteri FLRE5K1 group significantly reduced the infiltration of Treg cells, which significantly inhibited the progression of HCC. It was also found that the intake of L.reuteri FLRE5K1 reduced the level of IL-10 in tumor tissues. IL-10 is secreted by Treg, dendritic cells, MDSCs and Kupffer cells [45]. In HCC, Treg cells are positively correlated with IL-10 [46]. Treg inhibits Th1-type cells from secreting cytokine IFN-γ by releasing the immunosuppressive cytokine IL-10, resulting in the reduction of NK cells and consequently a tolerant and inhibitory environment [47].

In summary, the present study confirmed by in-situ modeling that intragastric administration of L.reuteri FLRE5K1 can inhibit the development and progression of HCC, and addressed its potential mechanism, i.e., through activation of the IFN-γ/CXCL10/CXCR3 pathway and positive feedback regulation of this pathway to enhance IFN-γ secretion, induce Th0 cells polarize to Th1 cells, and inhibit the formation of Treg cells, so as to enhance its anti-tumor immune activity and drive tumor regression. It is notable that the interaction between symbiotics and tumors in solid organs is a complex process with multiple factors and mechanisms and relevant studies are still in the primary exploratory. The present study only tentatively discussed the inhibitory effect of L.reuteri FLRE5K1 on HCC and related mechanisms from the aspect of antitumor immunity.

Author contributions X.Z.W., F.X. designed and supervised the research; N.Z., S.W.Y., X.L.W, and K.W. performed most of the experiments. X.Z.W., F.X., F.M.Z, B.H., J.L. and F.Y.Y. analysed and discussed the data. All authors contributed to writing the manuscript. All authors revised and approved the final version of the manuscript.

Funding This work was supported by the science and technology planning project of Jiangxi Provincial Department of Education No.GJJ210249, the Science and technology planning project of Jiangxi Provincial Health Commission No.202210568 and the Jiangxi University Innovation and entrepreneurship training program No.S202010403037.

Data availability The datasets generated during and analysed during the current study are available from the corresponding author on reasonable request.

Conflict of interests The authors declare no competing interests.

Ethical approval and consent to participate All animal experimental procedures were conducted in accordance with guidelines for the care and use of laboratory animals from the National Institutes of Health and were approved by the Jiangxi Experimental Animal Management Committee (SYXK (Gan) 2022-0001).

Consent for publication The content of this manuscript has not been previously published and is not under consideration for publication elsewhere.

Sung H, Ferlay J, Siegel RL, Laversanne M, Soerjomataram I, Jemal A et al (2021) Global Cancer Statistics 2020: GLOBOCAN Estimates of Incidence and Mortality Worldwide for 36 Cancers in 185 Countries. CA Cancer J Clin 71: 209–249. https://www.ncbi.nlm.nih.gov/pubmed/33538338
Wang H and Li W (2021) Recent update on comprehensive therapy for advanced hepatocellular carcinoma. World J Gastrointest Oncol 13: 845–855. https://www.ncbi.nlm.nih.gov/pubmed/34457190
Blanc JF, Debaillon-Vesque A, Roth G, Barbare JC, Baumann AS, Boige V et al (2021) Hepatocellular carcinoma: French Intergroup Clinical Practice Guidelines for diagnosis, treatment and follow-up (SNFGE, FFCD, GERCOR, UNICANCER, SFCD, SFED, SFRO, AFEF, SIAD, SFR/FRI). Clin Res Hepatol Gastroenterol 45: 101590. https://www.ncbi.nlm.nih.gov/pubmed/33780876
Allemani C, Weir HK, Carreira H, Harewood R, Spika D, Wang XS et al (2015) Global surveillance of cancer survival 1995–2009: analysis of individual data for 25,676,887 patients from 279 population-based registries in 67 countries (CONCORD-2). Lancet 385: 977–1010. https://www.ncbi.nlm.nih.gov/pubmed/25467588
Chew V, Chen J, Lee D, Loh E, Lee J, Lim KH et al (2012) Chemokine-driven lymphocyte infiltration: an early intratumoural event determining long-term survival in resectable hepatocellular carcinoma. Gut 61: 427–438. https://www.ncbi.nlm.nih.gov/pubmed/21930732
Xu W, Liu K, Chen M, Sun JY, McCaughan GW, Lu XJ et al (2019) Immunotherapy for hepatocellular carcinoma: recent advances and future perspectives. Ther Adv Med Oncol 11: 1758835919862692. https://www.ncbi.nlm.nih.gov/pubmed/31384311
Lai E, Astara G, Ziranu P, Pretta A, Migliari M, Dubois M et al (2021) Introducing immunotherapy for advanced hepatocellular carcinoma patients: Too early or too fast? Crit Rev Oncol Hematol 157: 103167. https://www.ncbi.nlm.nih.gov/pubmed/33271389
Dasari S, Kathera C, Janardhan A, Praveen Kumar A and Viswanath B (2017) Surfacing role of probiotics in cancer prophylaxis and therapy: A systematic review. Clin Nutr 36: 1465–1472. https://www.ncbi.nlm.nih.gov/pubmed/27923508
Gorska A, Przystupski D, Niemczura MJ and Kulbacka J (2019) Probiotic Bacteria: A Promising Tool in Cancer Prevention and Therapy. Curr Microbiol 76: 939–949. https://www.ncbi.nlm.nih.gov/pubmed/30949803
Badgeley A, Anwar H, Modi K, Murphy P and Lakshmikuttyamma A (2021) Effect of probiotics and gut microbiota on anti-cancer drugs: Mechanistic perspectives. Biochim Biophys Acta Rev Cancer 1875: 188494. https://www.ncbi.nlm.nih.gov/pubmed/33346129
Endo H, Niioka M, Kobayashi N, Tanaka M and Watanabe T (2013) Butyrate-producing probiotics reduce nonalcoholic fatty liver disease progression in rats: new insight into the probiotics for the gut-liver axis. PLoS One 8: e63388. https://www.ncbi.nlm.nih.gov/pubmed/23696823
Kumar M, Verma V, Nagpal R, Kumar A, Gautam SK, Behare PV et al (2011) Effect of probiotic fermented milk and chlorophyllin on gene expressions and genotoxicity during AFB(1)-induced hepatocellular carcinoma. Gene 490: 54–59. https://www.ncbi.nlm.nih.gov/pubmed/21963996
Lee YK and Mazmanian SK (2010) Has the microbiota played a critical role in the evolution of the adaptive immune system? Science 330: 1768–1773. https://www.ncbi.nlm.nih.gov/pubmed/21205662
Lluch J, Servant F, Paisse S, Valle C, Valiere S, Kuchly C et al (2015) The Characterization of Novel Tissue Microbiota Using an Optimized 16S Metagenomic Sequencing Pipeline. PLoS One 10: e0142334. https://www.ncbi.nlm.nih.gov/pubmed/26544955
Yang D, Wang X, Zhou X, Zhao J, Yang H, Wang S et al (2021) Blood microbiota diversity determines response of advanced colorectal cancer to chemotherapy combined with adoptive T cell immunotherapy. Oncoimmunology 10: 1976953. https://www.ncbi.nlm.nih.gov/pubmed/34595059
Meng S, Chen B, Yang J, Wang J, Zhu D, Meng Q et al (2018) Study of Microbiomes in Aseptically Collected Samples of Human Breast Tissue Using Needle Biopsy and the Potential Role of in situ Tissue Microbiomes for Promoting Malignancy. Front Oncol 8: 318. https://www.ncbi.nlm.nih.gov/pubmed/30175072
Luo M, Hu M, Feng X, XiaoLi W, Dong D and Wang W (2020) Preventive effect of Lactobacillus reuteri on melanoma. Biomed Pharmacother 126: 109929. https://www.ncbi.nlm.nih.gov/pubmed/32126498
Detre S, Saclani Jotti G and Dowsett M (1995) A "quickscore" method for immunohistochemical semiquantitation: validation for oestrogen receptor in breast carcinomas. J Clin Pathol 48: 876–878. https://www.ncbi.nlm.nih.gov/pubmed/7490328
Xu Y, Ma XP, An JN, Zhang ZJ, Ding J, Qu YK et al (2015) Short-time QiBaoMeiRan Formula Treatment Exerts Estrogenic Activities without Side Effects on Reproductive Tissues in Immature Mice. Sci Rep 5: 17436. https://www.ncbi.nlm.nih.gov/pubmed/26644197
Bezkorovainy A (2001) Probiotics: determinants of survival and growth in the gut. Am J Clin Nutr 73: 399S-405S. https://www.ncbi.nlm.nih.gov/pubmed/11157348
De Souza Oliveira R, Rodrigues Florence A, Perego P, De Oliveira M and Converti A (2011) Use of lactulose as prebiotic and its influence on the growth, acidification profile and viable counts of different probiotics in fermented skim milk. International journal of food microbiology 145: 22–27. https://www.sciencedirect.com/science/article/abs/pii/S0168160510006240?via%3Dihub
Li J, Sung CY, Lee N, Ni Y, Pihlajamaki J, Panagiotou G et al (2016) Probiotics modulated gut microbiota suppresses hepatocellular carcinoma growth in mice. Proc Natl Acad Sci U S A 113: E1306-1315. https://www.ncbi.nlm.nih.gov/pubmed/26884164
Liu J, Li F, Ping Y, Wang L, Chen X, Wang D et al (2015) Local production of the chemokines CCL5 and CXCL10 attracts CD8 + T lymphocytes into esophageal squamous cell carcinoma. Oncotarget 6: 24978–24989. https://www.ncbi.nlm.nih.gov/pubmed/26317795
Tokunaga R, Zhang W, Naseem M, Puccini A, Berger MD, Soni S et al (2018) CXCL9, CXCL10, CXCL11/CXCR3 axis for immune activation - A target for novel cancer therapy. Cancer Treat Rev 63: 40–47. https://www.ncbi.nlm.nih.gov/pubmed/29207310
Wennerberg E, Kremer V, Childs R and Lundqvist A (2015) CXCL10-induced migration of adoptively transferred human natural killer cells toward solid tumors causes regression of tumor growth in vivo. Cancer immunology, immunotherapy: CII 64: 225–235. https://link.springer.com/article/10.1007/s00262-014-1629-5
Schoenborn JR and Wilson CB (2007) Regulation of interferon-gamma during innate and adaptive immune responses. Adv Immunol 96: 41–101. https://www.ncbi.nlm.nih.gov/pubmed/17981204
Elia G and Fallahi P (2017) Hepatocellular carcinoma and CXCR3 chemokines: a narrative review. Clin Ter 168: e37-e41. https://www.ncbi.nlm.nih.gov/pubmed/28240761
Zhang J, Chen J, Guan GW, Zhang T, Lu FM and Chen XM (2019) [Expression and clinical significance of chemokine CXCL10 and its receptor CXCR3 in hepatocellular carcinoma]. Beijing Da Xue Xue Bao Yi Xue Ban 51: 402–408. https://www.ncbi.nlm.nih.gov/pubmed/31209409
Hirano S, Iwashita Y, Sasaki A, Kai S, Ohta M and Kitano S (2007) Increased mRNA expression of chemokines in hepatocellular carcinoma with tumor-infiltrating lymphocytes. J Gastroenterol Hepatol 22: 690–696. https://www.ncbi.nlm.nih.gov/pubmed/17444857
Chen W, Zheng R, Baade PD, Zhang S, Zeng H, Bray F et al (2016) Cancer statistics in China, 2015. CA Cancer J Clin 66: 115–132. https://www.ncbi.nlm.nih.gov/pubmed/26808342
Lee S and Margolin K (2011) Cytokines in cancer immunotherapy. Cancers (Basel) 3: 3856–3893. https://www.ncbi.nlm.nih.gov/pubmed/24213115
Castro F, Cardoso AP, Goncalves RM, Serre K and Oliveira MJ (2018) Interferon-Gamma at the Crossroads of Tumor Immune Surveillance or Evasion. Front Immunol 9: 847. https://www.ncbi.nlm.nih.gov/pubmed/29780381
Mosser DM and Edwards JP (2008) Exploring the full spectrum of macrophage activation. Nat Rev Immunol 8: 958–969. https://www.ncbi.nlm.nih.gov/pubmed/19029990
Yan Y, Zheng L, Du Q, Yazdani H, Dong K, Guo Y et al (2021) Interferon regulatory factor 1(IRF-1) activates anti-tumor immunity via CXCL10/CXCR3 axis in hepatocellular carcinoma (HCC). Cancer Lett 506: 95–106. https://www.ncbi.nlm.nih.gov/pubmed/33689775
Sakaguchi S, Yamaguchi T, Nomura T and Ono M (2008) Regulatory T cells and immune tolerance. Cell 133: 775–787. https://www.ncbi.nlm.nih.gov/pubmed/18510923
Zou W (2006) Regulatory T cells, tumour immunity and immunotherapy. Nat Rev Immunol 6: 295–307. https://www.ncbi.nlm.nih.gov/pubmed/16557261
Unitt E, Rushbrook SM, Marshall A, Davies S, Gibbs P, Morris LS et al (2005) Compromised lymphocytes infiltrate hepatocellular carcinoma: the role of T-regulatory cells. Hepatology 41: 722–730. https://www.ncbi.nlm.nih.gov/pubmed/15791620
Ormandy LA, Hillemann T, Wedemeyer H, Manns MP, Greten TF and Korangy F (2005) Increased populations of regulatory T cells in peripheral blood of patients with hepatocellular carcinoma. Cancer Res 65: 2457–2464. https://www.ncbi.nlm.nih.gov/pubmed/15781662
Yang XH, Yamagiwa S, Ichida T, Matsuda Y, Sugahara S, Watanabe H et al (2006) Increase of CD4 + CD25 + regulatory T-cells in the liver of patients with hepatocellular carcinoma. J Hepatol 45: 254–262. https://www.ncbi.nlm.nih.gov/pubmed/16600416
Gao Q, Qiu SJ, Fan J, Zhou J, Wang XY, Xiao YS et al (2007) Intratumoral balance of regulatory and cytotoxic T cells is associated with prognosis of hepatocellular carcinoma after resection. J Clin Oncol 25: 2586–2593. https://www.ncbi.nlm.nih.gov/pubmed/17577038
Fu J, Xu D, Liu Z, Shi M, Zhao P, Fu B et al (2007) Increased regulatory T cells correlate with CD8 T-cell impairment and poor survival in hepatocellular carcinoma patients. Gastroenterology 132: 2328–2339. https://www.ncbi.nlm.nih.gov/pubmed/17570208
Heller EA, Liu E, Tager AM, Yuan Q, Lin AY, Ahluwalia N et al (2006) Chemokine CXCL10 promotes atherogenesis by modulating the local balance of effector and regulatory T cells. Circulation 113: 2301–2312. https://www.ncbi.nlm.nih.gov/pubmed/16682613
Li CX, Ling CC, Shao Y, Xu A, Li XC, Ng KT et al (2016) CXCL10/CXCR3 signaling mobilized-regulatory T cells promote liver tumor recurrence after transplantation. J Hepatol 65: 944–952. https://www.ncbi.nlm.nih.gov/pubmed/27245433
Eufrasio de Figueiredo WM, Heredia FF, Santos AS, da Rocha Braga R, Marciano Fonseca FR, Lucia de Castro Rodrigues N et al (2019) CXCL10 treatment promotes reduction of IL-10(+) regulatory T (Foxp3(+) and Tr1) cells in the spleen of BALB/c mice infected by Leishmania infantum. Exp Parasitol 207: 107789. https://www.ncbi.nlm.nih.gov/pubmed/31669169
Lv Y, Cui M, Lv Z, Lu J, Zhang X, Zhao Z et al (2018) Expression and significance of peripheral myeloid-derived suppressor cells in chronic hepatitis B patients. Clin Res Hepatol Gastroenterol 42: 462–469. https://www.ncbi.nlm.nih.gov/pubmed/29753730
Zekri AN, El Deeb S, Bahnassy AA, Badr AM, Abdellateif MS, Esmat G et al (2018) Role of relevant immune-modulators and cytokines in hepatocellular carcinoma and premalignant hepatic lesions. World J Gastroenterol 24: 1228–1238. https://www.ncbi.nlm.nih.gov/pubmed/29568203
El-Badawy O, Sayed D, Badary M, Abd-Alrahman M, El-Feky M and Thabit A (2012) Relations of regulatory T cells with hepatitis markers in chronic hepatitis B virus infection. Human immunology 73: 335–341. https://www.sciencedirect.com/science/article/abs/pii/S0198885912000249?via%3Dihub

No competing interests reported.

Download PDF

Version 1

posted

You are reading this latest preprint version

L. reuteri FLRE5K1 inhibits the development and progression of hepatocellular carcinoma via activating the IFN-γ/CXCL10/CXCR3 pathway

Status:

Version 1

Abstract

Figures

Introduction

Materials And Methods

Results

Discussion

Declarations

References

Additional Declarations

Status:

Version 1