Chrysophanol post-conditioning attenuated cerebral ischemia-reperfusion injury induced NLRP3-related pyroptosis in a TRAF6-dependent manner

doi:10.21203/rs.3.rs-1603607/v1

Download PDF

Research Article

Chrysophanol post-conditioning attenuated cerebral ischemia-reperfusion injury induced NLRP3-related pyroptosis in a TRAF6-dependent manner

https://doi.org/10.21203/rs.3.rs-1603607/v1

This work is licensed under a CC BY 4.0 License

Version 1

posted

You are reading this latest preprint version

Background: Pyroptosis induces neuronal death by triggering an excessive inflammatory injury. Chrysophanol possesses robust anti-inflammatory features, and it is protective against CIRI. The purpose of this research was to assess the effect of Chrysophanol post-treatment on CIRI-induced pyroptotic cell death, and to explore its underlying mechanisms.

Methods: CIRI was induced in rats by CA and subsequent cardiopulmonary resuscitation, and PC12 cells were exposed to oxygen-glucose deprivation/reoxygenation (OGD/R) to imitate CIRI in vitro. The survival rate, neurological outcomes, histopathological changes and cognitive functions were examined to explore the neuroprotection mediated by Chrysophanol post-conditioning. Pyroptosis-associated proteins were quantified by qRT-PCR and western blot both in vivo and in vitro model. Meanwhile, gain- and loss-of-function analyses of NLRP3 or TRAF6 were also performed to evaluate their effects on Chrysophanol-mediated anti-pyroptotic signaling pathway. Finally, the interaction between NLRP3 and TRAF6 was detected in Chrysophanol-treated PC12 cells.

Results: It was found that post-CA brain injury led to a notable cerebral damage by examining histopathological changes and neurological outcomes. The existence of pyroptosis was also confirmed in in vivo and in vitro CIRI models. Moreover, we further confirmed that post-treatment with Chrysophanol, the main bioactive ingredient of Rhubarb, significantly suppressed expressions of pyroptosis-associated proteins, e.g., NLRP3, ASC, cleaved-caspase-1 and N-terminal GSDMD, and inhibited the expression level of tumor necrosis factor receptor-associated factor 6 (TRAF6). Furthermore, NLRP3 overexpression neutralized the neuroprotection of Chrysophanol post-treatment, suggesting that pyroptosis was the major neuronal death pathway modulated by Chrysophanol post-treatment in OGD/R. Additionally, the neuroprotection of Chrysophanol post-treatment was also abolished by gain-of-function analyses of TRAF6. Finally, the results demonstrated that Chrysophanol post-treatment suppressed the interaction between TRAF6 and NLRP3.

Conclusions: Taken together, our findings revealed that Chrysophanol post-treatment could be protective against CIRI by inhibiting NLRP3-related pyroptosis via a TRAF6-dependent manner.

cardiac arrest

cerebral ischemia-reperfusion injury

pyroptosis

Chrysophanol

TRAF6

Cardiac arrest (CA) is one of the frequent causes of death worldwide [1, 2]. Cases who successfully received resuscitation after CA still have high rates of in-hospital mortality and disability, mainly due to neurological impairments induced by irreversible brain injury [3]. Although new and effective therapeutic techniques are continuously developed, the survival rate of patients suffering from post-CA brain injury (PCABI) still remains extremely low [4]. Thus, early diagnosis and treatment of neurological outcomes after CA are vital for clinical settings.

Although the possible underlying mechanism of PCABI has not been fully explored, neuroinflammation has been widely recognized because of its essential role[5, 6]. As a kind of mediated necrosis, pyroptosis refers to cell death caused by cell lysis related to inflammation [7]. The prominent features of pyroptosis are closely related to the rapid plasma-membrane rupture and the leakage of a large number of pro-inflammatory intracellular products [7, 8]. Emerging evidence has demonstrated that activation of NOD-like receptor pyrin domain-containing protein 3 (NLRP3)-related inflammasomes promoted the transformation of procaspase-1 into caspase-1, subsequently enhanced maturation of IL-1β and IL-18, and GSDM (cleaved gasdermin) family, eventually leading to the pyroptosis [9]. Recent studies have reported that NLRP3 inflammasome activation-mediated pyroptosis pathway is associated with cerebral ischemia-reperfusion injury (CIRI) [10-12]. Nevertheless, few studies have concentrated on the exact role and significance of pyroptosis in PCABI.

Chrysophanol, known as a natural anthraquinone, possesses several pharmacological effects, including anti-oxidative, anti‑inflammatory [13], anti-fibrotic [14], and anti-cancer activities [15]. The data from in vitro or in vivo studies have proved that Chrysophanol, an important bioactive component of Rhubarb, is a potential candidate to inhibit inflammation by regulating macrophage activities and suppressing the expression levels of pro-inflammatory cytokines through nuclear factor-κB (NF-κB) signaling pathway [16, 17]. Furthermore, Chrysophanol showed a neuroprotective effect through inhibiting mitochondrial autophagy [18] and attenuation of endoplasmic reticulum (ER) stress response [19]. However, it has still remained elusive whether the protection provided by Chrysophanol is involved in NLRP3-related pyroptosis during CIRI.

As cerebral ischemia is rarely preventable, numerous studies have concentrated on the intervention in the reperfusion period. A great number of studies have recently reported that potent pharmacological agents applied at the onset of reperfusion could significantly reduce the incidence of CIRI [20, 21]. Hence, whether Chrysophanol post-treatment has robust protective effects against CIRI needs to be elucidated. Increasing evidence suggested that Chrysophanol has markedly attenuated cerebral injury after focal CIRI, which could be partly attributed to its anti-oxidative stress [22] or anti-inflammatory effects[23]. Moreover, Chrysophanol may alleviate the ischemic brain damage via decreasing the activation of NLRP3 inflammasomes [24]. Therefore, it was hypothesized that the protective roles of Chrysophanol post-treatment in CIRI was associated with suppressed NLRP3-related pyroptosis.

Tumor necrosis factor receptor-associated factor 6 (TRAF6), belonging to TRAF protein family, has been recently reported to participate in inflammatory responses through different intracellular signaling pathways [25, 26]. For instance, TRAF6 promoted the activation of NF-κB, which was subsequently translocated to nuclei, resulting in increased transcriptions of pro-inflammatory cytokines [27]. In addition, TRAF6-associated pro-inflammatory activity critically contributed to the progression of myocardial [28] and hepatic [29] ischemia-reperfusion injury. Of note, suppression of TRAF6 significantly decreased the pyroptosis-associated inflammatory reactions [30], while overexpression of TRAF6 remarkably promoted pyroptosis through the caspase‑1/3 signaling pathways [26]. Hence, TRAF6 is characterized as a novel pro-inflammatory regulator. However, the effect of TRAF6 on NLRP3-related pyroptosis in CIRI is still unclear.

Hence, the purpose of this research was to assess the effect of Chrysophanol post-treatment on CIRI-elicited pyroptotic cell death, and to explore its underlying protective mechanisms.

Experimental animals

Experimental procedures were conducted according to the international ethics guidelines after approval by the Ethics Committee of Xiangya Hospital of Central South University (Changsha, China). Male Sprague-Dawley rats, weighing 300-350 g, were obtained from Silaikejingda Co., Ltd. (Changsha, China). Rats were maintained under optimal conditions (50% humidity, twenty-five centigrade degree, and a 12:12 light/dark cycle), and fed appropriately for seven days prior to the experiments.

Experimental model

A total of 156 SPF (specific-pathogen free)-level male adult Sprague-Dawley rats were classified into three groups randomly. CA/CPR (cardiopulmonary resuscitation) was not induced in the sham-operated group (30 rats), while all other surgical steps were carried out. We constructed the CA/CPR model based on the literature with some modifications [31]. Rats were anesthetized with an intraperitoneal injection of 2% sodium pentobarbital (4 mg/100g; B5646; ApexBio, Shanghai, China), and the trachea was intubated with a 14-gauge cannula. The right carotid vein was cannulated by PE-50 tubing for central venous pressure monitoring and medical administration. The right carotid artery was cannulated with a PE-25 tube, which was connected to a pressure transducer (BL-420S; Chengdu Taimeng Software Co., Ltd., Chengdu, China) for real-time monitoring of blood pressure. Cardiac rhythm was monitored using a three-lead ECG (electrocardiogram) with electrocardiograph leads inserted subcutaneously into the chest wall. Core body temperature was maintained at 37 °C by a thermistor-controlled heat lamp. The incision sites were infiltrated with 0.5% ropivacaine (AstraZeneca, Cambridge, UK) for postoperative analgesia. CA was induced using vecuronium (2 mg/kg; Mylan Institutional LLC., Rockford, IL, USA), followed by disconnection of the ventilator and obstruction of the intubation tube. Ten minutes later, CPR was commenced, which included administration of 10 μg/ml epinephrine (100 μg/kg; Hefeng Co., Ltd., Beijing, China) and 0.5 ml 5% sodium bicarbonate (Huiyinbi Co., Ltd., Shanghai, China) through the jugular vein. Chest compressions were performed, followed by ventilation using a volume-controlled small animal ventilator (provided by Beijing Zhong Shi Di Chuang Science and Technology Development Co. Ltd., Beijing, China). Additional dose of sodium bicarbonate was administered 5 min after CPR according to the arterial blood pressure. Blood gas analysis was carried out 10 min before and after ROSC (return of spontaneous circulation), which was defined as an “organized cardiac rhythm with a mean arterial pressure of ≥ 50 mmHg, which is sustained continuously for at least 10 min.” Rats without ROSC following standard CPR for 15 min were defined as resuscitation failure.

After CA/CPR, survivors were randomly divided into CA group and CA + Chrysophanol (CA+CHR) group, respectively. Chrysophanol (purchased from National Institutes for Food and Drug Control, Beijing, China) with a purity of more than 98% was dissolved in 0.9% NaCl with 1% DMSO (dimethyl sulfoxide) and 1% Tween-80 before the treatments. Chrysophanol (10 mg/kg) was intraperitoneally administered at 24 h after CA/CPR, followed by every 24 h for 7 consecutive days. Rats in the sham and CA groups were administered a corresponding volume of saline with 1% DMSO and 1% Tween-80 that would serve as vehicle. Body weight and the survival rates were evaluated before or at 3 and 7 days after intraperitoneal administration, respectively.

To establish a CIRI model in vitro, PC12 cells were exposed to OGD/R (oxygen-glucose deprivation/reoxygenation) to imitate CIRI. Briefly, PC12 cells were washed with PBS (phosphate-buffered saline), and then, cultured in a glucose-free medium. The PC12 cells were cultured in an incubator chamber (3110; Thermo Fisher Scientific, Waltham, MA, USA) under conditions of 95% N₂ and 5% CO₂ for 6 h, and then, were discarded to culture in a medium containing glucose for one day under conditions of 95% O₂and 5% CO₂ [32]. For in vitro studies, PC12 cells were acutely treated with Chrysophanol, an important component of Rhubarb, which was firstly manufactured into stock solution, then diluted into different concentrations (0, 10, 50, 100, 200 μM) and subsequently subjected to re-oxygenation to induce pharmacological post-conditioning. After 4 cycles of Chrysophanol administration (60-min Chrysophanol treatments with an interval of 60 min), the Chrysophanol-containing culture medium was replaced with a normal medium. The treatment with MCC950 (10 μM) or necrosulfonamide (10 μM, NSA) was performed similar to Chrysophanol to clarify the role of pyroptosis in OGD/R. Each experiment was carried out at least three times.

Neurological deficit score

Each rat was scored according to the mNSS (modified neurological severity score) [33]determined by charts at 1, 3, and 7 days after CA/CPR. Scores ranged from 0 (normal) to 18 (most severe neurological damage).

MWM (Morris water maze) test

The steps of MWM test was consistent with the previous literature [34]. In order to assess memory and spatial learning, we placed the animals in a circular pool which was 1.6 m in diameter and 60 cm in height. A platform of 12 cm was immersed in the water (2.0 cm below the water), and the temperature was maintained at 25 ± 1℃. The swimming path and escape latency were recorded automatically. Into a quiet room with visual cue decoration the water maze containing four quadrants was put. We placed the animals into the maze at diverse beginning sites, which were trained to identify a platform without signs. The maximum trial duration was 120 seconds for each trial, and four trials were performed daily. One day after the terminal training session, the probe trial was performed. We removed the platform, and the memory of the animals concerning the platform sites was assessed. We recorded the time spent on the target quadrant and the number of times that each rat was crossed over the exact location of the former platform. After the test, the animals were killed for histological examination.

Determination of brainwater content

The brain tissues (n = 5, per group) were dried at 105 °C for one day to detect the dry weight. Then, brain water content (%) was defined as follows: brain water content (%) = [(wet weight－dry weight)/wet weight × 100%].

Histological examination

After the observation period, a certain brain tissue was selected from each group to assess the histological changes of hippocampus, because the CA1 area is sensitive to ischemia following cerebral injury. The brains were fixed in paraformaldehyde solution, and then, embedded into paraffin. Sections (5 µm) were formed, and deparaffinized, followed by H&E (hematoxylin and eosin) staining, Nissl staining, and TUNEL (terminal deoxynucleotidyl transferase dUTP nick end labeling) staining. Nissl-positive and TUNEL-positive cells are counted. Sections were examined in a random order under a light microscope with magnifications of 100× and 400× by an investigator who was blinded to grouping. At high magnifications, the number of positive cells in 4 fields of view was randomly counted, and the average number of positive cells was calculated.

Enzyme-linked immunosorbent assay (ELISA)

Before harvesting the brain tissues, blood collection needles and tubes were used to collect blood from the left ventricle, which was placed at -4℃ overnight, followed by centrifugation at 3,000 rpm for 10 min. The pale yellow supernatant was aspirated with a pipette, and the serum was aliquoted into 2 ml cryotubes, and stored at -80℃ for further experiment. An ELISA kit was used to detect IL-1β and IL-18 according to the manufacturer’s instructions (Wuhan Huamei Biotech Co., Ltd., Wuhan, China). At a wavelength of 450 nm, the OD (optical density) value of each rat serum sample was measured and recorded after the above-mentioned steps. The “Curve Expert” drawing software was used to plot a standard curve, and the above OD value was enrolled into the regression equation to achieve the sample concentration. To calculate the concentration of the diluted sample, multiplication was conducted by the inverse of dilution factor.

qRT-PCR (quantitative reverse transcription polymerase chain reaction)

Total RNA was isolated from brain samples using TRIzol reagent (Invitrogen, Carlsbad, CA, USA), and PC12 cells were harvested. Then, 5 µm RNA was utilized to reversely transcribe into cDNA using the Revert Aid First Strand cDNA Synthesis kit (provided by Invitrogen; cat. no. K1622), according to the manufacturer’s instructions. The 2^-^∆∆Ct method was used to determine the relative mRNA expressions. Table 1 showsthe sequences of primers.

Cellular viability detection and LDH (lactate dehydrogenase) measurement

The cellular viability was detected with CCK-8 (Cell Counting Kit‐8; Dojindo, Kumamoto, Japan), and LDH release was measured with a commercial kit (Roche, Basel, Switzerland), as described previously[35]. Standardization of the LDH release values and cell survival rates was performed, and the results was described as percentage.

Detection of oxidative stress

The PC12 cells were harvested at 24 h after re-oxygenation to quantify the level of oxidative stress. The activities of superoxide dismutase (SOD), glutathione (GSH) and the content of malondialdehyde (MDA) were measure using commercial biochemical kits (Nanjing Jiancheng, China), according to the manufacturer’s instructions.

Quantification of ROS (reactive oxygen species) production and detection of cell apoptosis

The ROS level in PC12 cells was tested by a commercial DCFH-DA (2,7-dichlorodihydrofluorescein diacetate) kit (provided by Beyotime,Shanghai,China; #S0033), according to the manufacturer’s protocols.

Apoptotic cells were detected using an Annexin V-FITC/PI Apoptosis Detection kit (Thermo Fisher Scientific), according to the manufacturer’s instructions. Subsequently, a FACSort flow cytometer (Becton Dickinson, Franklin Lakes, NJ, USA) was used to determine the percentage of the apoptotic cells.

Western blot analysis

The hippocampus and cortex were quickly separated on the ice plate, and the left and right sides were distinguished in 4 cryotubes and then placed into liquid nitrogen. The left hippocampus and cortex were used for Western blotting; the bilateral cortex and hippocampus in the sham group were compared. The expressions of ASC, N-terminal GSDMD, cleaved-caspase-1, NLRP3, and TRAF6 in cortex and hippocampus were identified. The proteins were quantitated by the bicinchoninic acid (BCA) method, separated by 10% SDS-PAGE (sodium dodecyl sulfate-polyacrylamide gel electrophoresis), and transferred electrophoretically onto PVDF (polyvinylidene difluoride) members. After blocking nonspecific binding sites with BSA (bovine serum albumin, 3%), the PVDF members were incubated with primary antibodies: anti-caspase-1 (1:500; Proteintech, Rosemont, IL, USA), anti-NLRP3 (1:500; Cell Signaling Technology, Danvers, MA, USA), and anti-N-terminal of GSDMD (1:500; Abcam Technology, Cambridge, MA, USA), anti-ASC (1:1000; Abcam Technology, Cambridge, MA, USA), anti-TRAF6 (1:400, Abcam Technology, Cambridge, MA, USA) and anti-GAPDH (1:10000; Abcam Technology, Cambridge, MA, USA), overnight at four centigrade degree, which were then incubated with a secondary antibody for one and a half hours at room temperature after TBST washing. The chemiluminescence assay was performed to identify the immunoreactive bands, and the gray value of immune reactivity was calculated using the ImageJ software.

Overexpression and knockdown of NLRP3 and TRAF6 in PC12 cells

In order to overexpress NLRP3 or TRAF6, PC12 cells were transfected with 50 nM of adenovirus (Ad-) to overexpress NLRP3 or TRAF6 (synthetized by GeneChem Co., Ltd., Shanghai, China). In addition, to knockdown NLRP3 and TRAF6, PC12 cells were treated with NLRP3 or TRAF6 siRNAs (25 nM) and their corresponding scrambled RNAs (synthesized by GeneChem Co., Ltd.), respectively. The PC12 cells were transfected by Lipofectamine 3000 (Thermo Fisher Scientific), as per the manufacturer’s protocols. After one day, the PC12 cells were exposed to OGD/R in the in vitro model, as previously mentioned. The efficiency of overexpression and depletion was detected by Western blot assay.

Immunofluorescence staining

NLRP3 and caspase-1 expressions in the PC12 cells were determined by immunofluorescence staining. In brief, after fixed by paraformaldehyde (4%), the PC12 cells were cultured with anti-NLRP3 or cleaved caspase-1 (p20) antibody (1:200; Abcam) overnight at four centigrade degree. Subsequently, goat anti-rabbit secondary antibody (1:200; Beyotime) was incubated at twenty-five centigrade degree for 1 h. After that, 4’-6-diamidino-2-phenylindole (DAPI; Sigma-Aldrich, St. Louis, MO, USA) was used to stain the nucleus of PC12 cells. Finally, protein levels were detected with a fluorescence microscope (IX81; Olympus, Tokyo, Japan).

Co-Immunoprecipitation (CO-IP) assay

The samples were incubated with rabbit polyclonal IgG control antibody, anti-NLRP3 (1:200; Abcam) or anti-TRAF6 (1:200; Abcam). Next, the lysates were incubated at 4 °C overnight. Subsequently, the mixture was incubated for another two hours after Protein A/G PLUS-Agarose was added into the lysates. The mixture was washed and denatured using immunoprecipitation buffer, followed by immunoblotting of the eluted proteins with the anti-TRAF6 or anti-NLRP3 antibody, as mentioned earlier.

Statistical analysis

The experimental data were statistically analyzed by the SPSS 25.0 software (IBM, Armonk, NY, USA), and the measurement data were expressed as mean ±SD (standard deviation). Normal distribution of the data was determined using skewness, kurtosis coefficient, and the one-sample Kolmogorov-Smirnov test. Normally distributed measurement data were compared between groups by ANOVA (one-way analysis of variance). When the homogeneity of variance was met, the LSD (least significant difference) test was used. When the uniformity of variance was not met, the Dunnett T3 test was used. The log-rank test was employed for the survival analysis. Linear correlation between variables was tested by the Pearson’s correlation analysis. P<0.05 was considered statistically different. GraphPad Prism 7 software (GraphPad Software Inc., San Diego, CA, USA) was used to draw statistical graphs.

1. General conditions of rats with or without CA/CPR

At first, the basic weight level of rats in each group was similar. However, on the 3rd day after CA/CPR, the body weight of animals in the CA+CHR group was lower compared to the sham and CA groups. There was no significant difference in body weight between the sham and CA groups. On the 5th to 7th days after CA/CPR, the weight of rats in the CA and CA+CHR groups was reduced. Compared with the CA group, Chrysophanol treatment for 7 days could more significantly reduce the weight of rats (P<0.05, Fig. 1A).

Then, the baseline physiological features of all rats, including hemodynamic parameters, temperature, and arterial blood gas tensions were recorded. Nevertheless, CA/CPR led to remarkable physiological and biochemical disorders in all the groups, except for in the sham group. Nevertheless, these changes were gradually improved from CPR to ventilation, and no alternation was found in the CA and CA+CHR groups (Table-2).

2. Chrysophanol post-treatment improved survival rate and prevented CA-induced neurological deficits

156 Sprague-Dawley rats were enrolled in the study, of which 45 rats were not included due to failed ventilation (n=10), failed resuscitation (n=13, non-ROSC), prolonged resuscitation time (n=10, CPR more than five minutes to achieve ROSC), or death at different time points after ROSC (n=12). Among 111 rats that were finally included in the current research, there were 30 rats in the sham group with a mortality of 0%. The survival rates on the 3rd and 7th days in the sham, CA, and CA + CHR groups were 100%, 85.4% and 78.1%; and 100%, 68.6% and 54.3%, respectively. The survival rate of rats in the sham group and other CA-based groups was alternative (Fig. 1B). Additionally, a significant improvement of the survival rate was observed in the CA+CHR group, when compared to CA group (P<0.05), suggesting that Chrysophanol post-treatment had a robust protective effect against CA.

The mNSS was calculated to evaluate the neurological functions following CA/CPR surgery. The mNSS scores were significantly higher in rats treated with CA/CPR surgery compared with those in sham-treated rats. Although there were no significant differences in the mNSS scores between the CA and CA+CHR groups on the first day after ROSC (P>0.05), Chrysophanol post-treatment reversed the increased mNSS scores exhibited by the CA/CPR on the 3rd and 7th days after surgery (P<0.05, Fig. 1C).

The function of spatial learning and memory was assessed using the MWM test from 3 to 7 day after resuscitation (Fig. 1D). In the pre-training phase, all rats in the 3 groups swam easily. In the spatial recognition phase, the mean latency values of recognizing the platform and the length of the path to arrive at the platform gradually reduced. Nevertheless, compared to the sham group, the latency was longer for animals in the CA group (Fig. 1E; P<0.05), the path length was greater (Fig. 1F; P<0.05), and the proportion of thigmotaxis was higher (Fig. 1G; P<0.05). These changes were markedly suppressed by post-treatment with Chrysophanol (Fig. 1E-G; P<0.05). Nevertheless, the swimming speed were not different among the three groups (data were not shown).

The rats were free to swim for one minute to find the platform after removing the platform. The retention performance was estimated by the path in the target quadrant, the time spent on the target quadrant, the number of target quadrant entries and the number of platforms crossing. In the CA group, the spent time (Fig. 1H; P<0.05), the swim path length (Fig. 1I; P<0.05) in the target quadrant, the number of platforms crossing (Fig. 1J; P<0.05), and the number of target quadrant entries were reduced (Fig. 1K; P<0.05) compared to the sham group. The results above were abrogated by the Chrysophanol post-treatment (Figs. 1H-K; P<0.05). The total path length and swimming speed were not significantly different among the three groups (data were not shown).

3. Chrysophanol post-treatment attenuated CA-induced neuronal damage in the hippocampus

In CA/CPR-induced brain injury models, an alteration in the brain water content, which was calculated based on water content/wet weight × 100%, was found as an important indicator of brain edema. Fig. 2A illustrates that the water content in the cerebral tissues of CA-treated rats was higher compared with that in the sham-treated rats. Nevertheless, Chrysophanol post-treatment dramatically reduced the brain water content on the postoperative 7th day.

The results of hematoxylin and eosin (HE) staining exhibited absence of damaged cells and normal morphology in hippocampal CA1 in sham-operated rats. However, a great number of damaged cells with obvious neural cell loss were observed in the same region in the CA-treated rats. Additionally, the morphology was normal with rare damaged cells in the same region after Chrysophanol post-treatment (Fig. 2B).

The number of hippocampal neuronal cells was counted on the 7th day after recovery from CA/CPR in all the groups. Several atrophic neurons with damaged nuclei and shrunken cytoplasm were found in the animals of CA group, while the morphology remained unchanged in the sham group, according to the results of the Nissl staining. Besides, the neuronal loss was prevented after Chrysophanol post-treatment, compared to the CA group (Figs. 2C and D, P<0.05).

In the present study, the number of TUNEL-positive cells in the CA1 region was significantly elevated following CA and resuscitation. However, neurons in the CA1 region displayed a regular arrangement in the sham-operated rats. Similarly, post-treatment with Chrysophanol remarkably decreased the number of CA-induced TUNEL-positive cells in the CA1 region of the hippocampus at 7 days after CA/CPR (Figs. 2E and F, P<0.05).

4. Chrysophanol post-treatment alleviated CA-induced neuronal pyroptosis possibly in parallel with suppressed TRAF6 expression

It has been demonstrated that pyroptosis might play a crucial role in CIRI. Subsequently, we attempted to indicate whether Chrysophanol-mediated neuroprotection is involved in suppressing CA-induced pyroptosis in vivo, in which the pyroptosis-related proteins were analyzed. We firstly investigated the effect of Chrysophanol on the assembly of ACS, NLRP3 inflammasomes, cleaved caspase-1, and GSDMD-N (N-terminal GSDMD). Western blotting and RT-qPCR clearly indicated that CA enhanced NLRP3, ASC, cleaved caspase-1, and GSDMD-N levels in both cortex and hippocampus at 7 days after CA. Chrysophanol post-treatment also significantly inhibited the mRNA and protein levels of NLRP3 and ASC. Moreover, Chrysophanol post-treatment markedly suppressed the activity of cleaved caspase-1. In addition, we further found similar results, in which Chrysophanol post-treatment reversed the increased level of GSDMD-N after surgery (Figs. 3A-F, P<0.05).

Pyroptosis, a newly discovered inflammation-mediated programmed cell death, amplified tissue injury or induced cell death by triggering excessive inflammatory damage. On 7 days after CA, we determined whether Chrysophanol post-treatment can exert a neuroprotective effect by suppressing pyroptosis-related inflammatory factors using ELSIA. The pyroptosis-related inflammatory products (IL-1β and IL-18) were also remarkably abated after Chrysophanol post-treatment (Figs. 3G, P<0.05). Furthermore, the expression level of TRAF6 was significantly upregulated after CA, while it was markedly downregulated after Chrysophanol post-treatment (Figs. 3H and I, P<0.05).

Taken together, these findings suggested that Chrysophanol post-treatment substantially restrained formation of NLRP3 inflammasomes and cleavage of caspase-1 and GSDMD-N, thereby preventing the maturation of IL-1β and IL-18 in the brain after CA in parallel with inhibition of TRAF6 expression.

5. Chrysophanol post-treatment protected PC12 cells against OGD/R-induced pyroptosis

One of the primary pharmacological functions of Chrysophanol, an important component of Rhubarb, is associated with its anti-inflammatory properties. Firstly, we used different concentrations of Chrysophanol to investigate its neuroprotective role. Chrysophanol alone had no significant influences on cellular viability and LDH release (data are not shown), while Chrysophanol post-treatment elicited a neuroprotective effect under OGD/R conditions, which was dependent on the dose. As the most appropriate concentration was 100 μM, it was selected for subsequent experiments (Figs. 4A and B, P<0.05).

In order to further testify that pyroptosis is the major form of programmed cell death in OGD/R-stimulated injury, we used MCC950, a specific inhibitor of NLRP3, and necrosulfonamide (NSA), a chemical inhibitor of gasdermin D, to inhibit the pyroptosis. The results demonstrated that both MCC950 and NSA significantly suppressed the OGD/R-induced neuronal death, as evidenced by improved cellular viability and decreased LDH release in the absence of Chrysophanol (Figs. 4C-F, P<0.05). However, cellular viability and LDH release were unchanged between MCC950 and MCC950+CHR groups or between NSA and NSA+CHR groups, indicating that no additional effect was provided by MCC950 or NAS in Chrysophanol-treated PC12 cells.

Next, we verified that Chrysophanol alone or combined with MCC950 or NAS had protective effect against OGD/R-caused pyroptosis by detecting the levels of pyroptosis-related proteins. Western blotting revealed that the levels of NLRP3, cleaved caspase-1 and GSDMD-N were all inhibited in Chrysophanol or Chrysophanol + MCC950 group under OGD/R condition (Figs. 4G and H, P<0.05). The level of GSDMD-N was markedly suppressed in the Chrysophanol + NAS group (Figs. 4I and J, P<0.05). Moreover, the levels of pyroptosis-associated inflammatory factors (IL-18 and IL-1β) were also reduced after Chrysophanol alone or combined with MCC950 or NAS post-treatment, as measured by ELISA (Figs. 4K, P<0.05). Similarly, there is no difference of pyroptosis-related indicators between CHR and MCC950+CHR groups or between CHR and NSA+CHR groups

To get more evidence, NLRP3 was overexpressed or knocked down in OGD/R exposed-PC12 cells. Overexpression of NLRP3 enhanced the expression levels of pyroptosis-related proteins and inflammatory products in the OGD/R-stimulated PC12 cells. Although silencing of NLRP3 by using siRNA (small interfering RNA) did not provide additional protective effects for Chrysophanol-treated cells, the neuroprotective effects of Chrysophanol post-treatment were neutralized in NLRP3 overexpressing PC12 cells under OGD/R (Figs. 4L-N, P<0.05). Based on these results, we confirmed the important role of NLRP3-regulated pyroptosis in Chrysophanol-mediated CIRI.

Collectively, the above-mentioned findings suggested that NLRP3-mediated pyroptosis was the major apoptotic signaling pathway modulated by Chrysophanol post-treatment in the setting of OGD/R-induced injuries in PC12 cells.

6. Chrysophanol post-treatment inhibited pyroptotic cell death by inhibiting the interaction between TRAF6 and NLRP3

TRAF6 was determined in vitro, and the results showed that the expression level of TRAF6 was upregulated during OGD/R-triggered damage, while it was downregulated after Chrysophanol post-treatment (Figs. 5A and B, P<0.05). Additionally, the results of the Pearson’s correlation analysis indicated that the levels of TRAF6 and GSDMD-N showed positive correlation (Figs. 5C and D, P<0.05).

To confirm that Chrysophanol post-treatment is protective against OGD/R-induced injury in a TRAF6-dependent manner, we also performed gain- and loss-of-function analyses of TRAF6 in PC12 cells. Firstly, knockdown of TRAF6 appeared protective against OGD/R-induced neuronal death, while overexpression of TRAF6 exhibited an opposite effect (Figs. 5E and F, P<0.05). Previous studies had clearly demonstrated that TRAF6 has indispensable roles in regulating oxidative stress in CIRI injury. Therefore, to get more solid evidence, we further examined whether TRAF6 overexpression or knockdown influenced oxidative stress in OGD/R treated PC12 cells in the absence or presence of Chrysophanol. Firstly, the content of MDA in OGD/R-operated PC12 cells was decreased after Chrysophanol post-treatment. Contrarily, protective factors, including GSH and SOD, were all increased. Similarly, overexpression of TRAF6 abrogated the effect of Chrysophanol on oxidative stress-induced by OGD/R exposure, while, TRAF6 consumption had provided additional protective roles in oxidative stress of Chrysophanol-treated PC12 cells (Figs. 5G-I, P<0.05).

Moreover, overexpression of TRAF6 also reversed the neuroprotective effects of Chrysophanol post-treatment, because OGD/R re-elevated ROS production and cell apoptosis. Importantly, Chrysophanol provided additional neuroprotective effects in the PC12 cells transfected with TRAF6-siRNA (Figs. 5J-M, P<0.05).

To validate the function of TRAF6 in Chrysophanol-mediated anti-pyroptotic effects, we overexpressed and silenced TRAF6 in PC12 cells and found that overexpression of TRAF6 reversed the protective effects of Chrysophanol on pyroptosis-related factors. In the groups that were transfected with TRAF6-siRNA, Chrysophanol showed a similar effect as previous results (Figs. 6A-C, P<0.05). Furthermore, immunofluorescence co-localization was performed. Consistently, there were fewer cleaved caspase-1-positive and NLRP3-positive PC12 cells in the Chrysophanol-treated group. Overexpression of TRAF6 dramatically increased co-localization of cleaved caspase-1 and NLRP3 compared to the control plasmid. Additionally, overexpression of TRAF6 abolished the effects of Chrysophanol on the co-localization of NLRP3 and cleaved caspase-1 (Figs. 6D). Finally, the TRAF6-NLRP3 interaction was strongly elevated in the OGD/R group compared with that in the control group. However, Chrysophanol significantly inhibited the TRAF6-NLRP3 interaction (Figs. 6E-F, P<0.05).

Hence, Chrysophanol was protective against ischemic cerebral injury through reducing oxidative stress and pyroptosis via suppressing the TRAF6-NLRP3 axis.

In spite of high-quality CPR and successful ROSC, the majority of cases, who experienced sudden CA inside or outside a hospital, still suffer from painful sequelae of post-cardiac arrest syndrome, including hypoxic-ischemic brain injury, myocardial dysfunction, and systemic inflammatory response syndrome [36]. Along with the pathophysiological development of post-CA syndrome, hypoxic-ischemic brain injury alone attributes greatly to high rates of mortality and morbidity in the absence of an efficacious treatment. Although a complex cascade of molecular events were related to the pathophysiological disturbances of post-CA brain injury, the resultant neuroinflammation might cause additional damage by provoking the death of the neuronal cells [37, 38]. Therefore, potential therapeutic strategies aiming to alleviate neuroinflammation induced by CA should be urgently developed.

Pharmacological interventions applied immediately at the onset of reperfusion could improve the brain resistant from a subsequent lethal episode of ischemic events, which is called pharmacological post-treatment. The concept of pharmacological post-treatment is extremely intriguing since it makes the intervention more easily controllable and clinically applicable. Accumulating evidence in experimental preparations has demonstrated that post-operative interventions of inhalational anesthetics [20], adenosine agonist [21], and other agents [39] were used as pharmacological mimetics to render the prevention of lethal CIRI, which could be ideal alternatives that might substitute preconditioning. Chrysophanol plays an essential role in CIRI. A growing body of evidence demonstrated that Chrysophanol promoted neuronal survival in the brain after CIRI because of its strong anti-oxidative stress, anti-apoptosis and anti-inflammation properties [22-24]. Thus, the most remarkable finding of the present study was that post-treatment with Chrysophanol, an important component of Rhubarb, exerted robust protective effects against CIRI, as evidenced by improved survival rate, neurological outcomes, and decreased brain damage. Moreover, we further confirmed that Chrysophanol post-treatment also protected PC12 cells against OGD/R-induced injury, as documented by increased cellular viability and alleviated LDH release. Therefore, Chrysophanol post-treatment showed a neuroprotective effect, and it was a promising therapeutic potential for preventing CIRI.

During CIRI, necrotic neuronal cells may release various DAMPs (damage-associated molecular patterns), which serve as inflammatory substances to initiate inflammatory cascade reactions. Pyroptosis, identified as an inherently inflammatory programmed cell death, has been found to be associated with the development and progression of post-CA brain injury [31, 37]. Several experimental studies have reported that the pyroptosis-relevant molecules are highly expressed in the ischemic brain, indicating that pyroptosis is critical for CIRI [40, 41]. Thus, pyroptosis and its relationship with inflammation have noticeably attracted clinicians’ attention to treat CIRI. Distinct from other forms of cell death, pyroptosis has its distinctive morphological features and molecular mechanisms. As a crucial pyroptosis-associated mediator, NLRP3 (NOD-like receptor family pyrin domain containing 3) inflammasomes generally contains NLRP3, apoptosis-associated speck-like proteins (e.g., ASC), and pro-caspase-1. Recent studies have demonstrated that genetic deficiency of NLRP3 inflammasomes efficaciously relieved ischemic brain injury-mediated pyroptosis [42]. Consistent with previous studies, we found that NLRP3 inflammasome pathway was activated by CA and OGD/R conditions, leading to an excessive inflammatory cascade response. Correspondingly, Chrysophanol post-treatment strongly suppressed CIRI-induced NLRP3 inflammasomes, suggesting that the neuroprotective effects of Chrysophanol post-treatment might be related to its anti-pyroptotic features. In addition, the mature NLRP3 inflammasomes complex could also cleave pro-caspase-1 into active caspase-1, which was recognized to modulate pyroptotic cell death. According to the previous studies, the expression levels of caspase-1 were increased in ischemic stroke models. Moreover, caspase-1 inhibition [43]or knockout [44] exhibited a neuroprotective effect against CIRI. Consequentially, active caspase-1 triggered maturation and secretion of IL-18 and IL-1β. We, in the present study, found that Chrysophanol post-treatment significantly suppressed the secretion of IL-18 and IL-1β and the expression level of cleaved caspase-1 during CIRI. Additionally, active caspase-1 subsequently regulated the release of GSDMD-N, which specifically interacted with phospholipid molecules in the plasma membrane and then caused formation of pores, eventually resulting in pyroptosis [45]. Thus, GSDMD was featured as a pivotal executioner of caspase-1-dependent pyroptosis. Similarly, Chrysophanol post-treatment markedly neutralized the increased level of GSDMD-N after CA and OGD/R. To achieve more solid evidence, the specific inhibitors of NLRP3 and GSDMD, MCC950 and NSA were added to rescue PC12 cells from OGD/R, indicating that pyroptosis is the main cell death in CIRI. More importantly, overexpression of NLRP3 not only exacerbated OGD/R-induced cell injury, but also reversed the effects of Chrysophanol post-treatment on the pyroptosis-related indicators, while knockdown of NLRP3 showed opposite effects. Based on these findings, it was demonstrated that Chrysophanol post-treatment could exert robust protective effects through suppressing pyroptosis.

To date, animal experiments have also indicated that Chrysophanol relieves CIRI-induced brain damage through attenuation of neuroinflammation [23, 24]. Nevertheless, few studies have reported the anti-pyroptotic effects of Chrysophanol on post-CA brain injury. According to the findings of the present study, overexpression of NLRP3 almost completely abrogated the protective effects of Chrysophanol, suggesting that pyroptosis was identified as a major neuronal death form modulated by Chrysophanol post-treatment during CIRI. Therefore, further delineation about the underlying molecular mechanisms of anti-pyroptotic effects of Chrysophanol is of great significance to develop novel therapeutic strategies.

TRAF, which is composed of 7 members (TRAF1-7), is an important multifunctional protein [46]. TRAF6, distributed widely and abundantly in the brain, is the most important member of TRAF family, because of the smallest homology and the greatest difference in C-terminal domain. Studies have increasingly found that TRAF6 inhibition significantly restrained the degree of ROS-related oxidative stress[30, 47] and NF-κB-mediated inflammation in ischemic injury [48]. Mechanistically, TRAF6 activation, resulting in the elevated ROS production, may contribute to the presence of pyroptosis. Besides, TRAF6 level has dramatically upregulated in the peripheral blood of ischemic stroke individuals [49] and TRAF6 gene polymorphisms attributed to the increased susceptibility of ischemic stroke in Southern Chinese Han population [50]. Thus, TRAF6 could be defined as a bridge between oxidative stress and neuroinflammation. Oxidative stress occurs during CIRI due to an imbalance between pro-oxidant and anti-oxidant activities, resulting in surplus formation of reactive oxygen species (ROS), also recognized as a causative event of neuroinflammation and one important DAMPs, which could initiate a series of cellular signaling cascades that eventually trigger pyroptosis [30, 41]. Our results also showed that Chrysophanol post-treatment suppressed oxidative stress in OGD/R-treated PC12 cells. Additionally, TRAF6-deletion cells were more resistant to OGD/R-trigger oxidative stress, as shown by markedly reserving the level of SOD and GSH, as well as reducing ROS production and the content of MDA. In contrast, TRAF6 overexpression significantly rendered the PC12 cells more vulnerable to OGD/R-induced oxidative stress. In addition, gain- and loss-of-function analyses in vitro also unraveled that TRAF6 promoted the progression of OGD/R injury by enhancing NLRP3-related pyroptosis. Furthermore, the expression levels of TRAF6 and GSDMD-N showed positive correlation with each other in OGD/R-stimulated PC12 cells. We further confirmed that TRAF6 ablation markedly suppressed pyroptotic signaling pathway. Similarly, overexpression of TRAF6 deteriorated pyroptotic cell death, and abrogated the protective effects of Chrysophanol post-treatment. More importantly, unlike silencing NLRP3, Chrysophanol post-treatment could provide additional neuroprotection in si-TRAF6-treated cells. Therefore, our results indicated that TRAF6 functioned as an important promoter of pyroptotic cell death, which was regulated by Chrysophanol. However, the detailed intracellular molecular mechanism is still unclear. A previous study demonstrated that TRAF6 induced ROS overproduction and neuroinflammation through directly interacting with Ras-related C3 botulinum toxin substrate 1 (Rac1)[51]. Additionally, the anti-inflammatory effect of DJ-1 was involved in dissociation of NLRX1 from TRAF6 during CIRI [47]. According to these findings, we found that TRAF6 interacted with NLRP3 to trigger pyroptotic inflammatory process. In agreement with previous findings mentioned above, Chrysophanol post-treatment significantly attenuated the interaction between TRAF6 and NLRP3, suggesting that Chrysophanol has a prospective anti-pyrpptosis feature, and the underlying mechanism is involved in regulation of the TRAF6-NLRP3 axis.

In summary, TRAF6 was induced following CIRI and promoted ROS-mediated oxidative stress, which in turn enhanced pyroptosis. Besides, TRAF6 also directly interacted with NLRP3 and potentiated the activation of NLRP3 inflammasome and the latter ultimately contributed to pyroptotic cell death. Hence, our present study had revealed that post-treatment with Chrysophanol, a natural anthraquinone isolated from Rhubarb, may have the potential to attenuate CIRI through the TRAF6-dependent inactivation of NLRP3-related pyroptosis, providing an alternative option for treating CA-induced brain injury.

Declaration of conflicting interests

The authors declare no potential conflicts of interest with respect to the research, authorship, or publication of this article.

Authors’ contributions

Zhi Ye and Pingping Xia conceived and designed the experiments. Murat Marjan, Zhuoyi Liu, Wanqing Zhou and Pingping Xia performed the experiments. Qian Zhang, Chen Cheng and Yuanyuan Tao analyzed the data. Jie Minxi Zhao, Zhihua Wang, Yuanyuan Tao and Chen Cheng provided reagents/materials/analysis tools. Pingping Xia, and Murat Marjan wrote the manuscript. Zhi Ye: Conceptualization, Methodology, Funding acquisition, Project administration, Supervision.

Acknowledgements

This work was supported by the National Natural Science Foundation of China (grant numbers 82171467 and 82001393 ), Hunan Provincial Natural Science Foundation of China (grant numbers no. 2021JJ3119) and Hainan Provincial Natural Science Foundation of China (grant numbers no. 2019RC365).

Shao F, Li CS, Liang LR, Li D, Ma SK. Outcome of out-of-hospital cardiac arrests in Beijing China. Resuscitation. 2014;85:1411-1417.
Mozaffarian D, Benjamin EJ, Go AS, Arnett DK, Blaha MJ, Cushman M, Das SR, de Ferranti S, Despres JP, Fullerton HJ, et al. Heart disease and stroke statistics-2016 update: a report from the American Heart Association. Circulation. 2016;133:e38-360.
Neumar RW, Nolan JP, Adrie C, Aibiki M, Berg RA, Bottiger BW, Callaway C, Clark RS, Geocadin RG, Jauch EC, et al. Post-cardiac arrest syndrome: epidemiology, pathophysiology, treatment, and prognostication. A consensus statement from the International Liaison Committee on Resuscitation (American Heart Association, Australian and New Zealand Council on Resuscitation, European Resuscitation Council, Heart and Stroke Foundation of Canada, InterAmerican Heart Foundation, Resuscitation Council of Asia, and the Resuscitation Council of Southern Africa); the American Heart Association Emergency Cardiovascular Care Committee; the Council on Cardiovascular Surgery and Anesthesia; the Council on Cardiopulmonary, Perioperative, and Critical Care; the Council on Clinical Cardiology; and the Stroke Council. Circulation. 2008;118:2452-83.
Stock D, Jacob B, Chan V, Colantonio A, Cullen N. Change in function over inpatient rehabilitation after hypoxic ischemic brain injury: a populationwide cohort study. Arch Phys Med Rehabil. 2019;100:1640-1647.
Ousta A, Piao L, Fang YH, Vera A, Nallamothu T, Garcia AJ 3rd, Sharp WW. Microglial activation and neurological outcomes in a murine model of cardiac arrest. Neurocrit Care. 2022; 36(1):61-70.
Liu F, McCullough LD. Inflammatory responses in hypoxic ischemic encephalopathy. Acta Pharmacol Sin. 2013; 34:1121-1130.
Frank D, Vince JE. Pyroptosis versus necroptosis: similarities, differences, and crosstalk. Cell Death Differ. 2019; 26 (1): 99-114.
Man SM, Karki R, Kanneganti TD. Molecular mechanisms and functions of pyroptosis, inflammatory caspases and inflammasomes in infectious diseases. Immunol Rev. 2017; 277:61-75.
Li L, Jiang M, Qi L, Wu Y, Song D, Gan J, Li Y, Bai Y. Pyroptosis, a new bridge to tumor immunity. Cancer Sci. 2021; 112(10): 3979-3994.
Liu J, Zheng J, Xu Y, Cao W, Wang J, Wang B, Zhao L, Zhang X, Liao W. Enriched environment attenuates pyroptosis to improve functional recovery after cerebral ischemia/reperfusion injury. Front Aging Neurosci. 2021;13:717644.
Xiao L, Dai Z, Tang W, Liu C, Tang B. Astragaloside IV alleviates cerebral ischemia-reperfusion injury through NLRP3 inflammasome-mediated pyroptosis inhibition via activating Nrf2. Oxid Med Cell Longev. 2021; 2021: 9925561.
Xu P, Tao C, Zhu Y, Wang G, Kong L, Li W, Li R, Li J, Zhang C, Wang L, Liu X, Sun W, Hu W. TAK1 mediates neuronal pyroptosis in early brain injury after subarachnoid hemorrhage. J Neuroinflammation. 2021; 18(1):188.
Ma S, Xu H, Huang W, Gao Y, Zhou H, Li X, Zhang W. Chrysophanol relieves cisplatin-induced nephrotoxicity via concomitant inhibition of oxidative stress, apoptosis, and inflammation. Front Physiol. 2021;12:706359.
Yong JP, Kwang HL, Mi SJ, Yong HL, Yong JK, Changhyun P, Bonglee K, Kyu HC, Ki HK. Hepatoprotective potency of chrysophanol 8-O-Glucoside from Rheum palmatum L. against hepatic fibrosis via regulation of the STAT3 signaling pathway. Int J Mol Sci. 2020; 21(23):9044.
Park S, Lim W, Song G. Chrysophanol selectively represses breast cancer cell growth by inducing reactive oxygen species production and endoplasmic reticulum stress via AKT and mitogen-activated protein kinase signal pathways.Toxicol Appl Pharmacol. 2018; 360:201-211.
Wen Q, Mei L, Ye S, Liu X, Xu Q, Miao J, Du S, Chen D, Li C, Li H. Chrysophanol demonstrates anti-inflammatory properties in LPS-primed RAW 264.7 macrophages through activating PPAR-gamma.Int Immunopharmacol. 2018; 56:90-97.
Wen Q, Lau N, Weng H, Ye P, Du S, Li C, Lv J, Li H. Chrysophanol exerts anti-inflammatory activity by targeting histone deacetylase 3 through the high mobility group protein 1-nuclear transcription factor-kappa B signaling pathway in vivo and in vitro. Front Bioeng Biotechnol. 2021; 8:623866.
Cui WH, Zhang HH, Qu ZM, Wang Z, Zhang DJ, Wang S. Effects of chrysophanol on hippocampal damage and mitochondrial autophagy in mice with cerebral ischemia reperfusion. Int J Neurosci. 2020; 20:1-8.
Zhao Y, Fang Y, Zhao H, Li J, Duan Y, Shi W, Huang Y, Gao L, Luo Y. Chrysophanol inhibits endoplasmic reticulum stress in cerebral ischemia and reperfusion mice. Eur J Pharmacol. 2018; 818:1-9.
Hwang JW, Jeon YT, Lim YJ, Park HP. Sevoflurane postconditioning-induced anti-inflammation via inhibition of the Toll-like receptor-4/Nuclear factor kappa B pathway contributes to neuroprotection against transient global cerebral ischemia in rats. Int J Mol Sci. 2017; 18(11):2347.
Grewal AK, Singh N, Singh TG. Neuroprotective effect of pharmacological postconditioning on cerebral ischaemia-reperfusion-induced injury in mice. J Pharm Pharmacol. 2019;71(6):956-970.
Zhao Y, Huang Y, Fang Y, Zhao H, Shi W, Li J, Duan Y, Sun Y, Gao L, Luo Y. Chrysophanol attenuates nitrosative/oxidative stress injury in a mouse model of focal cerebral ischemia/reperfusion. J Pharmacol Sci. 2018; 138(1):16-22.
Zhao Y, Fang Y, Li J, Duan Y, Zhao H, Gao L, Luo Y. Neuroprotective effects of Chrysophanol against inflammation in middle cerebral artery occlusion mice. Neurosci Lett. 2016; 630:16-22.
Zhang N, Zhang X, Liu X, Wang H, Xue J, Yu J, Kang N, Wang X. Chrysophanol inhibits NALP3 inflammasome activation and ameliorates cerebral ischemia/reperfusion in mice. Mediators Inflamm. 2014; 2014:370530.
Zhang L, Wang T, Lu Y, Zheng Q, Gao Y, Zhou X, Huang D. Tumor necrosis factor receptor-associated factor 6 plays a role in the inflammatory responses of Human periodontal ligament fibroblasts to enterococcus faecalis. J Endod. 2015; 41(12):1997-2001.
Wei B, Gong Y, Yang H, Zhou J, Su Z, Liang Z. Role of tumor necrosis factor receptor-associated factor 6 in pyroptosis during acute pancreatitis. Mol Med Rep. 2021; 24(6):848.
Huang H, Xia A, Sun L, Lu C, Liu Y, Zhu Z, Wang S, Cai J, Zhou X, Liu S. Pathogenic functions of tumor necrosis factor receptor-associated factor 6 signaling following traumatic brain injury. Front Mol Neurosci. 2021;14:629910.
He L, Wang Z, Zhou R, Xiong W, Yang Y, Song N, Qian J .Dexmedetomidine exerts cardioprotective effect through miR-146a-3p targeting IRAK1 and TRAF6 via inhibition of the NF-kappaB pathway. Biomed Pharmacother. 2021; 133:110993.
Liu H, Fan J, Zhang W, Chen Q, Zhang Y, Wu Z. OTUD4 alleviates hepatic ischemia-reperfusion injury by suppressing the K63-linked ubiquitination of TRAF6. Biochem Biophys Res Commun. 2020; 523(4):924-930.
Yan W, Sun W, Fan J, Wang H, Han S, Li J, Yin Y. Sirt1-ROS-TRAF6 signaling-induced pyroptosis contributes to early injury in ischemic mice. Neurosci Bull. 2020; 36(8):845-859.
Chang Y, Zhu J, Wang D, Li H, He Y, Liu K, Wang X, Peng Y, Pan S, Huang K. NLRP3 inflammasome-mediated microglial pyroptosis is critically involved in the development of post-cardiac arrest brain injury. J Neuroinflammation. 2020;17(1):219.
Chen G, Li C, Zhang L, Yang J, Meng H, Wan H, He Y. Hydroxysafflor yellow A and anhydrosafflor yellow B alleviate ferroptosis and parthanatos in PC12 cells injured by OGD/R. Free Radic Biol Med. 2022; 179:1-10.
Lv J, Guan W, You Q, Deng L, Zhu Y, Guo K, Gao X, Kong J, Yang C. RIPC provides neuroprotection against ischemic stroke by suppressing apoptosis via the mitochondrial pathway. Sci Rep. 2020; 10(1):5361.
Wang Z, Xia P, Hu J, Huang Y, Zhang F, Li L, Wang E, Guo Q, Ye Z. LncRNA MEG3 alleviates diabetic cognitive impairments by reducing mitochondrial-derived apoptosis through promotion of FUNDC1-related mitophagy via Rac1-ROS axis. ACS Chem Neurosci. 2021;12(13):2280-2307.
Chen C, Huang Y, Xia P, Zhang F, Li L, Wang E, Guo Q, Ye Z. Long noncoding RNA Meg3 mediates ferroptosis induced by oxygen and glucose deprivation combined with hyperglycemia in rat brain microvascular endothelial cells, through modulating the p53/GPX4 axis. Eur J Histochem. 2021; 65(3):3224.
Mentzelopoulos SD, Zakynthinos SG. Post-cardiac arrest syndrome: pathological processes, biomarkers and vasopressor support, and potential therapeutic targets. Resuscitation. 2017;121:A12-A14.
Jiang M, Li R, Lyu J, Li X, Wang W, Wang Z, Sheng H, Zhang W, Karhausen J, Yang W. MCC950, a selective NLPR3 inflammasome inhibitor, improves neurologic function and survival after cardiac arrest and resuscitation. J Neuroinflammation. 2020; 17(1): 256.
Ocak U, Ocak PE, Huang L, Zuo G, Yan J, Hu X, Song Z, Zhang JH. Inhibition of PAR-2 attenuates neuroinflammation and improves short-term neurocognitive functions via ERK1/2 signaling following asphyxia-induced cardiac arrest in rats. Shock. 2020; 54 (4):539-547.
Yang CY, Liu SY, Wang HY, Li YL, Guo D, Wang XY, Hua W, Wang GL. Neuroprotection by propofol post-conditioning: focus on PKMzeta/KCC2 pathway activity. Cell Mol Neurobiol. 2018; 38 (3):691-701.
Liang J, Wang Q, Li JQ, Guo T, Yu D. Long non-coding RNA MEG3 promotes cerebral ischemia-reperfusion injury through increasing pyroptosis by targeting miR-485/AIM2 axis. Exp Neurol. 2020; 325:113139.
Xia P, Pan Y, Zhang F, Wang N, Wang E, Guo Q, Ye Z. Pioglitazone confers neuroprotection against ischemia-induced pyroptosis due to its inhibitory effects on HMGB-1/RAGE and Rac1/ROS pathway by activating PPAR-ɤ. Cell Physiol Biochem. 2018; 45(6):2351-2368.
Yang F, Wang Z, Wei X, Han H, Meng X, Zhang Y, Shi W, Li F, Xin T, Pang Q, Yi F. NLRP3 deficiency ameliorates neurovascular damage in experimental ischemic stroke. J Cereb Blood Flow Metab. 2014; 34(4):660-667.
Liang Y, Song P, Chen W, Xie X, Luo R, Su J, Zhu Y, Xu J, Liu R, Zhu P, Zhang Y, Huang M. Inhibition of caspase-1 ameliorates ischemia-associated blood-brain barrier dysfunction and integrity by suppressing pyroptosis activation. Front Cell Neurosci. 2021; 14: 540669.
Schielke GP, Yang GY, Shivers BD, Betz AL.Reduced ischemic brain injury in interleukin-1 beta converting enzyme-deficient mice. J Cereb Blood Flow Metab. 1998; 18 (2): 180-5.
Wang K, Sun Z, Ru J, Wang S, Huang L, Ruan L, Lin X, Jin K, Zhuge Q, Yang S. Ablation of GSDMD improves outcome of ischemic stroke through blocking canonical and non-canonical inflammasomes dependent pyroptosis in microglia. Front Neurol. 2020; 11:577927.
Lee NK, Lee SY. Modulation of life and death by the tumor necrosis factor receptor-associated factors (TRAFs). J Biochem Mol Biol 2002, 35: 61-66.
Peng L, Zhou Y, Jiang N, Wang T, Zhu J, Chen Y, Li L, Zhang J, Yu S, Zhao Y. DJ-1 exerts anti-inflammatory effects and regulates NLRX1-TRAF6 via SHP-1 in stroke. J Neuroinflammation. 2020; 17(1): 81.
Chen L, Kong L, Wei X, Wang Y, Wang B, Zhang X, Sun J, Liu H. beta-arrestin 2 negatively regulates NOD2 signalling pathway through association with TRAF6 in microglia after cerebral ischaemia/reperfusion injury. J Cell Mol Med. 2019; 23(5):3325-3335.
Wu D, Lee YG, Liu HC, Yuan RY, Chiou HY, Hung CH, Hu CJ. Identification of TLR downstream pathways in stroke patients. Clin Biochem. 2013; 46(12):1058-1064.
Su L, Chen Z, Yan Y, Liang B, Xie J, Chen Q, Tan J, Gu L. Association between TRAF6 gene polymorphisms and susceptibility of ischemic stroke in Southern Chinese Han Population. J Mol Neurosci. 2015; 57(3): 386-92.
Li T, Qin JJ, Yang X, Ji YX, Guo F, Cheng WL, Wu X, Gong FH, Hong Y, Zhu XY, Gong J, Wang Z, Huang Z, She ZG, Li H. The ubiquitin E3 ligase TRAF6 exacerbates ischemic stroke by ubiquitinating and activating Rac1. J Neurosci. 2017; 37(50):12123-12140.

Table-1 Primer sequence
Name	Sequence
NLRP3	ATGCTGCTTCGACATCTCCT
	AACCAATGCGAGATCCTGAC
caspase-1	CACAGCTCTGGAGATGGTGA
	TCTTTCAAGCTTGGGCACTT
ASC	CTTGTCAGGGGATGAACTCAAAA
	GCCATACGACTCCAGATAGTAGC
GSDMD	GTGCCTCCACAACTTCCTGA
	GTCTCCACCTCTGCCCGTAG
IL-1β	CACCTCTCAAGCAGAGCCACAG
	GGAAGGCTGACTTTCTCCTGGTA
IL-18	AAACCCGCCTGTGTTCGA
	GGGTTCCATGGTGAAGTCAAC
GAPDH	TGGTGAAGCAGGCATCTGAC
	TGCTGTTGAAGTCGCAGGAG

Table-2. Physiological baseline characteristics
Parameters	Time points	CA	CA+R
CPR time (s)		107.9±31	105.5±30
Total dose of epinephrine (μg)		12.3±2.5	12.1±2.3
Mean arterial pressure (mmHg)	Baseline	106.6±9.2	110±9.5
	Post-ROSC 10 min	83.0±7.9	81.9±6.7
	Post-ROSC 30 min	95.2±8.8	95.5±8.6
	Post-ROSC 60 min	114.3±4.5	116.1±5.0
Heart (beats/min)	Baseline	387.8±42.5	385.5±35.8
	Post-ROSC 10 min	285.4±33.5	290.4±28.3
	Post-ROSC 30 min	364.8±27.5	370.3±25.8
	Post-ROSC 60 min	377.2±18.5	370.8±20.2
Rectal temperature (℃)	Baseline	37.1±0.4	36.9±0.3
	Post-ROSC 10 min	37.0±0.3	36.8±0.3
	Post-ROSC 30 min	36.9±0.4	37.0±0.3
	Post-ROSC 60 min	37.0±0.4	36.9±0.4
pH	Baseline	7.44±0.05	7.45±0.05
	Post-ROSC 10 min	7.01±0.11	7.05±0.08
	Post-ROSC 30 min	7.23±0.13	7.25±0.14
	Post-ROSC 60 min	7.39±0.06	7.40±0.05
PaCO₂(mmHg)	Baseline	40.5±4	41.4±5
	Post-ROSC 10 min	56.5±6	55.8±5
	Post-ROSC 30 min	45.7±5	46.8±4
	Post-ROSC 60 min	41.5±4	40.5±5
PO₂(mmHg)	Baseline	141.7±14.2	145.2±12.7
	Post-ROSC 10 min	134.7±17.1	135.5±15.2
	Post-ROSC 30 min	154.7±14.8	160±15.3
	Post-ROSC 60 min	148.3±12.5	146.8±13.2

No competing interests reported.

Download PDF

Version 1

posted

You are reading this latest preprint version

Chrysophanol post-conditioning attenuated cerebral ischemia-reperfusion injury induced NLRP3-related pyroptosis in a TRAF6-dependent manner

Status:

Version 1

Abstract

Figures

Introduction

Materials And Methods

qRT-PCR (quantitative reverse transcription polymerase chain reaction)

Results

Discussion

Declarations

References

Tables

Additional Declarations

Status:

Version 1