Luteolin-7-O-glucoside Corrects the Disorder of Glucose Metabolism in Treating Respiratory syncytial virus Pneumonia

doi:10.21203/rs.3.rs-1619513/v1

Download PDF

Research Article

Luteolin-7-O-glucoside Corrects the Disorder of Glucose Metabolism in Treating Respiratory syncytial virus Pneumonia

https://doi.org/10.21203/rs.3.rs-1619513/v1

This work is licensed under a CC BY 4.0 License

Version 1

posted

You are reading this latest preprint version

Background

Respiratory syncytial virus (RSV) pneumonia is the main causes of acute bronchiolitis in infants. Luteolin-7-O-glucoside (LUT-7G) is a natural flavonoid, which exists in a variety of plants and has a variety of biological activities. The purpose of this study was to reveal the therapeutic effect of LUT-7G on RSV pneumonia from the perspective of glucose metabolism.

Methods

Mice model of RSV pneumonia were constructed and administered LUT-7G intervention (60mg/kg·d^− 1). The pathological injury of lung tissue was observed by HE staining. Real-time qPCR was used to detect inflammatory factors and RSV surface protein. Then the metabolites of glycolysis and tricarboxylic acid cycle (TCA) in lung tissue and serum of mice were detected by gas chromatography-mass spectrometry (GC-MS) to evaluate the regulatory effect of LUT-7G on glucose metabolism under virus infection.

Results

Pharmacodynamic studies show that LUT-7G could reduce the inflammatory injury of lung tissue by up-regulating IL-10 mRNA, reducing RSV G, F protein and pro-inflammatory factor TNF-α and TGF-β mRNA. Target metabonomics showed that RSV infection could up-regulate the levels of glycolysis and TCA metabolites in lung tissue and serum, while LUT-7G could improve the disorder of glucose metabolism and partially reverse the upregulation of glucose, lactate and malate in lung tissue.

Conclusion

LUT-7G can improve the pathological injury of lung tissue induced by RSV by regulating glucose metabolism and inhibiting inflammation.

Respiratory syncytial virus

Luteolin-7-O-glucoside

GC-MS

glycolysis

Tricarboxylic acid cycle.

We found an enhanced glucose metabolic response in mouse models of RSV pneumonia. After the intervention with Luteolin-7-O-glucoside, the inflammatory damage in the lung tissue of mice was reduced, the pro-inflammatory cytokines were decreased, the virus replication was inhibited, and the enhanced glucose metabolism response was reversed. We speculate that Luteolin-7-O-glucoside may regulate the body's immune response to RSV by regulating glucose metabolism.

In the first 15 years of the 21st century, pneumonia is the leading cause of mortality in children under 5 years of age worldwide(1), and respiratory syncytial virus (RSV) is the most common pathogen of pneumonia in children(1, 2). In addition to children, the elderly and immunocompromised patients are also at greater risk of developing severe lower respiratory tract infections after being infected with RSV virus(3). When RSV enters the human body, epithelial cells are first infected, resulting in epithelial cell desquamation and ciliary structure destruction(4), the immune cells are then activated to clear the virus and cause tissue damage(5). Compared with direct destruction of epithelial cells, immune response is a more important cause of inflammatory damage caused by RSV(6, 7).

Intracellular metabolism determines function of immune cells, activation of immune cells such as macrophages, dendritic cells, natural killer cells, and effector T cells is accompanied by an increase in intracellular glycolysis(8-11), and immune cells obtain energy in glycolysis for phagocytosis, antigen presentation, production of effector molecules, etc. A growing number of research shows that changes in intracellular metabolic pathways can affect immune cell function(12). Take macrophage for example, in M2-type macrophages, the tricarboxylic acid cycle (TCA) is intact and combined with oxidative phosphorylation(13). However, the mitochondrial TCA is disrupted in M1-type macrophages, and excess citrate and succinate are produced at the same time, which directly changes the type of cytokines released by macrophages(14). If several key genes in the glycolytic pathway are disturbed, macrophages can be polarized in the M2 direction(15). Viral and intracellular bacterial pathogens can reprogram host cell metabolism to meet their own needs(16), and RSV can disrupt cellular energy metabolism, especially mitochondrial function, which interferes with immune function of the organism(17-19).

Currently, the prevention and treatment methods against RSV are very limited, and there are only few types of vaccines and monoclonal antibodies aimed at interfering with RSV infection, which are only suitable for specific groups of people(20, 21). At present, only symptomatic treatment is available for patients with RSV pneumonia, and there is a lack of means to regulate the body's immune system and metabolic system against RSV infection.

Luteolin-7-O-glucoside (LUT-7G) is a natural flavonoid compound which exists in various vegetables and herbs(22, 23), and has various biological activities such as anti-inflammatory, antioxidant, antimicrobial, anticancer(24-28). One study found that in a mouse model of inflammation induced by CFA (Complete Freund's Adjuvant), LUT-7G inhibited the expression of IL-1β in nerve tissue and serum, and inhibited the activation of macrophages and microglia in nerve tissue(26). In a rat model of cerebral ischemia-reperfusion, LUT-7G down-regulated inflammatory mediators such as IL-1β, TNF-α, iNOS and COX-2 in brain tissue, and inhibited the activation of NF-κB signaling pathway(27). The functions of LUT-7G in regulating immune cells and inhibiting the release of pro-inflammatory molecules suggest that it may be used in the treatment of pulmonary inflammation.

In conclusion, in order to verify the therapeutic effect of LUT-7G on RSV pneumonia, we constructed an RSV mouse model and intervened with LUT-7G. We observed the lesions of lung tissue by HE staining, observed RSV replication ability by detecting RSV G and F protein mRNA and assessed lung tissue inflammation by detecting the levels of inflammatory factors TNF-α, TGF-β, IL-10 mRNA. Finally, we detected the key intermediates of glycolysis and mitochondrial TCA in mouse lung tissue and serum by gas chromatography-mass spectrometry (GC-MS), and observed the effect of LUT-7G on energy metabolism in RSV-infected mice.

2.1 Experimental Materials

2.1.1 Experimental Animals

SPF-grade female BALB/c mice aged 5-6 weeks (17-19g) were purchased from Qinglongshan Animal Breeding Center in Jiangning District, NanJing City, China. Permit Number: SCXK (su) 2017-0001.

2.1.2 Cells and Viruses

Human epidermoid larynx carcinoma cells contaminated with Hela cells were purchased from ATCC (CCL-23). Cells in passages 5-30 used for experiments. Human respiratory syncytial virus (RSV) strain A2 Long was purchased from China Center for Type Culture Collection (Wuhan, China). Cells and viruses were preserved in Jiangsu Provincial Key Laboratory of Childhood Respiratory Diseases (Traditional Chinese Medicine).

2.1.3 Drugs and Reagents

LUT-7G purchased from Nanjing Liangwei Biotechnology Co., Ltd. (Nanjing, China)

Carboxymethyl cellulose sodium salt (CMC-Na, C4888), hydrochloride (98%), pyridine (99.8%), 1, 2-13C2-glucose (SH2326V, 99%), N,O-Bis(trimethylsilyl)-trifluoroacetamide (BSTFA), pyruvate (Batch no: SLBP4879V), glucose (Batch no: WXBC1347V), lactate (Batch no: BCBS2643V) , 3-phosphoglycerate (Batch no: SLBW5317), malate (Batch no: WXBB0572) , succinate (Batch no: SLBR5477V) , citrate (Batch no: MKBS5294V) , fumarate (Batch no: WXBB1420V) and α-ketoglutarate (Batch no: BCBT6944) were purchased from Sigma-Aldrich Company (St Louis, MO, USA). Phosphoenolpyruvate (PEP, Batch no: D1712023) and cis-aconitate (Batch no: C1806046) were purchased from Shanghai Aladin Biochemical Technology Co. LTD. Isocitrate (Batch no: H06S7B19343) was purchased from Source Leaf Creature (Shanghai, China).

TRIzol reagents was purchased from Ambion (Texas, USA). Reverse transcription reagents, Taq DNA polymerase, quantitative real time PCR reagents were purchased from Vazyme Biotech Co., Ltd (Nanjing, China).

2.1.4 Primers for Real-Time PCR

PCR primers (Table 1) were synthesized by Shanghai Sangon Biotechnology Co., Ltd (Shanghai, China).

2.2 Experimental Methods

2.2.1 Animal Modeling, Drug Administration and Material Collection

RSV was amplified on Hep-2 cells and cultured in DMED [DMEM containing 2% FBS (v/v), 100 U/mL penicillin, and 0.1 mg/mL streptomycin] at 37°C, 5% CO2. When cell fusion lesions caused 50%-80% of Hep-2 cells to shed (typically occurs between 48h and 72h after infection), both supernatant and cells were collected, vortexed vigorously for 5-10 s, centrifuged at 3,000 rpm for 10 min, aspirated the supernatant, and then stored at -80°C for use. The titer of RSV was quantified by a plaque assay.

The experimental protocol was approved by the Animal Ethics Committee of Nanjing University of Chinese Medicine. After 1 week of adaptive feeding, the mice were anesthetized by ether inhalation. The control group was given 80 μL of saline through the nose, and the other groups were given 80 μL of RSV virus solution containing 5 × 10⁵ PFU. LUT-7G was given daily (60mg/kg·d^-1) intragastrically for at least 12 hours after the mice were infected with RSV. The control group and the model group were given saline containing 0.5% CMC-Na, once a day. Both groups were intervened for 4 days.

The mice were anesthetized within 24 hours after the last administration, and blood was collected from the eyeballs. Then the mice were sacrificed by dislocation, lung tissues were obtained for HE staining, PCR, GC-MS and other experiments.

2.2.2 Lung Histopathological Evaluation

Left-lung tissues of mice were fixed with 4% paraformaldehyde overnight, dehydrated by gradient ethanol, then embedded in paraffin, sectioned to a thickness of about 4 μm and dried for later use. HE staining was performed, microscope images were acquired and analyzed. HE staining was mainly used to evaluate the infiltration of airway inflammatory cells, with a score of 0 being no inflammation, 1 being slight or very little, 2 being moderate or more, 3 being severe or much, and 4 being very severe or heavy. 0 is normal, 1, 2, 3, and 4 are graded from mild to severe. The pathological scores of 5 mice in each group were counted.

2.2.3 Detection of Viral Surface Proteins and Inflammatory Factors by RT-PCR

RNA was extracted from mouse lung tissues with TRIzol reagents and reverse transcribed. Quantitative PCR was performed on a Quant Studio 7 Flex real-time PCR system using Eva Green Master Mix reagents. The data were calculated and analyzed by the 2^-^△△^CT method, and normalized with GAPDH as the internal reference.

2.2.4 Detection of Glycolysis and TCA Intermediates by GC-MS

2.2.4.1 Preparation of Reference Solution

Accurately weighed an appropriate amount of glucose, 3-phosphoglycerate, PEP, pyruvate, citrate, cis-aconitate, isocitrate, and succiniate, placed the above reference substance in a 10mL volumetric flask, and diluted with water. Proper amounts of fumarate, malate, lactate and α-ketoglutarate were placed in a 10mL volumetric flask, diluted with methanol to prepare a mother solution, and then diluted with methanol solution to a predetermined gradient concentration (Supplementary Table 1).

2.2.4.2 GC-MS-based Samples Preparation for Metabolomics

Taked 50 μL of serum samples, lung tissue lysates or 50 μL mixed reference solution, added 200 μL of ice methanol (containing 10 ug/mL internal standard 1,2-13C-myristic acid), vortexed for 3 min, and incubated at 4°C , 18,000 rpm, centrifugation for 10 min. Taked 100 μL of the supernatant, put it in a centrifugal concentrator and evaporate to dryness for 2 h, added 30 μL of 10 mg/mL methoxyamine pyridine solution, mixed for 3 min, and shaked in a constant temperature shaker at 30 °C , 450rpm for 1.5 h. Added 30 μL of BSTFA, mixed well, shaked at 37°C , 450rpm for 0.5 h, then centrifuged at 18,000 rpm for 10 min, taked the supernatant, transfered the mixture to a sampling bottle with a glass insert and conducted GC-MS analysis .

2.2.4.3 Gas Phase Conditions and Mass Spectrometry Conditions

The gas chromatograph equipped with the Trace 1310 automatic sampling system, the chromatographic column was a TG-5MS capillary chromatographic column, and the temperature program was adopted. The initial temperature was kept at 60 °C for 1 min, then increased to 100 °C at 30 °C/min, and finally increased to 300 °C at 20 °C/min and held for 2 min. The inlet temperature was 300 °C; the split mode was 20:1; the carrier gas was high-purity helium, and the flow rate was 1.2 mL/min; the injection volume was 1 μL.

Electron impact (EI) was used as an ionization source for GC-MS analysis. The ion source temperature and transfer line temperature were both 300 °C; the ionization energy was 70 eV; the solvent peak delay time was 3.8 min. The retention time of each target metabolite was obtained by full scan mode, each metabolite was quantitatively determined by selective reaction monitoring (SRM) mode, and the collision gas was high-purity argon. The specific parameters of each metabolite are shown in Supplementary Table 2, and the extracted ion chromatogram of each reference substance is shown in Supplementary Figure 1-2.

2.2.5 Statistical Analysis

GraphPad Prism 7.0 was used for data processing and graphing, and measurement data were expressed as Mean ± SD. One-way ANOVA was used for comparisons among multiple groups, Dunnett's post-hoc was used for multiple comparisons, P<0.05 was considered as statistically significant difference. MetaboAnalyst 3.0 (http://www.metaboanalyst.ca) was used to perform principal component analysis (PCA), partial least-squares discriminant analysis (PLS-DA) and metabolic pathway analysis on metabolomic data (Supplementary Table 3).

3.1 LUT-7G attenuates RSV-induced lung tissue damage

In order to study the protective effect of LUT-7G on mouse lung tissue, we took out the lung tissue for HE staining. Compared with the control group, the lung tissue of the mice in the model group showed typical pathological changes after RSV infection, including pulmonary interstitial edema, alveolar wall thickening, and inflammatory cell infiltration, etc. These injuries were all repaired after LUT-7G intervention. As shown in Figure.1, compared with the control group, the pathological score of the lung tissue of the mice in the model group was significantly increased (P<0.05), and the pathological score was significantly decreased after the LUT-7G intervention (P<0.05).

3.2 LUT-7G inhibits RSV replication and attenuates RSV-induced inflammatory responses

The transcription level of RSV G and F proteins can reflect the RSV replication ability. We measured the mRNA levels of RSV G and F proteins in mouse lung tissue to clarify the replication ability of the virus in lung tissue. We found that RSV replication was obvious in the lung tissue of mice in the model group, and the mRNA levels of RSV G and F proteins were significantly increased (P<0.05), while the mRNA levels of RSV G and F proteins were significantly decreased after LUT-7G treatment (P<0.05) (Fig.2 A-B), indicating that the replication of RSV virus is inhibited.

Cytokines TGF-β, TNF-α, and IL-10 can reflect the pulmonary inflammation caused by RSV infection. We detected the mRNA levels of the above cytokines in mouse lung tissue by RT-PCR technology to study the effect of LUT-7G on the above cytokines. The results showed that the mRNA levels of TGF-β and TNF-α in the lung tissue of mice infected with RSV were significantly increased (P<0.05), and the mRNA level of IL-10 was also increased to a certain extent. LUT-7G can reduce the mRNA levels of TGF-β and TNF-α (P<0.05), and increase the mRNA level of IL-10 (Fig.2 C-E), which has an inhibitory effect on inflammation, indicating that LUT-7G can reduce RSV inflammation.

3.3 Metabolomics analysis results of lung tissue and serum after LUT-7G intervention in RSV mice

To study the effect of RSV infection on energy metabolism in mice, we selected 11 key intermediates in glycolysis and mitochondrial TCA cycle, and performed targeted metabolomic analysis on mouse lung tissue and serum by GC-MS. First, we identify the global metabolic differences between groups by principal component analysis (PCA). As shown in Figure.3, serum samples have shown a segregation trend between groups, and this trend is more pronounced in lung tissue samples(Fig.3A-B). Then we used PLS-DA to perform multivariate analysis on each group. The results showed that compared with the normal group, there were significant differences in the target metabolite profiles after RSV infection, while the serum and lung tissues of the LUT-7G group showed different degrees of regression trends(Fig.3C-D).

We used MetaboAnalyst 3.0 to draw heatmaps of target metabolites in serum and lung tissue respectively to judge the changing trend of each target metabolite (Supplementary Figure.3). In lung tissue, compared with the control group, the target metabolites in the model group were regulated to different degrees. After LUT-7G intervention, except for succinate and pyruvate, other target metabolites have different degrees of regression and the regression trend of glucose is the most obvious.

Compared with the control group, serum lactate, pyruvate, 3-phosphoglycerate, and cis-aconitate increased significantly after RSV infection, and these up-regulated metabolites were all down-regulated after LUT-7G intervention. It is worth noting that serum glucose and tricarboxylic acid cycle intermediates such as α-ketaglutarate, succinate, fumarate, and malate were up-regulated after LUT-7G intervention (Figure.4).

In this study, we validated the therapeutic effect of the flavonoid LUT-7G on RSV pneumonia. In mouse models of RSV pneumonia, LUT-7G attenuated lung tissue damage, inhibited RSV replication, and modulated cytokine levels in inflammatory condition. The most surprising thing is that LUT-7G reversed the intracellular metabolic disturbance caused by RSV.

We assessed the inflammatory status of the lungs by detecting changes in cytokines such as TNF-α, IL-10, and TGF-β1. TNF-α is an important proinflammatory cytokine which mediates various acute and chronic inflammations including autoimmune diseases. In viral pneumonia, TNF-α is released by immune cells and participates in activating the immune system(29), and may even be involved in the occurrence of inflammatory storms(30). IL-10, a cytokine with anti-inflammatory properties(31), is indispensable for maintaining epithelial cell integrity in infectious diseases, limiting viral or bacterial-induced inflammatory responses and promoting tissue healing(32). TGF-β1 is a cytokine that exerts pro-inflammatory or immunosuppressive functions depending on the environment(33, 34). Upon RSV infection, TGF-β1 amplifies RSV-induced epithelial inflammation(35), induces host cell cycle arrest and promotes RSV replication(36), attenuates macrophage-mediated type I IFN responses and promotes macrophage apoptosis of cells(37).In addition, TGF-β1 can amplify the effect of RSV infection on mitochondrial respiratory function and reduce ATP production(37). After the intervention of LUT-7G, the pro-inflammatory cytokines TNF-α and TGF-β1 decreased, while the level of anti-inflammatory cytokine IL-10 increased. We believe that LUT-7G can regulate inflammatory factors to reduce inflammatory damage.

Although our study cannot fully reveal the mechanism, our data suggest that RSV does increase intracellular metabolism. In mouse serum and lung tissue, the levels of upstream metabolic substances such as glucose and pyruvate, as well as key intermediates in glycolysis and TCA were up-regulated due to RSV infection, and this trend was particularly significant in lung tissue. Most viruses can alter or enhance specific metabolic pathways(38), such as herpes simplex virus type 1 (HSV-1), which induces host cells to preferentially use glucose for nucleotide synthesis over glycolysis or TCA(39, 40); Intracellular glucose consumption, glutaminolysis, and glycolysis are all increased upon adenovirus HAdV-2 infection, and the carbon flux in virus-infected cells are increased rather than decreased(41). ATP is necessary for viral particles to attach and enter host cells, while the TCA provides the raw material for the synthesis of biomolecules required for viral replication(40). In addition, some TCA intermediates, including citrate and succinate, can also act as signaling molecules to mediate metabolic reprogramming and inflammatory responses(42, 43).

RSV may alter cellular metabolism to meet its own energy needs by affecting host cell mitochondrial function. Although there is no direct evidence that RSV utilizes intermediates of the TCA, studies have shown that RSV alters the division of mitochondria in host cells(17). RSV induces mitochondrial redistribution to perinuclear positions near the center of microtubule organization, reducing mitochondrial membrane potential and increasing mitochondrial reactive oxygen species (ROS) production(17). RSV also affected mitochondrial protein abundance, inhibiting the activity of multiple proteins including mitochondrial complex I(18, 19). In addition, the accumulation of mitochondrial ROS can not only promote the replication of RSV(17, 18), but also induce the expression of glucose transporter-1 (Glut1) and glycolysis-related enzymes such as hexokinase and lactate dehydrogenase by enhancing the expression of hypoxia inducible factor-1α (HIF-1α), thereby regulating the cellular oxidative phosphorylation shifts to the glycolytic pathway, promoting lactate production(44). Our study showed that after LUT-7G intervention, the abnormal intracellular metabolic level in mice was corrected, which was manifested in the decrease of pyruvate, lactate and intermediates of glycolysis and TCA in lung tissue and serum. Although we are not clear about the mechanism, we speculate that LUT-7G prevents RSV from hijacking cellular metabolic pathways and inhibits RSV replication by regulating intracellular metabolism.

We observed that the levels of lactate in the lung tissue and serum of RSV-infected mice were significantly increased, and we speculated that this was related to the disturbance of mitochondrial function and the increase of pyruvate levels. The overall level of intracellular metabolism increases during virus infection, in order not to accumulate excess pyruvate and affect the tricarboxylic acid cycle, cells reduce excess pyruvate to lactate. Although more and more studies have shown that lactate can be used as an energy substance(45) to supply energy to organs such as the brain and skeletal muscle under special conditions(46, 47), the accumulation of lactate in the body may not be beneficial to health. Lactate is a potential nutrient for tumors(48) and acts as a signaling molecule in promoting tumor cell proliferation, promoting tumor inflammation and stimulating tumor angiogenesis(49, 50). Elevated lactate levels are also detrimental to antiviral signaling(51). Lactate can competitively bind to the transmembrane domain of mitochondria antiviral signaling protein (MAVS), interrupt the mitochondrial localization of MAVS, interfere with the interaction between retinoic acid-inducible gene protein I (RIG-I) and MAVS and the aggregation of MAVS, thereby inhibiting RLR (RIG-I like receptor) antiviral signaling pathway and downstream type I IFN production(51).

In our experiment, the levels of lactate in serum and lung tissue of mice were significantly down-regulated after LUT-7G intervention. We speculate that the levels of metabolites such as lactate may be correlated with the levels of inflammatory factors and inflammatory damage. Macrophages play an important role in the immune response against pulmonary infection(52). During RSV infection, autocrine TNF-a by macrophages can induce macrophage and monocyte necrosis through RIPK1, RIPK3 and MLKL-dependent pathways, aggravating the lung damage(53). The same clinical observation found that nasal TNF-a levels in infants with RSV bronchitis were positively correlated with disease severity, with higher TNF-a levels leading to longer hospital stays(53). Polarization and function of macrophages are regulated by intracellular metabolites(54). The researchers found enhanced pulmonary glycolysis in paraquat-induced acute lung injury rats, accompanied by increased lactate levels and increased M1 macrophages(55). The use of the glycolysis inhibitor 2-DG could inhibit the polarization of macrophages towards the M1 phenotype(55). Lipopolysaccharide could induce the core metabolic response of macrophages from oxidative phosphorylation to glycolysis, greatly increase the TCA intermediate succinate, and increase the level of inflammatory factor IL-1β mediated by HIF-1α(14). The above studies have shown that intracellular metabolites can act as inflammatory mediators to affect immune cell function, and induce immune cells to release inflammatory factors to participate in inflammatory damage. LUT-7G can simultaneously down-regulate glucose metabolism intermediates and inflammatory factors such as TNF-a. We speculate that LUT-7G may affect immune cell function by regulating intracellular glucose metabolism, thereby reducing the release of inflammatory factors and the inflammatory response.

Taken together, in the mouse model of RSV pneumonia, there is hyperactivity of intracellular glycolysis and TCA in lung tissue. LUT-7G can attenuate inflammatory injury in mouse lung tissue, inhibit RSV replication in lung tissue, down-regulate pro-inflammatory cytokine levels and up-regulate protective cytokine levels, and modulate intracellular glucose metabolism. Our research proves that LUT-7G can treat RSV pneumonia through multiple pathways, and its regulation of intracellular metabolic pathways in infection and inflammatory states has further research value.

LUT-7G: luteolin-7-O-glucoside;

RSV: respiratory syncytial virus;

GC-MS: gas chromatography mass spectrometry;

TCA: tricarboxylic acid cycle;

PCA: principle component analysis;

PLS-DA: partial least-squares-discriminate analysis;

IL-1β: interleukin-1β;

TNF-α: tumor necrosis factor-α;

iNOS: inducible NO synthase;

COX-2: cyclooxygenase-2;

NF-κB: nuclear factor-κB;

EI: electron impact;

SRM: selective reaction monitoring;

RT-PCR: reverse transcription-polymerase chain reaction;

PFU: plaque-forming units;

NK: nature kill;

MAVS: mitochondrial antiviral signaling protein;

RIG-I: retinoic acid-inducible gene protein I;

RLR: RIG-I like receptor;

RIPK1: receptor-interacting protein kinase 1;

RIPK3: receptor-interacting protein kinase 3;

MLKL: Mixed lineage kinase domain-like protein;

HIF-1α: hypoxia-inducible factor-1α.

Ethics approval and consent to participate: All animal experiments in this study received ethical approval from the Animal Ethical Council of Nanjing University of Chinese Medicine (Permit number is 012071001578).

Consent for publication: Not applicable.

Availability of data and material: The datasets used and/or analysed during the current study are available from the corresponding author on reasonable request.

Competing interests: The authors declare that they have no competing interests.

Funding: This work was supported by National Natural Science Foundation, China (81873340; 82174436).

Authors' contributions: Li W-F, Chen Y-Z, Ling X-Y conceived the project and designed the experiments. Tao J-L and Yuan B reviewed the experimental process. Li W-F, Chen Y-Z, Ling X-Y, Sun Y-L conducted the experiments, analyzed data, and prepared the manuscript. Tao J-L and Yuan B evaluated the manuscript critically and all authors read and approved the final manuscript.

Acknowledgements:

This work was supported by National Natural Science Foundation, China (81873340; 82174436). We would like to thank the participants of both studies.

Liu L, Oza S, Hogan D, Chu Y, Perin J, Zhu J, et al. Global, regional, and national causes of under-5 mortality in 2000-15 an updated systematic analysis with implications for the Sustainable Development Goals. The Lancet. 2016;388(10063):3027–35.
O'Brien KL, Baggett HC, Brooks WA, Feikin DR, Hammitt LL, Higdon MM, et al. Causes of severe pneumonia requiring hospital admission in children without HIV infection from Africa and Asia: the PERCH multi-country case-control study. The Lancet. 2019;394(10200):757–79.
Griffiths C, Drews SJ, Marchant DJ. Respiratory Syncytial Virus: Infection, Detection, and New Options for Prevention and Treatment. Clin Microbiol Rev. 2017;30(1):277–319.
Liesman RM, Buchholz UJ, Luongo CL, Yang L, Proia AD, DeVincenzo JP, et al. RSV-encoded NS2 promotes epithelial cell shedding and distal airway obstruction. J Clin Invest. 2014;124(5):2219–33.
Deng Y, Herbert JA, Robinson E, Ren L, Smyth RL, Smith CM. Neutrophil-Airway Epithelial Interactions Result in Increased Epithelial Damage and Viral Clearance during Respiratory Syncytial Virus Infection. J Virol. 2020;94(13).
Bergeron HC, Tripp RA. Immunopathology of RSV: An Updated Review. Viruses. 2021;13(12).
Li F, Zhu H, Sun R, Wei H, Tian Z. Natural killer cells are involved in acute lung immune injury caused by respiratory syncytial virus infection. J Virol. 2012;86(4):2251–8.
Michalek RD, Gerriets VA, Jacobs SR, Macintyre AN, MacIver NJ, Mason EF, et al. Cutting edge: distinct glycolytic and lipid oxidative metabolic programs are essential for effector and regulatory CD4 + T cell subsets. J Immunol. 2011;186(6):3299–303.
Krawczyk CM, Holowka T, Sun J, Blagih J, Amiel E, DeBerardinis RJ, et al. Toll-like receptor-induced changes in glycolytic metabolism regulate dendritic cell activation. Blood. 2010;115(23):4742–9.
Donnelly RP, Loftus RM, Keating SE, Liou KT, Biron CA, Gardiner CM, et al. mTORC1-dependent metabolic reprogramming is a prerequisite for NK cell effector function. J Immunol. 2014;193(9):4477–84.
Rodriguez-Prados JC, Traves PG, Cuenca J, Rico D, Aragones J, Martin-Sanz P, et al. Substrate fate in activated macrophages: a comparison between innate, classic, and alternative activation. J Immunol. 2010;185(1):605–14.
O'Neill LA, Kishton RJ, Rathmell J. A guide to immunometabolism for immunologists. Nat Rev Immunol. 2016;16(9):553–65.
Jha AK, Huang SC, Sergushichev A, Lampropoulou V, Ivanova Y, Loginicheva E, et al. Network integration of parallel metabolic and transcriptional data reveals metabolic modules that regulate macrophage polarization. Immunity. 2015;42(3):419–30.
Tannahill GM, Curtis AM, Adamik J, Palsson-McDermott EM, McGettrick AF, Goel G, et al. Succinate is an inflammatory signal that induces IL-1beta through HIF-1alpha. Nature. 2013;496(7444):238–42.
Dang CP, Leelahavanichkul A. Over-expression of miR-223 induces M2 macrophage through glycolysis alteration and attenuates LPS-induced sepsis mouse model, the cell-based therapy in sepsis. PLoS One. 2020;15(7):e0236038.
Eisenreich W, Rudel T, Heesemann J, Goebel W. How Viral and Intracellular Bacterial Pathogens Reprogram the Metabolism of Host Cells to Allow Their Intracellular Replication. Front Cell Infect Microbiol. 2019;9:42.
Hu M, Schulze KE, Ghildyal R, Henstridge DC, Kolanowski JL, New EJ, et al. Respiratory syncytial virus co-opts host mitochondrial function to favour infectious virus production. Elife. 2019;8.
Hu M, Bogoyevitch MA, Jans DA. Subversion of Host Cell Mitochondria by RSV to Favor Virus Production is Dependent on Inhibition of Mitochondrial Complex I and ROS Generation. Cells. 2019;8(11).
Munday DC, Howell G, Barr JN, Hiscox JA. Proteomic analysis of mitochondria in respiratory epithelial cells infected with human respiratory syncytial virus and functional implications for virus and cell biology. J Pharm Pharmacol. 2015;67(3):300–18.
Griffin MP, Yuan Y, Takas T, Domachowske JB, Madhi SA, Manzoni P, et al. Single-Dose Nirsevimab for Prevention of RSV in Preterm Infants. N Engl J Med. 2020;383(5):415–25.
Madhi SA, Polack FP, Piedra PA, Munoz FM, Trenholme AA, Simoes EAF, et al. Respiratory Syncytial Virus Vaccination during Pregnancy and Effects in Infants. N Engl J Med. 2020;383(5):426–39.
Zhang B, Nan TG, Xin J, Zhan ZL, Kang LP, Yuan Y, et al. Development of a colloidal gold-based lateral flow dipstick immunoassay for rapid detection of chlorogenic acid and luteoloside in Flos Lonicerae Japonicae. J Pharm Biomed Anal. 2019;170:83–8.
Chen W, Zhou L, Qiao Y, Qi J, Fu G, Xia X. Quality Evaluation of Ilex asprella Based on Simultaneous Determination of Five Bioactive Components, Chlorogenic Acid, Luteoloside, Quercitrin, Quercetin, and Kaempferol, Using UPLC-Q-TOF MS Study. J AOAC Int. 2019;102(5):1414–22.
Xiong J, Li S, Wang W, Hong Y, Tang K, Luo Q. Screening and identification of the antibacterial bioactive compounds from Lonicera japonica Thunb. leaves. Food Chem. 2013;138(1):327–33.
Song YS, Park CM. Luteolin and luteolin-7-O-glucoside strengthen antioxidative potential through the modulation of Nrf2/MAPK mediated HO-1 signaling cascade in RAW 264.7 cells. Food Chem Toxicol. 2014;65:70–5.
Shi CY, He XB, Zhao C, Wang HJ. Luteoloside Exerts Analgesic Effect in a Complete Freund's Adjuvant-Induced Inflammatory Model via Inhibiting Interleukin-1beta Expression and Macrophage/Microglia Activation. Front Pharmacol. 2020;11:1158.
Li Q, Tian Z, Wang M, Kou J, Wang C, Rong X, et al. Luteoloside attenuates neuroinflammation in focal cerebral ischemia in rats via regulation of the PPARgamma/Nrf2/NF-kappaB signaling pathway. Int Immunopharmacol. 2019;66:309–16.
Shao J, Wang C, Li L, Liang H, Dai J, Ling X, et al. Luteoloside Inhibits Proliferation and Promotes Intrinsic and Extrinsic Pathway-Mediated Apoptosis Involving MAPK and mTOR Signaling Pathways in Human Cervical Cancer Cells. Int J Mol Sci. 2018;19(6).
Carvajal JJ, Avellaneda AM, Salazar-Ardiles C, Maya JE, Kalergis AM, Lay MK. Host Components Contributing to Respiratory Syncytial Virus Pathogenesis. Front Immunol. 2019;10:2152.
Soy M, Keser G, Atagunduz P, Tabak F, Atagunduz I, Kayhan S. Cytokine storm in COVID-19: pathogenesis and overview of anti-inflammatory agents used in treatment. Clin Rheumatol. 2020;39(7):2085–94.
Yao Y, Simard AR, Shi F-D, Hao J. IL-10-Producing Lymphocytes in Inflammatory Disease. International Reviews of Immunology. 2013;32(3):324–36.
Ouyang W, Rutz S, Crellin NK, Valdez PA, Hymowitz SG. Regulation and functions of the IL-10 family of cytokines in inflammation and disease. Annu Rev Immunol. 2011;29:71–109.
Dhainaut JF, Charpentier J, Chiche JD. Transforming growth factor-beta: a mediator of cell regulation in acute respiratory distress syndrome. Crit Care Med. 2003;31(4 Suppl):S258-64.
Bedke N, Sammut D, Green B, Kehagia V, Dennison P, Jenkins G, et al. Transforming growth factor-beta promotes rhinovirus replication in bronchial epithelial cells by suppressing the innate immune response. PLoS One. 2012;7(9):e44580.
McCann KL, Imani F. Transforming growth factor beta enhances respiratory syncytial virus replication and tumor necrosis factor alpha induction in human epithelial cells. J Virol. 2007;81(6):2880–6.
Gibbs JD, Ornoff DM, Igo HA, Zeng JY, Imani F. Cell cycle arrest by transforming growth factor beta1 enhances replication of respiratory syncytial virus in lung epithelial cells. J Virol. 2009;83(23):12424–31.
Grunwell JR, Yeligar SM, Stephenson S, Ping XD, Gauthier TW, Fitzpatrick AM, et al. TGF-beta1 Suppresses the Type I IFN Response and Induces Mitochondrial Dysfunction in Alveolar Macrophages. J Immunol. 2018;200(6):2115–28.
Mayer KA, Stockl J, Zlabinger GJ, Gualdoni GA. Hijacking the Supplies: Metabolism as a Novel Facet of Virus-Host Interaction. Front Immunol. 2019;10:1533.
Vastag L, Koyuncu E, Grady SL, Shenk TE, Rabinowitz JD. Divergent effects of human cytomegalovirus and herpes simplex virus-1 on cellular metabolism. PLoS Pathog. 2011;7(7):e1002124.
Sanchez-Garcia FJ, Perez-Hernandez CA, Rodriguez-Murillo M, Moreno-Altamirano MMB. The Role of Tricarboxylic Acid Cycle Metabolites in Viral Infections. Front Cell Infect Microbiol. 2021;11:725043.
Carinhas N, Koshkin A, Pais DA, Alves PM, Teixeira AP. (13) C-metabolic flux analysis of human adenovirus infection: Implications for viral vector production. Biotechnol Bioeng. 2017;114(1):195–207.
Mills E, O'Neill LA. Succinate: a metabolic signal in inflammation. Trends Cell Biol. 2014;24(5):313–20.
Williams NC, O'Neill LAJ. A Role for the Krebs Cycle Intermediate Citrate in Metabolic Reprogramming in Innate Immunity and Inflammation. Front Immunol. 2018;9:141.
Song K, Li B, Chen YY, Wang H, Liu KC, Tan W, et al. LRPPRC regulates metastasis and glycolysis by modulating autophagy and the ROS/HIF1-alpha pathway in retinoblastoma. Mol Ther Oncolytics. 2021;22:582–91.
Bian Y, Li L, Dong M, Liu X, Kaneko T, Cheng K, et al. Ultra-deep tyrosine phosphoproteomics enabled by a phosphotyrosine superbinder. Nat Chem Biol. 2016;12(11):959–66.
Rasmussen P, Wyss MT, Lundby C. Cerebral glucose and lactate consumption during cerebral activation by physical activity in humans. FASEB J. 2011;25(9):2865–73.
Elustondo PA, White AE, Hughes ME, Brebner K, Pavlov E, Kane DA. Physical and functional association of lactate dehydrogenase (LDH) with skeletal muscle mitochondria. J Biol Chem. 2013;288(35):25309–17.
Hui S, Ghergurovich JM, Morscher RJ, Jang C, Teng X, Lu W, et al. Glucose feeds the TCA cycle via circulating lactate. Nature. 2017;551(7678):115–8.
Doherty JR, Cleveland JL. Targeting lactate metabolism for cancer therapeutics. J Clin Invest. 2013;123(9):3685–92.
Colegio OR, Chu NQ, Szabo AL, Chu T, Rhebergen AM, Jairam V, et al. Functional polarization of tumour-associated macrophages by tumour-derived lactic acid. Nature. 2014;513(7519):559–63.
Zhang W, Wang G, Xu ZG, Tu H, Hu F, Dai J, et al. Lactate Is a Natural Suppressor of RLR Signaling by Targeting MAVS. Cell. 2019;178(1):176–89 e15.
Fan R, Wen B, Liu W, Zhang J, Liu C, Fan C, et al. Altered regulatory cytokine profiles in cases of pediatric respiratory syncytial virus infection. Cytokine. 2018;103:57–62.
Santos LD, Antunes KH, Muraro SP, de Souza GF, da Silva AG, Felipe JS, et al. TNF-mediated alveolar macrophage necroptosis drives disease pathogenesis during respiratory syncytial virus infection. Eur Respir J. 2021;57(6).
Kieler M, Hofmann M, Schabbauer G. More than just protein building blocks: how amino acids and related metabolic pathways fuel macrophage polarization. FEBS J. 2021;288(12):3694–714.
Zhang Y, Yuan D, Li Y, Yang F, Hou L, Yu Y, et al. Paraquat promotes acute lung injury in rats by regulating alveolar macrophage polarization through glycolysis. Ecotoxicol Environ Saf. 2021;223:112571.

Table 1. Sequence of primers used in Real-Time PCR

Gene	Forward Prime (5’-3’)	Reverse Prime (5’-3’)
TNF-α	CCCTCACACTCAGATCATCTTCT	GCTACGACGTGGGCTACAG
TGF-β1	CTCCCGTGGCTTCTAGTGC	GCCTTAGTTTGGACAGGATCTG
IL-10	GCTCTTACTGACTGGCATGAG	CGCAGCTCTAGGAGCATGTG
RSV-F	AACAGATGTAAGCAGCTCCGTTATC	GATTTTTATTGGATGCTGTACATTT
RSV-G	CGGCAAACCACAAAGTCACA	TTCTTGATCTGGCTTGTTGCA

No competing interests reported.

supplementaryfiles.docx

Download PDF

Version 1

posted

You are reading this latest preprint version

Luteolin-7-O-glucoside Corrects the Disorder of Glucose Metabolism in Treating Respiratory syncytial virus Pneumonia

Status:

Version 1

Abstract

Background

Methods

Results

Conclusion

Figures

Summary At A Glance

Introduction

Materials And Methods

Result

Discussion

Abbreviations

Declarations

References

Tables

Additional Declarations

Supplementary Files

Status:

Version 1