Knock down of PCSK9 can improve myocardial ischemia/reperfusion injury by inhibiting autophagy

doi:10.21203/rs.3.rs-1610254/v1

Download PDF

Research Article

Knock down of PCSK9 can improve myocardial ischemia/reperfusion injury by inhibiting autophagy

https://doi.org/10.21203/rs.3.rs-1610254/v1

This work is licensed under a CC BY 4.0 License

Version 1

posted

You are reading this latest preprint version

Purpose: To investigate the effect and mechanism of proprotein convertase subtilisin/Kexin type 9 (PCSK9) on myocardial ischemia-reperfusion injury (MIRI) and to provide a reference for clinical prevention and treatment of acute myocardial infarction (AMI).

Methods: We established a rat myocardial ischemia/reperfusion (I/R) model and AC16 hypoxia/reoxygenation (H/R) model. A total of 48 adult male Sprague-Dawley rats were randomly assigned into 3 groups (n=16): control（scrambled RNAi was use）, ischemia/reperfusion(I/R), and I/R +SiRNA. In the I/R and I/R +siRNA groups, myocardial ischemia was induced by occlusion of the left anterior descending branch (LAD) of the coronary artery in rats in the I/R group for 0.5 hours reperfused for 3 days. To assess myocardial injury, rats were subjected to the electrocardiogram (ECG), cardiac function, cardiac enzymes, and 2,3,5-triphenyl tetrazolium chloride (TTC) /Evan Blue (EB) staining. Meanwhile, hematoxylin-eosin (HE) staining was used to detect morphological changes of cardiomyocytes in each group, and the level of myocardial fibrosis was quantified by Masson trichrome staining. Differences in expression of autophagy level proteins and Bcl-2/adenovirus E1B 19-kDa interacting protein (BNIP3) signaling-related proteins were determined by protein blotting.

Results: PCSK9 mRNA and protein levels were significantly upregulated during cardiomyocyte hypoxia in vitro and in vivo. Immunohistochemistry confirmed that PCSK9 expression was increased in rat hearts 3 days after anterior descending branch ligation. In vitro and in vivo experimental studies revealed that siRNA knockdown of PCSK9 resulted in reduced expression of the autophagic protein Beclin-1, light chain 3 (LC3) compared to control-treated cells and sham-operated groups, at the same time, the presentation of the autophagic pathway BNIP3 was also downregulated. Furthermore, the PCSK9-mediated small interfering RNA (siRNA) group injected into the left ventricular wall significantly improved cardiac function and myocardial infarct size, as well as the expression of mRNA of Recombinant Human Interleukin-1β（IL-1β）and Nucleotide-binding oligomerization domain-like receptor protein 3 (NLRP3) was significantly downregulated and reduced the inflammatory response compared with the I/R group.

Conclusions: In ischemic/hypoxic circumstances, PCSK9 expression was dramatically increased. PCSK9 knockdown alleviated MIRI via the BNIP3-mediated autophagic pathway, and improved myocardial infarct size and cardiac function.

PCSK9

SiRNA

Myocardial ischemia-reperfusion injury

Autophagy

Bnip3

Knock down

Every year, more than 17 million people die as a result of cardiovascular disease, making it the leading cause of death worldwide^[1]. Myocardial infarction (MI) has a significant impact on cardiovascular disease-related mortality, and MIRI contributes significantly to MI, potentially leading to the possibility of heart failure, arrhythmias, and eventually cardiac systolic dysfunction^{[2, 3]}. Though the mechanism of MIRI has not been fully elucidated, it has been linked to be closely associated with Ca2 + overload, reactive oxygen species (ROS) accumulation, reduced adenosine triphosphate (ATP) production, and reduced mitochondrial membranes^{[4, 5]}.

When a cell sustains external damage, autophagy digests the damaged organelles to re-feed the cell and maintain intracellular homeostasis^[6]. Autophagy occurs in four stages: nucleation, elongation, segregation, and degradation^[7]. The activation of autophagy was shown to be controlled by regulating the concentration of Sirt3 in myocytes. The incidence of future myocardial infarction patients could be significantly reduced by maintaining proper autophagy expression at various stages of myocardial ischemia-reperfusion^[6]. However, the mechanism underlying the link between autophagy and myocardial ischemia-reperfusion injury is unknown.

A class of PCSK9 inhibitors is being used in clinical trials to lower cholesterol levels by inhibiting the hepatic low-density lipoprotein (LDL) receptors, which raises serum LDL-c levels in the process^[8]. Activation of death-edge kinases or lower pH in the first phase of reperfusion after ischemia maintenance can reduce myocardial infarct volume caused by a high-fat diet^{[9, 10]}. In contrast the increase in myocardial infarct volume in hypercholesterolemia is associated with increased reactive oxygen species (ROS) formation during reperfusion^[11]. It is thought that PCSK9 protects the myocardium by preventing autophagy from occurring, which is why it is upregulated in IMRI hearts^[12].

Both atherosclerotic cardiovascular disease and myocardial infarction were reduced when LDL-C levels were lower. The benefits of PCSK9 inhibitors in lowering LDL-C and lowering cardiovascular risk are undeniable. Therefore, in August 2019, the European Society of Cardiology (ESC) and the European Atherosclerosis Society (EAS) issued a joint recommendation to develop stricter LDL-C level targets for patients with recent MI ^[13]. During ischemia-reperfusion injury, the use of PCSK9 inhibitors can reduce the incidence of myocardial infarction and arrhythmias^[14]. It would be even more impressive that evolocumab may be effective in reducing myocardial infarction size and severity. It is well known that myocardial infarction size is related to reperfusion opening time, and mortality may be further reduced if myocardial infarction size can be significantly reduced ^{[15, 16]}.

The main focus of the study is how PCSK9 is linked to MIRI and autophagy, what pathways regulate it, how this affects myocardial infarction size and cardiac function, and whether PCSK9 inhibitors can reduce IRI, improve MI, and thereby reduce the autophagy pathway through which PCSK9 inhibitors mortality rate.

Animals

A total of 48 adult male Sprague-Dawley rats, weighing 250–300 g, were purchased from the Suzhou Xishan Biotechnology Co., LTD. [License No: scxk (Xiang) 2019-0014]. All rats were housed in a temperature-controlled environment with a 12:12 hour light-dark cycle, with free access to food and water. Rats were sacrificed with intravenous injection of 10%chloral hydrate at 3mL/kg after the experiments. Animal experiments were approved by the Animal Experimentation Committee of the Institutional Review Board of Guizhou Medical University and complied with the guidelines of Guizhou Medical University for the care and use of animals.

Myocardial ischemia -reperfusion protocol

Rats were anesthetized with Chloral hydrate (3mL/kg) and Intraperitoneal heparin injection. When the rats were mechanically ventilated after endotracheal intubation, the tidal volume was 1.0 ml per minute and respiration rate was 100 minutes. A left-sided chest opening is performed at the fourth intercostal space, and the pericardium is opened. An 8 − 0 filament gently crosses the LAD 2/3 of the way around the LAD, located between the starting points near the pulmonary cones. Occlusion of the LAD causes epicardial cyanosis with local hypokinesis and typical ECG changes of acute myocardial infarction (marked ST-segment elevation with T-wave changes). MIRI was induced by ligating the LAD artery for 30 minutes, followed by reperfusion for 3 days by removing the sutures^[17]. PCSK9 small interfering RNA or scrambled siRNA (1ug/10g) were injected into the apex and anterolateral wall of the heart with insulin needle in rats at the end of ischemia. A total of 48 adult male Sprague-Dawley rats were randomly divided into three experimental groups using the methodology of random number table, as follows(I) the control group in which rats were subjected to the same manipulation but without LAD ligation. Scrambled RNAi was used as control (n = 16); (II) the ischemia/reperfusion (I/R) group, where rats received ischemia-reperfusion and saline administration (n = 10); and (III) the I/R + SiRNA groups, the left ventricular wall was injected with SiRNA (1ug/10g) into the apex and anterolateral wall of the heart, using an insulin needle, while ischemia-reperfusion. For three days, the rats were cared for after the chest was closed and they began to recover. The sequence of PCSK9 siRNA was as follows: An antisense molecule, 5′-GGAGGUGUAUCUCUUAGAUTT-3′, is also available. Measuring the extent of the heart attack.

Assessment of the size of the myocardial infarct

Infarct size was estimated using Evans blue (EB, Beijing Solarbio Science & Technology Co., Ltd., China)/2,3,5-triphenyltetrazolium staining (TTC, Beijing Solarbio Science & Technology Co., Ltd., China). Following reperfusion, the rats were re-anesthetized and the LAD re-ligated and injected with 2 ml 2% Evans blue via the tail vein. After the skin of the lips and distal limbs were blue-stained, the hearts were removed, rinsed with 4◦C phosphate-buffered saline (PBS), and frozen at − 80◦C for 30 min, and sliced into 5–7 slices. The sections were immersed in 1% TTC buffer (pH = 7.5) for 30 min at 37◦C. The area at risk (AAR) was defined as the area not stained by Evans blue, and the infarct area (IA) was defined as the area not stained by TTC. Images of the stained slices were captured with a digital camera, quantified by Image-Pro Plus, and presented as a percentage^[18]. Images of the stained slices were captured with a digital camera, quantified by Image-Pro Plus, and presented as a percentage.

Echocardiographic assessment of LV function

A VINNO6 high-resolution ultrasound system was used to perform an echocardiographic analysis on day 3 after IRI to assess cardiac function in anesthetized rats. Ejection fraction (EF) and shortening fraction (FS) measurements were performed to assess the left ventricular (LV) systolic function of the heart. The average of three consecutive cardiac cycles was used for each measurement.

Cell Culture、Simulated ischemia and Transfection of siRNA

AC16 cells (American Tissue Culture Collection) were cultured in Dulbecco’s modified Eagle’s medium (DMEM) (Gibco) supplemented with 10% fetal bovine serum (FBS), 100 U/ml penicillin, and streptomycin. Cells were maintained in a humidified 95% air/5% CO2 incubator at 37°C. Simulated ischemia/reperfusion (SI/R) was performed as previously described. Briefly, cardiomyocytes were exposed to a glucose-free, serum-free medium and transferred to a hypoxic modular incubator for 10 hours at 37°C with 5% CO2 and 95% N2. After hypoxia, the medium was replaced with a fresh oxygenated normal or high glucose medium, and the dishes were transferred to a normoxic incubator (95% air/5% CO₂₎ for 8 hours of reoxygenation. All cells were starved for 12 hours with serum-free media before being subjected to normoxia or hypoxia.

SiRNA duplexes corresponding to rat PCSK9 were purchased from RiboBio Biotechnology (Guangzhou, CHN). Cardiomyocytes were transfected with 50 nM of each siRNA for 48 hours using siRNA transfection reagent to inhibit gene expression. The media was replaced with a normal medium, and the cells were subsequently exposed to hypoxia for the times specified. Scrambled RNAi was used as control. To confirm the efficiency of protein knockdown using siRNA, cell lysates were used for Q-PCR or western blot analysis.

Western blot analysis

Human-derived cardiomyocytes and rat myocardial tissue were extracted with RIPA lysis buffer (Beyotime, China) and PMSF (Roche, USA) to extract total protein. Protein content was measured using the BCA protein assay and protein samples were separated by electrophoresis on SDS-PAGE and transferred to a polyvinylidene difluoride membrane.

After 2 hours of blocking with 5% skim milk, the membranes were incubated overnight at 4°C with the primary antibody at a dilution of 1:1000. After washing with PBS containing 0.2% Tween, the membrane was incubated with a secondary antibody for 1 h at room temperature. Then, signals were detected with Pierce ECL Western Blotting Substrate. Intensity quantitation of the bands was captured using Image J software and normalized to β-actin.

Antibodies directed at PCSK9 (ab31762、ab84041), BNip3 (ab109362), Beclin-1 (ab210498) were purchased from Abcam (San Francisco, CA), LC3 (CST#4599) was purchased from Cell signaling (Danvers, MA).

Real time Q-PCR

Total RNA was extracted with TRizol reagent (Thermofisher). cDNA was synthesized with Hiscript III-RT Supermix for qPCR kit (Vazyme) following the manufacturer's instructions. Relative β-actin levels were quantified for each sample based on Ct (amplification cycle threshold), normalized to a value of 1 as an endogenous mRNA standard and expression relative to pseudo-ischemia. Real-time quantitative PCR using gene-specific primers as following Table 1.

Table 1

List of primers used in this study
Gene Species	Forward	Reverse
PCSK9 rat	TGGAACCTGGAGCGGATTAC	TTCCCGGTGGTCACTCTGTA
BNIP3 rat	GGGCTCCTGGGTAGAACT	AGACGGAAGCTGGAACG
Beclin-1 rat	GCGTCAGCTCTCGTCAA	GCCCGGTCTTCAGCTAC
LC3 rat	GGAGTCCTGTGTCTACGG	AAAAGCTGGGGTGTTCCT
β-actin rat	CACCCGCGAGTACAACCTC	CCCATACCCACCATCACACC
PCSK9 human	GCTGTGCCTTGGTTTCCT	TGTGAAGTAGGGGTGCGA
BNIP3 human Beclin-1 human LC3 human β-actin human IL-1β rat NLRP3 rat	CCAGCCTCGGTTTCTATTT GGATGGTGTCTCTCGCA GGCACCAACCCACCTACTC CTCGCTTCGGCAGCACA CCCTTGACTTGGGCTGT TGTTGTCAGGATCTCGCA	TATCTTGGTGTCTGCGA CAGTCTTCGGCTGAGGTT ATCCCACCAGCCAGCAC AACGCTTCACGAAATTGCGT CGAGATGCTGCTGTGAGA AGTGAAGTAAGGCCGGAAT

Histopathological change

Hematoxylin-eosin (H&E) staining and Masson trichrome staining were used to examine myocardial tissue's pathological and morphological changes. Light microscopy was used to examine paraformaldehyde-fixed, paraffin-embedded myocardial tissue slices stained with hematoxylin for 5 minutes, eosin for 2 minutes, or the Masson trichrome staining kit (Beijing Sola Biotechnology Co., Ltd., China).

Immunohistochemistry (IHC)

Heart tissue was prepared into 5-µm thick paraffin sections, dewaxed, and antigenically repaired in 1 mM EDTA (pH 9.0) for 15 min. The slides were then incubated with 10% goat serum for 1 h at room temperature, with primary antibody overnight at 4°C and secondary antibody for 30 min at room temperature. Hematoxylin was used to re-stain the nuclei for 2 min, and differentiation solution was used to differentiate the cells for 5 s and then ammonia was used to return the blue, finally alcohol, the eluate was dehydrated and clear, the neutral resin was used to seal the slides for fixation, microscopic observation (Lycra), and analysis using image pro6.0.

Measurement of cTnT, CK-MB

Myocardial injury was evaluated by measuring plasma concentrations of cardiac troponin T (cTnT) creatine kinase-MB (CK-MB). At the end of the reperfusion period, blood was collected and centrifuged at 1500 rpm for 10 min to obtain plasma. CKMB and cTnT levels and activity were measured using the appropriate ELISA kits (Biosino Bio-Technology and Science Inc., China) according to the manufacturer's protocols, respectively.

Statistical analysis

All experiments were repeated, and data were obtained by repeating them with similar quality. All data were analyzed by GraphPad Prism 7.0 software (CA, USA). Comparisons between groups were made by t-test or two-way ANOVA test for continuous numerical variables. Values are expressed as mean ± standard deviation, and P < 0.05 was considered statistically significant.

Upregulation of PCSK9 and autophagy levels under hypoxia

AC16 cells were subjected to 10 hours of hypoxia and 8 hours of reoxygenation, and total cellular proteins, lysate, and protein buffer were extracted and prepared into upper samples as shown in Fig. 1. PCSK9, Beclin-1, and LC3II/I expression was upregulated in the H/R group compared with the NC group (P < 0.001, n = 4), suggesting a potential relationship between PCSK9 and autophagy. Bnip3 is known to be induced by hypoxia, and autophagy has been shown to be protective against Bnip3-induced autophagy and cell death^[19]. pcsk9 may affect hypoxia-reoxygenated cardiomyocytes by mediating autophagy through the Bnip3 pathway.

Knockdown of PCSK9 leads to downregulation of autophagy levels

In order to explore the relationship between PCSK9 and autophagy. APCSK9 siRNA was transfected into AC16 cells. In line with our hypothesis, mPCSK9 increased LC3-II and Beclin-1 expression as well as autophagic flux in a dose-dependent manner (Fig. 2A-2B). Notably, the efficiency of PCSK9 siRNA transfection was confirmed by WB (Fig. 2C). In contrast, siRNA-mediated suppression of PCSK9 in cardiomyocytes drastically reduced the expression of LC3-II, beclin-1, and autophagic flux, as well as the expression of Bnip3 pathway proteins, which was confirmed at both the protein and RNA levels (Fig. 2D).

In vitro experiments verified the correlation between PCSK9 and the autophagic pathway and could affect autophagy via the Bnip3 pathway, thereby influencing cell death induced by hypoxic reoxygenation. We then performed in vivo experiments in SD rats to further validate this.

PCSK9 is knocked down to restrict the MI region

MIRI was induced in rats as depicted in the schematic diagram shown in Fig. 3A and confirmed via electrocardiography (Fig. 3B). Myocardial infarct size, myocardial damage marker expression, cardiac function, and histomorphological alterations in the heart were all measured. TTC/EB staining showed that knockdown of PCSK9 significantly reduced the size of myocardial infarction, compared with the I/R group (p < 0.001; Fig. 3C-3D). Within 3 days of ischemia, 2.33 ± 0.17 rats in the I/R group developed ventricular tachycardia (VT) and ventricular fibrillation (VF), and 2.1 ± 1.01 rats in the PCSK9 siRNA + I/R group developed ventricular fibrillation. The findings of cardiac enzyme tests revealed that knocking down PCSK9 lowered the severity of myocardial infarction (p < 0.0001; Fig. 3E-3F).

Knockdown of PCSK9 ameliorated MIRI in rats

Echocardiography was used to investigate whether the knockdown of PCSK9 influenced cardiac function. After 3 days of ischemia, the reperfused simultaneous left ventricular wall multipoint injection of PCSK9 siRNA resulted in significantly less unfavorable remodeling as well as better ejection fraction (EF) and shortening fraction (FS) compared to the I/R group (P < 0.001; Fig. 4A-4C). Meanwhile, cardiac enzymes such as CK-MB and CTNT showed that knockdown of PCSK9 resulted in a reduced degree of myocardial infarction compared to the I/R group (p < 0.0001; Fig. 3E-3F).

Knockdown of PCSK9 reduces autophagy expression and improves myocardial fibrosis

We performed HE, Masson staining, and immunohistochemistry tests to further evaluate the effect of PCSK9 knockdown on myocardial histological structure and fibrosis. Furthermore, HE staining shows that the cardiac tissue exhibited a clear and well-organized structure with little inflammatory infiltration or cardiac necrosis in control, however, myocardial structural abnormalities histological changes, including perinuclear vacuolization, necrosis, and massive inflammatory infiltration, were detected in the IR group. In contrast, knockdown of PCSK9 reduces myocardial inflammatory infiltration with a more transparent structure and less tissue necrosis (Fig. 5A). The IR group's Masson stain revealed a significantly increased fibrosis ratio, which was also alleviated by PCSK9 knockdown (Fig. 5B、5F). In IHC staining (Fig. 5C-5E、5G-5I), PCSK9、Bnip3 and Beclin-1 meaningfully raise in the IR group (p < 0.05), however, both autophagy levels and Bnip3 pathway protein expression were downregulated by knocking down PCSK9 (p < 0.05).

Knockdown of PCSK9 inhibiting autophagy via Bnip3 signaling pathway

To further study the mechanism of PCSK9 in vivo, rat models were constructed in this study. The knockdown efficiency was validated by Western blot and Q-PCR findings. After transfection with PCSK-siRNA, the protein and mRNA expression of the Bnip3、Beclin-1 and LC3 were significantly down-regulated (p < 0.05; N = 4; Fig. 6A-6C). We discovered that inhibiting the Bnip3 pathway significantly decreased Beclin-1 expression while increasing P62 expression (p < 0.05; N = 4; Fig. 6D-6E). According to the findings, PCSK9 may suppress autophagy levels by activating the Bnip3 pathway, thereby reducing the damage caused by I/R to cardiomyocytes.

Knockdown of PCSK9 attenuates myocardial inflammatory response

The inflammatory response during myocardial ischemia-reperfusion injury is critical for cardiac healing, whereas excessive inflammation prolongs infarction and promotes poor cardiac remodeling. Understanding the mechanisms underlying these uncontrolled inflammatory processes has significant implications during MIRI treatment^[20]. It has been shown that interleukin-1β(IL-1β) and Nod-1 ike receptor protein 3 (NLRP3) are significantly elevated in ischemia, and we have also performed experiments with inflammatory mediators. The results are shown in Fig. 7. Compared with the control, IL-1 and NLRP3 expression was significantly upregulated in the IR group (P < 0.05, n = 5; Fig. 7A), however, compared with the IR + PCSK9 siRNA group, expression was significantly downregulated (p < 0.05,n = 5; Fig. 7), indirectly suggesting that knockdown of PCSK9 could improve MIRI by suppressing autophagy levels and attenuating the inflammatory response.

Cardiovascular disease accounts for one-third of all death, and ischemic heart disease is the primary cause of death. To the best of our understanding, I/R damage frequently happens in clinical circumstances with complex mechanisms^[21]. PPCSK9 inhibitor therapy may be useful in reducing biochemical and physiological problems associated with cardiac MIRI^[14]. In recent years, studies have focused on the effects of PCSK9 on cholesterol and low-density lipoprotein. This work demonstrated that the knockdown of PCSK9 could ameliorate MIRI by inhibiting Bnip3 pathway-mediated autophagy. When one suffers external damage, autophagy is a self-repair mechanism; nevertheless, excessive autophagy can lead to increased cell death, reversing the process. Mitophagy is a type of selective autophagy that is involved in ischemia-reperfusion injury^[22].

PCSK9 was found to be considerably up-regulated in ex vivo tests after ischemia/hypoxia, whereas autophagy levels were recruited to further damage mitochondrial structure and metabolic function. Consistently, the results of TTC/EB staining, H&E staining, Masson’s trichrome staining, and cardiac enzymes measuring in this study showed that myocardial infarction area was enlarged, structural abnormalities, and cardiac enzymes (cTnT, CK-MB) levels increased significantly in the I/R group. However, knockdown of PCSK9 regulates autophagy levels through the Bnip3 pathway, and in contrast to the IR group, MIRI severity was reduced, and myocardial infarct size was reduced, resulting in improved cardiac function and reduced mortality. These results suggest that cardiac structures are protected, and the knockdown of PCSK9 increases myocardial viability.

Extensive evidence suggests that autophagy is critical in cardiomyocyte apoptosis during MIRI^{[23, 24]}. Yu et al. discovered that a lack of Mammalian STE20-like kinase1 provides a pro-survival signal to the reperfused heart by reversing FUN14 domain containing 1 related mitophagy and thereby decreasing cardiomyocyte mitochondrial apoptosis^[25]. Furthermore, I/R and oxygen-glucose deprivation/recovery damage raised the amount of Hypoxia-inducible factor-1 (HIF-1) expression, activated downstream BNIP3, and induced mitochondria-dependent autophagy. Up-regulation of HIF-1α and the BNIP3 expression may contribute to I/R-injured SD rat cardiomyocytes and OGD/R injury-induced autophagy in H9C2 cells. We hypothesize that myocardial viability is enhanced through knockdown of PCSK9 regulation associated with autophagy and Bnip3 pathway. To verify this idea, we investigated the relationship between PCSK9 and autophagy and the Bnip3 pathway. WB analysis revealed an increase in Bnip3, Beclin-1, and LC3II/I ratios while decreasing P62, indicating that PCSK9 activated the Bnip3 signaling pathway and increased autophagy levels. PCSK9 siRNA was injected into the left ventricular wall at numerous stages during reperfusion to confirm the role of the Bnip3 pathway in PCSK9 cardioprotection, while PCSK9 siRNA was transfected into cells prior to intrinsic hypoxia-reoxygenation. As expected, in the presence of Bnip3-siRNA, Bnip3 and Beclin-1 protein expression was repressed, P62 was boosted, and the upregulated effect of PCSK9 on autophagy was significantly reduced. These findings show that the key protective mechanism of PCSK9 against MIRI is autophagy inhibition via the Bnip3 pathway.

Inflammasome activation plays a vital role in host defense. At the same time, because autophagy is naturally linked to the adaptive immune system, it is strongly linked to inflammation. Zhang et al. discovered that knocking down lincRNA-Cox2 activated caspase-1, resulting in decreased IL-1 production and increased autophagy^[26]. Furthermore, Wang et al. discovered that neuregulin-1 can reduce reactive oxygen species formation by inhibiting NADPH oxidase 4 and inhibiting the NLRP3/caspase-1 pathway in MIRI to minimize oxidative damage and inflammation^[27]. A recent study showed that normocholesterolemic subjects with lower plasma PCSK9 and higher white adipose tissue surface-expression of LDLR and CD36 have higher NLRP3 inflammasome activation^[28]. To test whether PCSK9 can control inflammatory factors and hence worsen MIRI, PCSK9 knockdown was followed by NLRP3 and IL-1 downregulation, which was confirmed by WB and Q-PCR. The above data show that knockdown of PCSK9 inhibits autophagy and attenuates the inflammatory response, thereby ameliorating MIRI.

PCSK9 is mainly secretion by the liver and can be released into the blood. Circulating PCSK9 levels are associated with LDL-c levels. LDL-C is readily oxidized by ROS, and LOX-1 can be activated by autophagy, thereby regulating infarct size^[29]. Based on this information, we hypothesize that MIRI can be controlled indirectly by modulating autophagy and LDL-c levels. PCSK9 inhibitors are commonly used in lipid-lowering therapy, however their use in individuals with myocardial infarction is debatable. In the Atherosclerosis Risk in Communities trial, deletion of one copy of PCSK9 saves 88 percent of cardiovascular events in humans^[30]. This study provided experimental evidence for reducing reperfusion injury in patients with acute myocardial infarction. A significant number of clinical trials are still needed to validate the clinical use of PCSK9 inhibitors in patients with myocardial infarction.

In ischemic/hypoxic circumstances, PCSK9 expression was dramatically increased. PCSK9 knockdown alleviated MIRI via the BNIP3-mediated autophagic pathway and improved myocardial infarct size and cardiac function.

Author contribution

GWH, XYL, and WL designed and performed experiments, analyzed and interpreted data, and prepared the manuscript. KZ, ZGD, XLX, MZL, CL, YQL and LX participated in the design of the study and performed the statistical analysis. HYZ and ZHL conceived of the study, and participated in its design and coordination and review of this manuscript. All authors read and approved the final manuscript.

Funding

This work was mainly supported by the National Natural Science Foundation of China (Grant No. 81960047) and partially by the Science and Technology Foundation of Guizhou Provence [grant no. (2019)2800]. The National Natural Science Foundation of China (Grant No. 82160086), the Science and Technology Foundation of Health commission of Guizhou Province (Grant No. gzwkj2022-317).

Data Availability

All data, models, or code generated or used during the study are available from the corresponding author by request.

Code availability

Not applicable.

Ethics approval and consent to participate

The authors are accountable for all aspects of the work in ensuring that questions related to the accuracy or integrity of any part of the work are appropriately investigated and resolved. Animal experiments were approved by the Animal Experimentation Committee of the Institutional Review Board of Guizhou Medical University (License No. 2019（105）) and complied with the guidelines of Guizhou Medical University for the care and use of animals. The study was conducted in accordance with the Declaration of Helsinki (as revised in 2013).

Consent for publication

Not applicable.

Conflicts of interest

There are no conflicts of interest.

KUHN T C, KNOBEL J, BURKERT-RETTENMAIER S, et al. Secretome Analysis of Cardiomyocytes Identifies PCSK6 (Proprotein Convertase Subtilisin/Kexin Type 6) as a Novel Player in Cardiac Remodeling After Myocardial Infarction [J]. Circulation. 2020;141(20):1628–44.
HUANG Z-Q XUW, WU J-L, et al. MicroRNA-374a protects against myocardial ischemia-reperfusion injury in mice by targeting the MAPK6 pathway [J]. Life sciences, 2019, 232(116619.
LIU W, CHEN C, GU X, et al. AM1241 alleviates myocardial ischemia-reperfusion injury in rats by enhancing Pink1/Parkin-mediated autophagy [J]. Life Sci, 2021, 272(119228.
ELGEBALY SA, POSTON R, TODD R, et al. Cyclocreatine protects against ischemic injury and enhances cardiac recovery during early reperfusion [J]. Expert Rev Cardiovasc Ther. 2019;17(9):683–97.
SULAIMAN D, LI J, DEVARAJAN A, et al. Paraoxonase 2 protects against acute myocardial ischemia-reperfusion injury by modulating mitochondrial function and oxidative stress via the PI3K/Akt/GSK-3β RISK pathway [J]. Journal of molecular and cellular cardiology, 2019, 129(154 – 64.
ZHENG Y, SHI B. MA M, et al. The novel relationship between Sirt3 and autophagy in myocardial ischemia-reperfusion [J]. J Cell Physiol. 2019;234(5):5488–95.
ANZELL A R, MAIZY R, PRZYKLENK K, et al. Mitochondrial Quality Control and Disease: Insights into Ischemia-Reperfusion Injury [J]. Mol Neurobiol. 2018;55(3):2547–64.
GU H-M, ZHANG D-W. Hypercholesterolemia, low density lipoprotein receptor and proprotein convertase subtilisin/kexin-type 9 [J]. J biomedical Res. 2015;29(5):356–61.
PONCELAS M, INSERTE J, VILARDOSA Ú, et al. Obesity induced by high fat diet attenuates postinfarct myocardial remodeling and dysfunction in adult B6D2F1 mice [J]. Journal of molecular and cellular cardiology, 2015, 84(154 – 61.
INSERTE J, ALUJA D, BARBA I, et al. High-fat diet improves tolerance to myocardial ischemia by delaying normalization of intracellular PH at reperfusion [J]. Journal of molecular and cellular cardiology, 2019, 133(164 – 73.
ANDREADOU I, SCHULZ R. BADIMON L, et al. Hyperlipidaemia and cardioprotection: Animal models for translational studies [J]. Br J Pharmacol. 2020;177(23):5287–311.
DING Z, WANG X. LIU S, et al. PCSK9 expression in the ischaemic heart and its relationship to infarct size, cardiac function, and development of autophagy [J]. Cardiovasc Res. 2018;114(13):1738–51.
MOMTAZI-BOROJENI A A, SABOURI-RAD S, GOTTO A M, et al. PCSK9 and inflammation: a review of experimental and clinical evidence [J]. Eur heart J Cardiovasc pharmacotherapy. 2019;5(4):237–45.
MCSWEENEY C M PALEES, MANEECHOTE C, et al. PCSK9 inhibitor improves cardiac function and reduces infarct size in rats with ischaemia/reperfusion injury: Benefits beyond lipid-lowering effects [J]. J Cell Mol Med. 2019;23(11):7310–9.
WIVIOTT SD, GIUGLIANO R P, MORROW D A, et al. Effect of Evolocumab on Type and Size of Subsequent Myocardial Infarction: A Prespecified Analysis of the FOURIER Randomized Clinical Trial [J]. JAMA Cardiol. 2020;5(7):787–93.
SCHWARTZ G G, STEG P G, SZAREK M, et al. Alirocumab and Cardiovascular Outcomes after Acute Coronary Syndrome [J]. N Engl J Med. 2018;379(22):2097–107.
ZHOU H, MO L, HUANG N, et al. 3-iodothyronamine inhibits apoptosis induced by myocardial ischemia reperfusion via the Akt/FoxO1 signaling pathway [J]. Annals of Translational Medicine. 2022;10(4):168-.
ROSSELLO X, HALL A R, BELL R M, et al. Characterization of the Langendorff Perfused Isolated Mouse Heart Model of Global Ischemia-Reperfusion Injury: Impact of Ischemia and Reperfusion Length on Infarct Size and LDH Release [J]. J Cardiovasc Pharmacol Ther. 2016;21(3):286–95.
CRUCET M, WüST SJA, SPIELMANN P, et al. Hypoxia enhances lipid uptake in macrophages: role of the scavenger receptors Lox1, SRA, and CD36 [J]. Atherosclerosis. 2013;229(1):110–7.
NING K, JIANG L, HU T, et al. ATP-Sensitive Potassium Channels Mediate the Cardioprotective Effect of Panax notoginseng Saponins against Myocardial Ischaemia-Reperfusion Injury and Inflammatory Reaction [J]. BioMed research international; 2020. 2020(3039184.
LI L, LI X, ZHANG Z, et al. Protective Mechanism and Clinical Application of Hydrogen in Myocardial Ischemia-reperfusion Injury [J]. Pakistan J Biol sciences: PJBS. 2020;23(2):103–12.
WANG J, TOAN S, ZHOU H. New insights into the role of mitochondria in cardiac microvascular ischemia/reperfusion injury [J]. Angiogenesis. 2020;23(3):299–314.
LIU L, JIN X, HU C-F, et al. Exosomes Derived from Mesenchymal Stem Cells Rescue Myocardial Ischaemia/Reperfusion Injury by Inducing Cardiomyocyte Autophagy Via AMPK and Akt Pathways [J]. Cellular physiology and biochemistry: international journal of experimental cellular physiology, biochemistry, and pharmacology, 2017, 43(1): 52–68.
YU S-Y DONGB, FANG Z-F, et al. Knockdown of lncRNA AK139328 alleviates myocardial ischaemia/reperfusion injury in diabetic mice via modulating miR-204-3p and inhibiting autophagy [J]. J Cell Mol Med. 2018;22(10):4886–98.
YU W, XU M, ZHANG T, et al. Mst1 promotes cardiac ischemia-reperfusion injury by inhibiting the ERK-CREB pathway and repressing FUNDC1-mediated mitophagy [J]. J Physiol Sci. 2019;69(1):113–27.
XUE Z, ZHANG Z, LIU H, et al. lincRNA-Cox2 regulates NLRP3 inflammasome and autophagy mediated neuroinflammation [J]. Cell Death Differ. 2019;26(1):130–45.
WANG F, WANG H, LIU X, et al. Neuregulin-1 alleviate oxidative stress and mitigate inflammation by suppressing NOX4 and NLRP3/caspase-1 in myocardial ischaemia-reperfusion injury [J]. J Cell Mol Med. 2021;25(3):1783–95.
CYR Y, LAMANTIA V. BISSONNETTE S, et al. Lower plasma PCSK9 in normocholesterolemic subjects is associated with upregulated adipose tissue surface-expression of LDLR and CD36 and NLRP3 inflammasome [J]. Physiol Rep. 2021;9(3):e14721.
LI D, WILLIAMS V, LIU L, et al. Expression of lectin-like oxidized low-density lipoprotein receptors during ischemia-reperfusion and its role in the determination of apoptosis and left ventricular dysfunction [J]. J Am Coll Cardiol. 2003;41(6):1048–55.
COHEN JC, BOERWINKLE E, MOSLEY T H, et al. Sequence variations in PCSK9, low LDL, and protection against coronary heart disease [J]. N Engl J Med. 2006;354(12):1264–72.

Download PDF

Version 1

posted

You are reading this latest preprint version

Knock down of PCSK9 can improve myocardial ischemia/reperfusion injury by inhibiting autophagy

Status:

Version 1

Abstract

Figures

Introduction

Materials And Methods

Animals

Myocardial ischemia -reperfusion protocol

Assessment of the size of the myocardial infarct

Echocardiographic assessment of LV function

Cell Culture、Simulated ischemia and Transfection of siRNA

Western blot analysis

Real time Q-PCR

Histopathological change

Immunohistochemistry (IHC)

Measurement of cTnT, CK-MB

Statistical analysis

Results

Upregulation of PCSK9 and autophagy levels under hypoxia

Knockdown of PCSK9 leads to downregulation of autophagy levels

PCSK9 is knocked down to restrict the MI region

Knockdown of PCSK9 ameliorated MIRI in rats

Knockdown of PCSK9 reduces autophagy expression and improves myocardial fibrosis

Knockdown of PCSK9 inhibiting autophagy via Bnip3 signaling pathway

Knockdown of PCSK9 attenuates myocardial inflammatory response

Discussion

Conclusion

Declarations

References

Status:

Version 1