DOI: https://doi.org/10.21203/rs.3.rs-1599712/v1
Development of vast varieties of high yielding commercial poultry germplasm could possibly be due to rapid selection and controlled breeding. However, their maximum genetic production potential has not been achieved so far. Present study was conducted to analyse polymorphisms in egg- production associated microsatellite markers in sampled population of the selected strain of Rhode Island Red (RIR) chicken and to determine the association between various genotypes of polymorphic markers and layer production traits. One hundred and eleven pullets belonging to five hatches, maintained at institute’s farm, were used and data on body weight at 20 weeks of age (BW20) and layer economic traits (Age at sexual maturity (ASM), egg weight at 28 and 40 weeks of age (EW28, EW40) and egg production up to 40 weeks of age (EP40)) were analysed by least squares analysis of variance taking sire as random and hatch as fixed effects. Average ASM and EP40 were 135.19±1.15 days and 124.55±1.94 eggs, respectively. The BW20 revealed low, but positive genetic as well as phenotypic correlations with EP40 thereby suggesting its usefulness as selection criterion for genetic improvement of egg production. All egg production-associated microsatellite loci revealed polymorphism and exhibited prevalence of heterozygosity. The studied population demonstrated Hardy-Weinberg disequilibrium. Genotypes at two microsatellite loci ADL0023 and ADL0273 demonstrated significant effects on layer economic traits suggesting usefulness of microsatellite markers polymorphism in marker-assisted selection for genetic improvement of egg-production associated gene in chicken.
The poultry sector is fast growing in the developing country like India which plays a significant role in ensuring food-security. It has transformed from backyard farming to a vibrant organized industry during last three decades. The total poultry population of the country is 851.81 million, which has an increase of 16.81% over previous census of 2012 (Annual-Report, 2020). The annual egg production is approximately 103.32 billion pieces accounts for about 5.65% of the global egg production bringing India at 3rd position in egg production (Husbandry and Statistics, 2019). The egg production has increased by 8.5% over the previous year signifies the productivity of farm reared poultry birds.
Rhode Island Red is a dual-purpose breed and is more popular in the rural areas being well adapted to the local environmental conditions, more disease resistant and preferred by the small flock owners. It has gained more appreciation among consumers due to its brown shelled eggs and better egg producing ability.
Most of the economic traits in layer chicken are related to egg production which is limited to one sex only. Egg production traits are quantitative in nature and regions of the genome that control such traits are termed as quantitative trait loci (QTL). The markers flanking such QTL can be used in marker assisted selection to introduce or retain beneficial QTL alleles. The microsatellites at different chromosomal locations can detect such highly polymorphic QTLs to decipher genetic variability in the population, as they are repetitive DNA sequences and are randomly distributed throughout genome. The first genome scans to identify loci affecting egg quality traits have been based on medium-density microsatellite maps. Microsatellite (MS) markers are extensively used for determining genetic structure, diversity and relationships because of many advantages viz., higher degree of polymorphism, co-dominant inheritance, numerous and ubiquitous QTLs throughout the genome (Tautz, 1989). MS markers, by virtue of their co-dominancy and multiple-allelism proved to be efficient in genetic diversity studies, pedigree evaluation and genetic mapping (Ahlawat et al., 2004; Chatterjee et al., 2007; Das et al., 2015; Debnath et al., 2019) Chromosome 1 and 2 bears QTLs related to egg number and egg weight and chromosome 5 carries LOC395381 (ovomucin gene) related to reproductive function in chicken (Abasht et al., 2006a; Abasht et al., 2006b). Thus, these chromosomes have become most important for studying QTLs for production traits in poultry. In general, microsatellites explore maximum polymorphism in genome and thus the microsatellites located on these chromosomes have been considered important to explore the association of their variability with egg production traits. Moreover, most of the economic traits displayed a wide variation in the expression of genes at different loci, referred to as QTLs (Cheng et al., 1995). Several MS loci have been used to study the polymorphism in chicken breeds including White Leg Horn, RIR, Green-legged Partrigenous, Fayoumi, Alexandria etc. (Chatterjee et al., 2008a; Chatterjee et al., 2008b; Das et al., 2015; Radwan et al., 2014; Wardȩcka et al., 2002). Genetic variability at some MS loci have been reported to be associated with egg production traits such as age at sexual maturity (ASM), egg weight at 28 and 40 weeks (EW28 and EW40), egg production up to 40 weeks (EP40) of age etc. in RIRS (Das et al., 2015; Rahim, 2015). Hence, the present study was carried out to genotype the egg- production associated microsatellite markers in sampled population of the selected strain of Rhode Island Red (RIRS) chicken and to determine the association between polymorphic markers and layer production traits in RIRS chicken.
Blood sample (0.5-1 ml) was collected from jugular vein in heparinized (5 IU/ml) centrifuge tube from 111 experimental RIRS chicken belonging to five hatches. The samples were properly labelled and stored at -200C until further use. Genomic DNA was isolated from these samples by Phenol: Chloroform extraction method with slight modification (Sambrook and Russell, 2001; Das, 2013). Concentration and purity of genomic DNA were assessed by spectrophotometer using NanoDrop® ND-1000 Spectrophotometer (NanoDrop Technologies Inc., U.S.A.). The samples showing absorbance ratio (260/280) of ~ 1.8 (between 1.7 and 1.9) were considered as of satisfactory purity and used in further analysis. The Quality of extracted genomic DNA was assessed on 0.7% horizontal submarine Agarose Gel Electrophoresis and samples showing intact bands without smearing were considered good and used in further analysis.
A panel of 10 informative microsatellite markers having known association with egg production traits in various chicken breeds was identified from the published literatures (Chatterjee et al., 2008a; Das, 2013; Radwan et al., 2014). Forward and reverse primers were got synthesized from M/S Xcelris Genomics Labs Ltd., Ahmedabad (India). The nucleotide sequences of the primers and corresponding optimized annealing temperature are given in Table 1.
| Microsatellites | Chromosome location | Primer Sequence (5'-3') | Annealing temp. (0C) |
|---|---|---|---|
| ADL0023 | 5 | F: CTTCTATCCTGGGCTTCTGA R: CCTGGCTGTGTATGTGTTGC | 61 |
| ADL0158 | E29 | F: TGGCATGGTTGAGGAATACA R-TAGGTGCTGCACTGGAAATC | 52 |
| ADL0176 | 2 | F: TTGTGGATTCTGGTGGTAGC R: TTCTCCCGTAACACTCGTCA | 55 |
| ADL0273 | Z | F: GCCATACATGACAATAGAGG R: TGGTAGATGCTGAGAGGTGT | 55 |
| MCW0044 | 2 | F: AGTCCGAGCTCTGCTCGCCTCATA R: ACAGTGGCTCAGTGGGAAGTGACC | 63 |
| MCW0069 | 26 | F: GCACTCGAGAAAACTTCCTGCG R: ATTGCTTCAGCAAGCATGGGAGGA | 55 |
| MCW0103 | 3 | F: AACTGCGTTGAGAGTGAATGC R: TTTCCTAACTGGATGCTTCTG | 55 |
| MCW0110 | E48 | F: CATCTGTGTTACTGTCACAG R: TCAGAGCAGTACGCCGTGGT | 58 |
| MCW0145 | 1 | F: ACTTTATTCTCCAAATTTGGCT R: AAACACAATGGCAACGGAAC | 55 |
| MCW0 258 | Z | F: TTCTTAGTCCTTGCCAGAGGC R: CTGCAGGAGGATGTGTCCTAG | 55 |
The molecular sizes of amplified products were adjudged for their probable sizes through 2% horizontal agarose gel electrophoresis. Then, microsatellite alleles were identified by running the amplified products on 3.4% horizontal MetaPhor™ agarose gel electrophoresis (MAGE) (Debnath et al., 2017). The molecular sizes (bp) of all the alleles were determined with the help of Quantity One® software 4.6.8 (Bio-Rad Laboratories Inc., U.S.A.) through Gel Doc system. Genotypes of all the birds were determined on the basis of presence/ absence of microsatellite alleles.
Data on genotypes of all experimental birds at 10 microsatellites were compiled and analysed for their population genetics parameters using POPGENE® software 3.1 (Yeh, 1999). Average heterozygosity and Polymorphic Information Content (PIC) were calculated at each microsatellite locus (Nei, 1978; Botstein et al., 1980). Performance data recorded on all pullets were analysed for determining the association of various microsatellites genotypes with layer economic traits by least squares analysis of variance (LS ANOVA) incorporating microsatellite genotype as fixed effect in the model. The microsatellite-wise analysis was done for all the ten microsatellites using following model: -
Yijkl = µ + Si + Hj + Mk +eijkl
Where,
Yijkl = value of growth and layer economic traits measured on ijklth individual,
µ = Overall mean,
Si = Random effect of ith sire,
Hj = fixed effect of jth hatch (j = 1–5),
Mk = effect of kth genotype of a particular microsatellite marker (k = 1 - no. of alleles),
eijkl= random error (0, σ2).
Critical difference (CD) test at 5% level of significance was performed for comparing the least squares means under each microsatellite genotypes.
The results obtained for number of alleles, their sizes and frequencies at egg production associated microsatellites loci has been presented in Table 2. The average number of alleles per locus was 3.7, ranging from two to seven alleles at different loci and with frequency of 0.0146 to 0.9545. The size of most frequent allele was 204 bp at locus MCW0145 and least frequent one as 173 bp at MCW0069. Two to three alleles at various polymorphic loci with an average of 2.41 alleles per locus were reported across the breeds (Deshmukh et al., 2015). The polymorphic loci having two to six alleles with an average of 3.5 alleles and two to five alleles with average of 4 alleles per locus were observed in selected strain of Rhode Island Red chicken (Rahim et al., 2017). Thus, present findings were in close agreement to the earlier findings in chicken and demonstrated their applicability.
| Microsatellites | Chromosome location | No. of alleles | Allele code | Allele size (bp) | Allele frequency |
|---|---|---|---|---|---|
| ADL0023 | 5 | 3 | A | 190 | 0.1748 |
| B | 178 | 0.3398 | |||
| C | 172 | 0.4854 | |||
| ADL00158 | E29 | 4 | A | 212 | 0.0485 |
| B | 200 | 0.2524 | |||
| C | 194 | 0.6408 | |||
| D | 182 | 0.0583 | |||
| ADL0176 | 2 | 7 | A | 220 | 0.0340 |
| B | 215 | 0.2524 | |||
| C | 210 | 0.0583 | |||
| D | 205 | 0.2621 | |||
| E | 200 | 0.0971 | |||
| F | 195 | 0.2670 | |||
| G | 190 | 0.0291 | |||
| ADL0273 | Z | 3 | A | 150 | 0.0291 |
| B | 147 | 0.5243 | |||
| C | 144 | 0.4466 | |||
| MCW0044 | 2 | 4 | A | 150 | 0.0388 |
| B | 147 | 0.2621 | |||
| C | 141 | 0.4466 | |||
| D | 138 | 0.2525 | |||
| MCW0069 | 26 | 5 | A | 173 | 0.0146 |
| B | 169 | 0.1359 | |||
| C | 165 | 0.1893 | |||
| D | 161 | 0.1214 | |||
| E | 157 | 0.5388 | |||
| MCW0103 | 3 | 2 | A | 300 | 0.4854 |
| B | 292 | 0.5146 | |||
| MCW0110 | E48 | 4 | A | 116 | 0.2670 |
| B | 112 | 0.2718 | |||
| C | 104 | 0.2087 | |||
| D | 100 | 0.2525 | |||
| MCW0145 | 1 | 2 | A | 220 | 0.0485 |
| B | 204 | 0.9515 | |||
| MCW0258 | Z | 3 | A | 170 | 0.5340 |
| B | 158 | 0.4078 | |||
| C | 146 | 0.0582 | |||
| Mean ± SE | 3.70 ± 0.47 |
Nei’s heterozygosity of microsatellite (MS) loci was 0.55 ± 0.06 ranging from 0.09 (MCW0145) to 0.78 (ADL0176). Similar estimates for different microsatellites were reported of in various poultry breeds (Vijh and Tantia, 2004; Pandey et al., 2005). The observed and expected heterozygosity were 0.1922 ± 0.0687 and 0.5607 ± 0.06, respectively showing that the population was in Hardy-Weinberg disequilibrium. It might be due to the association of microsatellite loci with economic traits as the population was undergoing continuous selection for part-period egg production trait and was also small in size. Similar to the present findings, the observed and expected heterozygosities were reported in Ankaleshwar at ADL0023 as 0.333 and 0.804, at ADL0176 as 0.816 and 0.740 and at ADL0158 as 0.605 and 0.594, respectively (Pandey et al., 2005). There was a report of high observed and expected heterozygosities for ADL0023 (0.91 and 0.79), ADL0158 (0.92 and 0.72), ADL0176 (0.90 and 0.80), MCW0044 (0.27 and 0.49) and MCW0110 (0.73 and 0.73) loci in Kadaknath and Aseel breeds of chicken (Chatterjee et al., 2010a). Earlier reports (El-Sayed et al., 2011; Suh et al., 2014; Debnath, Kumar, Yadav, et al., 2015) also demonstrated similar estimates of observed and expected heterozygosities. The estimates were comparable to the earlier reports in RIR chicken. Five out of 10 MS loci had polymorphic information content (PIC) value more than 50%. The estimated average PIC value was 0.498 ± 0.06, which was ranging from 0.0880 (MCW0145) to 0.7489 (ADL0176), respectively and were in accordance with the earlier findings in RIR population (Vijh and Tantia, 2004; Pandey et al., 2005), although a few contrary reports are also available for the studied MS loci (Chatterjee et al., 2008a, Chatterjee et al., 2010; Deshmukh et al., 2015). The differences in PIC values may be due to the differences in genetic architecture of population analyzed or due to loss or fixation of some of the alleles during long-term selection.
The least squares analysis of variance of body weight at 20 weeks of age (BW20) and various layer economic traits viz., age at sexual maturity (ASM), egg weight at 28 (EW28) and 40 (EW40) weeks of age and egg production up to 40 (EP40) weeks of age presented in Table 3. Sire had significant effect on layer traits EW40 and EP40. Hatch had significant effect (P ≤ 0.05) on ASM and EW28. The least squares mean for BW20 and layer economic traits viz., ASM, EW28, EW40 and EP40 have been presented in Table 4. The overall least-squares mean of ASM, EW28, EW40 and EP40 were 134.98 ± 1.30days, 42.54 ± 0.32g, 48.15 ± 0.56g and 121.47 ± 2.44eggs, respectively. Least-squares means of body weight revealed that the birds of 1st hatch showed highest BW20 (1378.27 ± 53.33g) followed by 3rd (1372.71 ± 48.13g), 4th (1347.96 ± 32.32g), 5th (1336.05 ± 35.63g) and 2nd (1280.58 ± 54.93g) hatch. Least squares mean of layer economic traits also revealed that pullets of 5th hatch showed highest EW28 (44.84 ± 0.66g), and 2nd hatch showed highest EW40 (49.96 ± 1.26g), and 1st hatch showed highest EP40 (127.92 ± 5.55). Though, same management practices followed for all the hatches, still there was significant hatch effect. It might be due to micro-environmental variability as well as quick environmental fluctuations among the hatches which were beyond the human control. Similar findings were reported for significant hatch effect on early egg weights (Smith and Bohren, 1975), on egg production (King and Henderson, 1954) and on ASM in the coloured Punjab Broiler-II (PB2) dam line (Nwagu et al., 2007; Das, 2013; Debnath, Kumar, Bhanja, et al., 2015).
| Source of variation | df | Mean sum of squares | ||||
|---|---|---|---|---|---|---|
| ASM | BW20 | EW28 | EW40 | EP40 | ||
| Sire | 27 | 121.05 | 22286.35 | 7.13 | 19.82* | 375.81* |
| Hatch | 4 | 380.73* | 11556.03 | 23.13** | 20.98 | 143.70 |
| Error/ Remainder | 59 | 115.30 | 21695.30 | 6.22 (55) | 10.17 (55) | 203.91 (55) |
| df = Degrees of freedom; *P < 0.05; **P < 0.01; Figures within parentheses denote degrees of freedom | ||||||
| Factors | Least squares mean ± standard errors | ||||||
|---|---|---|---|---|---|---|---|
| N | ASM (days) | BW20 (g) | EW28 (g) | EW40 (g) | EP40 | ||
| Overall | 91 | 134.98 ± 1.30 | 1343.12 ± 17.65 | 42.54 ± 0.32 (87) | 48.15 ± 0.56 (87) | 121.47 ± 2.44 (87) | |
| Hatch | 1 | 12 | 140.75 ± 3.89a | 1378.27 ± 53.33 | 41.39 ± 0.92b | 47.56 ± 1.23 | 127.92 ± 5.55 |
| 2 | 9 | 132.54 ± 4.01cd | 1280.58 ± 54.93 | 42.71 ± 0.94b | 49.96 ± 1.26 | 123.16 ± 5.66 | |
| 3 | 12 | 139.86 ± 3.51ab | 1372.71 ± 48.13 | 41.47 ± 0.82b | 47.25 ± 1.12 | 119.46 ± 5.01 | |
| 4 | 28 | 134.77 ± 2.36bc | 1347.96 ± 32.32 | 42.29 ± 0.567b | 46.74 ± 0.81 | 119.64 ± 3.60 | |
| 5 | 30 | 126.99 ± 2.60d | 1336.05 ± 35.63 | 44.84 ± 0.66a (26) | 49.24 ± 0.93 (26) | 117.17 ± 4.10 (26) | |
| N = Number of observations; Means with same superscript in a column do not differ significantly (P ≤ 0.05); Figures within parentheses denote number of observations. | |||||||
Genetic parameters, viz., heritability, genetic and phenotypic correlations amongst body weight at 20 weeks of age (BW20) and various layer economic traits have been presented in Table 5. The heritability estimate for BW20 was 0.38 ± 0.48. Quite comparable heritability estimates with present investigation were reported by some of the researchers (Das, 2013; Qadri et al., 2013; Rahim et al., 2017). However, some authors have reported high heritability for BW20 chicken (Jilani et al., 2005), which might be due to differences in the genetic stocks evaluated. The heritability estimates were high for ASM (0.49 ± 0.48), EW40 (0.97 ± 0.50) and EP40 (0.86 ± 0.50), but low for EW28 (0.19 ± 0.46). Similar heritability for ASM has been reported by earlier researchers also (Laxmi et al., 2010; Rahim, 2015). Lower heritability estimates indicated that it was difficult to improve this trait through genetic selection. However, contrary to the present findings, some workers have reported lower heritability estimate for EW28, EW40 and EP40 (Barot et al., 2008; Anees et al., 2010; Rajkumar et al., 2011; Vasu et al., 2022). Genetic correlations (rG) of BW20 with EW28 and EW40 were positive, but negative with EP40. The rG of ASM with BW20, EW28 and EP40 were negative, but positive with EW40. The rG of EW28 was positive with EW40, but negative with EP40. The rG of EW40 was negative with EP40. The phenotypic correlations (rP) of ASM with all other traits were negative except EW28. The rP of BW20 was positive with EW28, EW40 and EP40. The rP of EW28 was positive and high with EW40, but negative with EP40. Likewise, EW40 had negative rP with EP40. Similar negative genetic correlations of ASM with layer traits have also been reported earlier (Laxmi et al., 2010; Qadri et al., 2013; Rahim, 2015). A few earlier reports demonstrated that BW20 had positive genetic correlations with EW28 and EW40 (Das et al., 2015), and negative with ASM and EP40 in selected strain of RIR chicken (Rahim, 2015).
| Traits | ASM | BW20 | EW28 | EW40 | EP40 |
|---|---|---|---|---|---|
| ASM | 0.49 ± 0.48 (91) | -0.74 ± 1.18 (91) | -0.49 ± 1.27 (87) | 0.34 ± 0.59 (87) | -0.58 ± 0.77 (87) |
| BW20 | -0.26 (91) | 0.38 ± 0.48 (91) | 0.59 ± 1.26 (87) | 0.12 ± 0.60 (87) | -0.06 ± 0.62 (87) |
| EW28 | 0.005 (87) | 0.16 (87) | 0.19 ± 0.46 (87) | 0.20 ± 0.77 (87) | -0.32 ± 1.06 (87) |
| EW40 | -0.06 (87) | 0.14 (87) | 0.46 (87) | 0.97 ± 0.50 (87) | -0.62 ± 0.47 (87) |
| EP40 | -0.28 (87) | 0.07 (87) | -0.16 (87) | -0.05 (87) | 0.86 ± 0.50 (87) |
| Figures within parentheses denote number of observations | |||||
All the experimental birds were genotyped for their profiles for 10 microsatellites, all of them were found polymorphic. Least squares analysis of variance of layer economic traits to determine the effects of MS genotypes taking it as independent factor in the model and MS genotype-wise LS means of various traits are given in Table 6 and Table 7, respectively.
| Source of variation | Mean sum of squares | |||||
|---|---|---|---|---|---|---|
| df | ASM | BW20 | EW28 | EW40 | EP40 | |
| ADL0023 | 3 | 58.47 | 80830.27** | 5.72 | 4.90 | 188.24 |
| ADL0158 | 3 | 239.98 | 5697.87 | 5.20 | 10.57 | 144.30 |
| ADL0176 | 8 | 117.34 | 20385.26 | 8.21 | 5.44 | 77.99 |
| ADL0273 | 2 | 67.69 | 58488.71$ | 25.18* | 14.31 | 2.36 |
| MCW0044 | 3 | 133.52 | 17993.42 | 3.03 | 1.93 | 23.12 |
| MCW0069 | 6 | 48.24 | 6015.21 | 6.03 | 13.92 | 286.92 |
| MCW0103 | 1 | 34.45 | 20299.47 | 4.19 | 0.15 | 9407.69 |
| MCW0110 | 8 | 96.61 | 24455.32 | 8.941 | 10.07 | 72.59 |
| MCW0145 | 1 | 3.28 | 52603.44 | 0.06 | 13.69 | 11.20 |
| MCW0258 | 4 | 37.68 | 20809.26 | 11.17 | 11.53 | 41.17 |
| df = Degrees of freedom; $P ≤ 0.07; *P ≤ 0.05; **P ≤ 0.01 | ||||||
| Microsatellite | Genotype | Least squares mean ± standard error | ||||
| ASM (days) (n = 110) | BW20 (g) (n = 110) | EW28(g) (n = 108) | EW40(g) (n = 103) | EP40 (n = 110) | ||
| ADL0023 | AA | 132.832 ± 3.63 | 1496.34a ± 45.52 | 42.18 ± 0.89 | 48.08 ± 1.20 | 118.07 ± 5.42 |
| BB | 136.63 ± 2.88 | 1295.52b ± 36.01 | 42.54 ± 0.68 | 47.39 ± 0.94 | 124.39 ± 4.27 | |
| CC | 134.62 ± 2.63 | 1325.76 b ± 32.89 | 42.77 ± 0.63 | 48.74 ± 0.93 | 126.14 ± 4.23 | |
| AB | 141.50 ± 6.25 | 1334.04b ± 78.34 | 40.04 ± 1.47 | 48.81 ± 2.11 | 134.72 ± 9.45 | |
| ADL0158 | BB | 139.76 ± 3.97 | 1313.12 ± 55.98 | 42.09 ± .95 | 47.85 ± 1.25 | 121.65 ± 5.71 |
| CC | 135.66 ± 2.30 | 1351.37 ± 30.93 | 42.56 ± .52 | 47.90 ± .81 | 124.06 ± 3.69 | |
| DD | 134.36 ± 4.99 | 1398.58 ± 70.83 | 44.16 ± 1.21 | 48.89 ± 1.64 | 124.51 ± 7.51 | |
| AB | 125.74 ± 4.69 | 1326.84 ± 66.44 | 41.27 ± 1.13 | 50.37 ± 1.46 | 132.48 ± 6.68 | |
| ADL0176 | BB | 137.20 ± 3.23 | 1276.81 ± 44.50 | 43.26 ± 0.76 | 47.63 ± 1.04 | 120.52 ± 4.86 |
| DD | 135.47 ± 3.69 | 1435.39 ± 50.86 | 44.01 ± 0.87 | 48.86 ± 1.19 | 127.38 ± 5.54 | |
| FF | 132.79 ± 5.22 | 1285.72 ± 71.94 | 40.17 ± 1.21 | 47.38 ± 1.64 | 123.65 ± 7.549 | |
| AB | 120.25 ± 9.27 | 1396.75 ± 127.90 | 40.67 ± 2.16 | 52.57 ± 2.85 | 112.61 ± 13.06 | |
| AD | 136.68 ± 8.68 | 1490.25 ± 119.72 | 43.67 ± 2.02 | 48.50 ± 2.73 | 126.17 ± 12.53 | |
| CD | 134.81 ± 7.30 | 1363.10 ± 100.67 | 43.75 ± 1.70 | 49.81 ± 2.26 | 127.69 ± 10.39 | |
| CE | 138.76 ± 5.95 | 1375.91 ± 82.01 | 41.79 ± 1.39 | 47.37 ± 1.85 | 133.77 ± 8.52 | |
| EF | 125.40 ± 8.30 | 1154.59 ± 114.42 | 41.31 ± 1.94 | 46.83 ± 2.58 | 122.25 ± 11.84 | |
| EG | 142.39 ± 6.23 | 1302.03 ± 85.90 | 40.65 ± 1.45 | 48.25 ± 1.92 | 122.92 ± 8.85 | |
| ADL0273 | AA | 137.60 ± 5.85 | 1530.30a ± 77.34 | 45.01a ± 1.50 | 52.41 ± 2.31 | 124.32 ± 10.63 |
| BB | 136.59 ± 2.17 | 1365.01b ± 28.79 | 43.26a ± 0.58 | 48.33 ± 0.97 | 124.26 ± 4.36 | |
| CC | 132.87 ± 2.79 | 1305.50c ± 36.95 | 41.16b ± 0.69 | 47.76 ± 1.08 | 125.01 ± 4.88 | |
| MCW0044 | AA | 139.43 ± 7.51 | 1373.84 ± 103.81 | 43.78 ± 1.81 | 47.28 ± 2.29 | 119.00 ± 10.42 |
| BB | 136.93 ± 3.27 | 1293.06 ± 44.97 | 41.91 ± 0.79 | 47.99 ± 1.06 | 124.58 ± 4.85 | |
| CC | 132.84 ± 2.63 | 1371.75 ± 36.10 | 42.58 ± 0.63 | 48.48 ± 0.87 | 125.23 ± 4.012 | |
| DD | 139.11 ± 3.76 | 1364.84 ± 51.83 | 43.03 ± 0.90 | 47.78 ± 1.18 | 123.58 ± 5.41 | |
| MCW0069 | CC | 134.37 ± 5.17 | 1285.23 ± 71.38 | 43.81 ± 1.19 | 48.28 ± 1.57 | 134.50 ± 7.08 |
| DD | 133.63 ± 4.96 | 1332.67 ± 68.52 | 41.85 ± 1.16 | 50.83 ± 1.60 | 127.40 ± 7.23 | |
| EE | 134.90 ± 2.79 | 1366.64 ± 38.53 | 42.80 ± 0.66 | 48.42 ± 0.90 | 118.57 ± 4.06 | |
| AE | 142.48 ± 7.04 | 1414.44 ± 97.26 | 39.40 ± 1.92 | 42.22 ± 2.36 | 133.09 ± 10.65 | |
| BD | 134.30 ± 5.50 | 1359.18 ± 76.06 | 42.12 ± 1.28 | 48.88 ± 1.62 | 135.38 ± 7.29 | |
| BE | 132.58 ± 3.19 | 1347.84 ± 44.17 | 41.90 ± 0.74 | 47.54 ± 1.02 | 121.75 ± 4.59 | |
| CE | 137.83 ± 3.53 | 1325.33 ± 48.84 | 42.87 ± 0.81 | 48.28 ± 1.06 | 126.98 ± 4.77 | |
| MCW0103 | AA | 134.39 ± 1.84 | 1366.63 ± 24.88 | 42.20 ± 0.43 | 48.18 ± 0.61 | 125.99 ± 2.78 |
| BB | 135.91 ± 1.78 | 1329.67 ± 24.06 | 42.73 ± 0.41 | 48.18 ± 0.58 | 123.32 ± 2.69 | |
| MCW0110 | AA | 136.66 ± 3.66 | 1301.64 ± 48.78 | 42.89 ± 0.84 | 48.74 ± 1.14 | 123.16 ± 5.41 |
| BB | 136.65 ± 3.75 | 1265.68 ± 50.04 | 41.37 ± 0.89 | 46.89 ± 1.23 | 125.93 ± 5.83 | |
| CC | 136.93 ± 6.88 | 1336.34 ± 92.10 | 42.01 ± 1.57 | 46.61 ± 2.02 | 120.81 ± 9.62 | |
| DD | 139.42 ± 4.90 | 1409.39 ± 65.53 | 44.05 ± 1.13 | 50.80 ± 1.47 | 122.14 ± 6.97 | |
| AC | 135.38 ± 3.21 | 1382.04 ± 42.71 | 41.95 ± 0.78 | 48.57 ± 1.05 | 124.46 ± 4.99 | |
| AD | 134.43 ± 5.89 | 1402.08 ± 78.85 | 40.80 ± 1.34 | 50.72 ± 1.74 | 134.03 ± 8.28 | |
| BC | 121.14 ± 7.32 | 1532.04 ± 98.12 | 45.80 ± 2.07 | 49.18 ± 2.67 | 127.92 ± 12.69 | |
| BD | 131.87 ± 3.23 | 1362.80 ± 43.04 | 43.68 ± 0.76 | 47.47 ± 1.026 | 122.01 ± 4.84 | |
| CD | 135.61 ± 6.41 | 1407.59 ± 85.91 | 43.51 ± 1.46 | 48.85 ± 1.89 | 131.12 ± 8.97 | |
| MCW0145 | BB | 135.12 ± 1.83 | 1356.02 ± 24.24 | 42.49 ± 0.42 | 48.03 ± 0.72 | 124.69 ± 3.28 |
| AB | 135.88 ± 3.69 | 1260.51 ± 49.40 | 42.39 ± 0.87 | 49.70 ± 1.22 | 123.18 ± 5.60 | |
| MCW0258 | AA | 136.50 ± 3.46 | 1303.88 ± 46.46 | 41.70 ± 0.79 | 47.55 ± 1.07 | 124.37 ± 4.88 |
| BB | 132.67 ± 3.64 | 1358.95 ± 48.84 | 42.37 ± 0.84 | 48.29 ± 1.13 | 125.58 ± 5.18 | |
| CC | 130.58 ± 11.37 | 1596.32 ± 152.53 | 48.87 ± 2.57 | 53.71 ± 3.35 | 118.54 ± 15.62 | |
| AB | 136.53 ± 4.27 | 1361.60 ± 57.31 | 43.15 ± 0.97 | 49.06 ± 1.35 | 125.94 ± 6.22 | |
| BC | 135.61 ± 7.01 | 1358.21 ± 94.03 | 41.76 ± 1.59 | 46.04 ± 2.06 | 118.57 ± 9.61 | |
| N = Number of observations; Means with same superscript in a column do not differ significantly (P < 0.05 and P < 0.07); Figures within parentheses denote number of observations. | ||||||
Genotypes at two MS loci (ADL0023 and ADL0273) were revealed significant (P ≤ 0.01) effects on layer economic traits. AA genotype at ADL0023 had revealed highest body weight (1496.34 ± 45.52 g) at BW20 which was statistically higher than those pullets having genotypes BB (1295.52 ± 36.01g), CC (1325.76 ± 32.89g) or AB (1334.04 ± 78.34g). Significant effect of genotypes at ADL0023 on BW20 had been reported by earlier researchers also (Chatterjee et al., 2008b; Das et al., 2015; Debnath et al., 2019; Rahim et al., 2017; Wardȩcka et al., 2002). ADL0273 genotypes had significant effect on BW20 (P ≤ 0.07) and EW28 (P ≤ 0.05). The pullets with AA genotype at this locus showed highest BW20 as 1530.30 ± 77.34g which was statistically higher than those pullets having BB (1365.01 ± 28.79g) and CC (1305.50 ± 36.95g). AA genotyped pullets revealed highest EW28 (45.01 ± 1.50g) which was statistically different than CC (41.16 ± 0.69g) genotyped birds, but did not differ from BB (43.26 ± 0.58g) genotyped birds. Similar to the present findings, earlier researchers had reported significant effect ADL0273 genotypes on ASM, BW20 and EW28 (Chatterjee et al., 2010b; Das et al., 2015; Debnath et al., 2015b; Radwan et al., 2014; Rahim, 2015). The rest of the MS-genotypes at other loci did not differ significantly for any of the layer economic traits. The non-significant effect of MS-genotypes at these loci was supported by previous reports (Chatterjee et al., 2008a; Das et al., 2015). Contrary to the present findings some of the reports suggested significant effect of genotypes at ADL0158, ADL0176, MCW0069, MCW0103, MCW0110, MCW0145 and MCW0258 on egg production and egg weight (Roushdy et al., 2008; Rahim et al., 2017).
The ASM in the studied population followed similar trend over the generations. The body weight at 20-weeks of age revealed low, but positive genetic as well as phenotypic correlations with egg production up to 40 weeks thereby suggesting its usefulness as selection criterion for genetic improvement of egg production. Owing to the high association of AA genotype at ADL0023 MS loci with body weight at 20 weeks and AA genotype at ADL0273 with body weight at 20 and egg weight at 28 weeks, they demonstrated as promising markers for genetic improvement of layer traits in poultry and may be used in future breeding programs.
Authorship contribution statement
Amiya Ranjan Sahu: Investigation, blood sample collection, DNA isolation, production data recording and statistical analysis, chemical reactions and gel documentation, molecular sizing, review and original draft writing. Sanjeev Kumar: Concept of work, project administration, Resource and budget handling, statistical analysis and manuscript editing. Sonu Kumar Jain: Blood sample collection, data recording and gel documentation. Chethan Raj R.: DNA isolation, chemical reactions and gel documentation.
Acknowledgements
Authors are thankful to the Directors of ICAR-Indian Veterinary Research Institute, Izatnagar and ICAR-Central Avian Research Institute, Izatnagar, India for providing the research facilities. The Senior Research Fellowship granted by the Indian Council of Agriculture Research, New Delhi, India to the first author for this Ph.D. research work is also acknowledged.
Disclosure statement
No potential conflict of interest was reported by the authors.
Funding agency
Indian Council of Agricultural Research, New Delhi, India.
Consent to participate
The corresponding author is willing to participate in reviewing the manuscripts submitted to this journal.
Compliance with ethical standards
The samplings from experimental birds were done in accordance with the ethical standards approved by Institute Animal Ethical Committee.
Data availability statements
All the data are available from the sources cited in the Materials and methods and from the authors upon request.