Four experiments were carried out to investigate (1) the growth performances of S. indica in co-inoculation with Azospirillum zeae under supplemented tryptophan (Trp), (2) the effect of tryptophan on symbiosis performances of S. indica with wheat seedling experiment, (3) the effect of A. zeae and S. indica on wheat performances under salinity stress and (4) effect of A. zeae and S. indica on P5CS expression and proline accumulation. Trp inhibited S. indica growth, but introduced A. zeae as co-culture could mitigate the adverse effect of Trp on S. indica growth. Co-inoculation of S. indica with A. zeae gave better results in salt affected plants in terms of plant biomass, water content and photosynthetic pigments (chl-a, chl-b and carotenoids). While plants inoculated with S. indica accumulated higher concentration of proline in leaves, plants inoculated with Azospirillum showed a lower concentration of proline under both salinity and non-salinity stress. However, plants co-inoculated with A. zeae and S. indica showed lower accumulation of proline in leaves, but had higher concentration of N, chlorophyll content, water content and biomass. Salinity decreased shoot nitrogen contents, but the reductions were lower in inoculated plants than in the un-inoculated seedlings.
Research Article
Improvement of salt tolerance of wheat through co-inoculation with Azospirillum zeae and Serendipita indica
https://doi.org/10.21203/rs.3.rs-1627249/v1
This work is licensed under a CC BY 4.0 License
Version 1
posted
You are reading this latest preprint version
Salinity stress
P5CS
proline
co-inoculation
Plant growth and yield are determined by various factors such as soil structure and fertility, soil water availably and nutrient availability. Salinity of water and soil are among the environmental constraints that determine the overall growth and performances of plants in cropland affected by soil saline and salinity of irrigation. Most arable lands in arid and semiarid areas are affected by salinity of soil and water. Salinity is now considerate as a serious issue for world food security. Introducing and investigating techniques that result in amelioration of salt stress in crop production would be important. PGPR/F has been reported to have potential to ameliorate salt stress in crop plants. The beneficial effects of plant growth-promoting rhizobacteria and fungi (PGPR/F) in crop productivity have been reported frequently (Okon et al. 1994; Jha et al. 2009; Helman et al. 2011; Franken 2012; Reis et al. 2015; Hartmann et al. 2019). Mechanisms of PGPR/F that mediated salt stress tolerance would be important and given the strategies to apply these microorganisms in crop production under saline conditions.
Salt in soil and irrigation water inhibit plant growth through injury to excess salt inside the plant cell and by inducing water deficit in soil. Plants involved several mechanisms to combat salinity stress. Accumulation of compatible osmolyte such as soluble sugar and proline and exclusion of Na while entering into the plant and preventing Na transport to leaves are among mechanisms that tolerate plant to salinity (Munns et al. 2006; Roy et al. 2014).
Among the PGPB, genus Azospirillum are the famous and most studied bacteria. Bacteria of the genus Azospirillum are Gram-negative, atmospheric N fixer, with ability to colonize the cortex tissues and root. Strains of Azospirillum have been frequently reported that have beneficial effects on the growth and yield of many economicaly important crops (Okon et al. 1994; Helman et al. 2011; Zarea 2017). Besides N fixation, better growth and yield of crops due to inoculation with Azospirillum has been mainly attributed to IAA production by Azospirillum spp (Bashan and Holguin, 1997; Fukami et al. 2018).
Serendipita indic, previously known as Piriformospora indica, (Weiß et al. 2016) belongs to a group of plant growth promoting microorganisms. This fungus is characterized with diverse plant growth promoting properties and has attracted attention worldwide. Published reports have shown that S. indica successfully resulted in improving the growth of diverse plant species tested (Varma et al. 2012, Gill et al. 2016) under non-stress and stress conditions (Franken 2012; Zarea et al. 2012; Waller et al. 2005).
Proline is an important compatible osmolyte that osmo-protect plants. Proline can stabilize protein andcell membranes, scavenge hydroxyl radicals and can be a source of nitrogen and carbon (Kavi Kishor et al. 2005). Hu et al. (1992) cloned the Δ1-pyrrolin-5-carboxylate synthetase (P5CS) gene for the first time from Vigna aconitifolia. In plants, proline is biosynthesized via two pathways. The precursors of proline are glutamate and/or ornithine. Proline catabolism is an oxidation process of two steps. Catabolism of proline starts with conversion of proline to P5C by proline dehydrogenase (PDH) and then pyrroline-5-carboxylate dehydrogenase (P5CDH) converts P5C to glutamate (Lehmann et al., 2010). A biosynthesis and degradation activity regulates the accumulation of proline (degradation (Mattioli et al., 2009). Several studies demonstrated that glutamate is the most responsible for the accumulation of proline in plant (Delauney and Verma, 1993; Hare and Cress, 1997). ProDH is a key enzyme that regulates accumulation o f proline (Peng et al., 1996).
Previous works dealing with PGPR have been shown that resulted in inducing salinity tolerance of various plants such as eggplant (Abd El-Azeem et al. 2012), maize (Chen et al. 2016). Co-inoculation with PGPR and rhizobium has been also reported to induce salt tolerance in various plants such as mung bean (Ahmad et al. 2011, 2013), corn (Bano and Fatima 2009). In wheat, co-inoculation with P. indica and Azospirillum improved physiology and yield performances under salt-induced conditions (Zarea et al. 2012). Potential application of bacteria to mitigate salinity stress has been proved in various plants (Ashraf et al. 2004; Chen et al. 2012; Atouei et al. 2019).
Indole acetic acid (IAA) is one of the most important plant hormones. Cell division and elongation, root formation, etc. are controlled and regulated by the IAA. IAA has been reported to affect the response of plant to environmental stress such as drought (Zarea 2019). Decreasing in free IAA has been assumed to be an adaptation mechanism response of plants to stress (Zarea 2019). Salt stress can affect the concentration of IAAA in plant leaves (Prakash and Prathapasenan 1990; Albacete et al. 2008). However, the severity of stress affects the lvels of IAA (Pierik and Testerink 2014). Synthesis of IAA by Azospirillum was detected during all growth stages. Different species produce various amounts of IAA. Several factors such as growth stage, substrate availability and culture condition also reported to have influence on IAA production (Malhotra and Srivastava 2009). Trp, as an IAA precursor, excretes by root plants under natural condition can be utilized by microorganisms occupied in the rhizosphere (Hayat et al. 2010). Excreted Trp of root plant can be converted into IAA by rhizobacteria or other IAA -dependent Trp bacteria.
In the present investigation, 4 experiment were carried out to investigate (1) the growth performances of S. indica in co-inoculation with A. zeae under supplemented tryptophan (Trp), (2) the effect of tryptophan on symbiosis performances of S. indica with wheat seedling experiment, (3) the effect of A. zeae and S. indica on wheat performances under salinity stress and (4) effect of A. zeae and S. indica on P5CS expression and proline accumulation.
2.1 Plant growth promoting microorganisms used in this study
Azospirillum zeae used in this study was able to survive at 1% NaCl. This strain was isolated from the interior root of wild wheat and able to colonize the interior root of wheat. The strain, Azospirillum zeae sp2 was identified based on the molecular approaches by Dr Katja Buro (Erfurt Research Centre for Horticultural Crops, University of Applied Sciences Erfurt). Based on the 16S rRNA gene analyses, the strain was identified as Azospirillum zeae (98% similarity with A. zeae). The culture of S. indica was obtained from Professor Philipp Franken (Erfurt Research Centre for Horticultural Crops, University of Applied Sciences Erfurt). S. indica has been reported that could survive at 0.4 M NaCl in modified Hill and Kafer broth medium (Zarea et al. 2012).
Experiment 1: in vitro growth performances of S. indica in co-inoculation with Azospirillum
Tryptophan (Trp) is used as a precursor for IAA produced by IAA-producing bacteria (Spaepen et al. 2007). Effect of A. zeae on S. indica was assayed under in vitro condition. S. indica were grown and maintained on agar-solid Kaefer medium in a petri dish supplemented with 10 g L-1 agar (Kaefer, 1977, Fig. 1). Fresh culture of the fungus S. indica was prepared on modified Hill and Kaefer agar medium and was used in all the experiments. Cultures were incubated in the dark at room temperature. The effect of Trp (1 g L-1) was elucidated on the growth of S. indica. S. indica in co-culture and sloe culture with Azospirillum. S. indica was grown in solidified medium in 8 cm Petri-dish supplemented with and without Trp for 7d. The basal medium used in this study consisted of Malic acid, 4.0 g; glucose, 1.0 g; yeast extract, 0.5 g; MgSO4 7H2O, 0.3 g; KH2PO4, 0.5 g; CaCl2, 0.02g; FeCl3, 0.015 g L-1 distilled water and 2 ml bromothymol blue (5 g L-1 in 0.2 N KOH). pH of the medium adjusted to 6.9 by KOH. One fungal agar plug (1×1 cm size) was placed into the center of the plates. Bacterial strain was streaked in the periphery of each plate separately. Cultures were incubated in the dark at room temperature. Growth response of S. indica to two Trp was evaluated in terms of fungus radial growth.
2.2 Experiment 2: effect of Tryptophan on S. indica symbiosis with wheat seedling
Co-culture in vitro of S. indica with pre-germinated wheat seeds was carried out according to the method description by Vadasseryet et al. (2008). Modified plant nutrient mediums (PNM, Vadasseryet et al. 2008) containing 0.0 and 1 g Trp L-1 PNM medium were prepared. Wheat seeds were surface sterilized in 70% ethanol for 3 min and in 3% sodium hypochlorite solution for 10 min. surface sterilized seeds were then rinsed several times in distilled water. 10 spore of S. indica were inoculated into a petri dish containing PNM. 2 days old pre-germinated seeds were placed near (at the distance of 2 cm) the spores for 14 days. The un-inoculated control seedlings received the same medium disc without the fungus. Root samples taken from seedlings from each petri dish were softened by heating in 10% KOH solution for 15 min. Softened root samples were then acidified in 1 M HCl solution for 10 minutes. Samples were then rinsed in distilled water three times. Finally root samples were stained by simmering in 0.02% Trypan blue overnight. To remove excess stain, samples were stained with 50% lactophenol for 2 h. The percentage of total root colonization and chlamydospore formation was determined according to the method described by McGonigle et al. (1990) and Varma et al. (1990), respectively. Root colonization was examined under a light microscope.
2.3 Experiment 3: effect of Azospirillum and S. indica on wheat performances under salinity stress
The investigation of the relationship between Azospirillum and S. indica and wheat plant under salinity stress in the terms of water contents, fresh and dry weights, photosynthetic pigments (Chla, b and carotenoids), Proline and Antioxidant Enzymes of wheat was done under greenhouse condition. For seed treatment with bacterial strain, culture of bacterial strain was cultured in modified NFb medium (Karimi et al. 2018) using 1 mL of the overnight-grown bacterial culture as initial inoculum. Wheat seeds were first surface sterilized by immersion in 98% ethanol for 30s, and followed by 2% sodium hypochlorite solution for 4 min. Seeds were then washed thoroughly with distilled water. Seeds were divided into two groups and one group of seeds received 1 mL of 1.8 107 CFU g-1 seed of Azospirillum and the second one received autoclaved bacterial inoculum. Soil used for pot culture was collected from crop land at the 0–30 cm depth of soil. Collected soil was sterilized at 120°C for 20 min. 10 g of S. indica (containing mycelium and spores) per kg soil (on dry weight basis) was mixed with sterilized soil thoroughly. Control treatment received autoclaved S. indica colure at the rate of 10 g of S. indica (containing mycelium and spores) per kg soil. The experiment was conducted out in complete randomized design with 8 treatments in a 2×2×2 complete factorial combination of Azospirillum (inoculation and non-inoculation), S. indica (inoculation and non-inoculation) and salinity irrigation (non-saline water and irrigation with saline water with ECw 12 dS/m) having 3 repeats. Plastic pots were filled with 7 kg of farmland soil. Farmland soil was collected from the top surface (0–30 cm). The pots were irrigated with tap water or saline water once a week. Azospirillum-inoculated wheat seeds (Triticum aestivum L.) of cultivar pishgam were sown at the rate of 10 seeds per pot. Pots were then thinned to 5 per pot. Pots were irrigated at 70 filed capacity. Pot at the tillering growth stage received 1 g N pot-1 and 0.25 g P pot-1. Fertilization was made three times, at tillering, stem elongation and grain filling. Control pots received the same amount of fertilizers. Dry and fresh weights of plants, water content, photosynthetic pigment content, Antioxidant enzymes (peroxidase and catalase and) activities and proline contents were measured for each treatment 70 days after sowing. Following the method Strain and Svec (1966), photosynthetic pigment concentrations of the fresh fully expanded leaves were calculated in 70-old day plants. Proline contents were measured in leaves according to the method of Bates et al. (1973). Total nitrogen was measured, using the Kjeldahl method.
2.4 Experiment 4: effect of Azospirillum and S. indica on P5CS expression and proline accumulation
The study amid to evaluate the effects of S. indica and Azospirillum on proline accumulation and expression the gene P5CS involved in the proline synthesis in salinity-induced wheat. Wheat seeds were first surface sterilized by immersion in 98% ethanol for 30s, and followed by 2% sodium hypochlorite solution for 4 min. Seeds were then washed thoroughly with distilled water. Seeds were divided into two groups and one group of seeds received 1 mL of 1.8 107 CFU g-1 seed of Azospirillum and the second one received autoclaved bacterial inoculum. Azospirillum inoculated seeds were sown in pots with 400 g of a farm land soil collected at 0–30 cm depth of soil. Collected soil was sterilized at 120°C for 20 min. 10 g of S. indica per pot (containing mycelium and spores) was placed at the 5 cm depth of the pot. Five Azospirillum-inoculated seeds were sown at 2 cm depth. The salt treatment was done by irrigation of water containing 65 mg of CaCl2 and 0.375 g of NaCl at 26th and 28th day of seedling emergence. Salt treatment was given according to the Rana et al. (2016) method. Leaf samples were then collected after 72 h of final salt treatment. The pot experiment was arranged in a 2 × 2 × 2 factorial scheme based on completely randomized design with three replications. Pot experiment was conducted in a growth chamber under controlled conditions to evaluate the expression analysis of two major genes P5CS. RNA was extracted using RiboEx Total RNA-301-001 kit (Pishgam Biotech. Co., Tehran, Iran). Total RNA was extracted from fully expanded leaf using RiboEx buffer according to the product manual. Leaf tissue were first ground in liquid N and immediately transferred to a 1.5 ml tube, and to it 1 ml of RiboEx buffer was immediately added. Tubes containing extracted samples were left at room temperature for 10 min in horizontal position. Then, tubes were centrifuged at 12,000 g at 4°C for 10 min. The supernatant was transferred into a new 1ml tube. 200 µl of chloroform was added to the tubes and mixed thoroughly by vortex for 15s gently. Tubes were left at room temperature for 2 min. Shortly afterwards, tubes were centrifuged at 12,000 g at 4°C for 15 min. The supernatant was transferred to a new tube. Quality of extracted RNA was checked on a 1.5% agrose gel. The primer sequences for P5CS were used as described by Tavakoli et al. (2016). The forward and reverse primers used for amplification of P5CS were TCGGTGCTGAGGTTGGCATAAG and TTGTCACCATTCACCACTTGCCC (Accession No JQ063079.1). Detection of PCR products was done using the SYBR Green Real-time PCR Master Mix. Proline contents were measured in leaves according to the method of Bates et al. (1973).
3.1 In vitro growth performances of S. indica in co-inoculation with Azospirillum
The effect of Trp on linear growth of S. india is represented in Fig. 1A. Cultural medium supplemented with 1 g liter-1 Trp had inhibitor effect on linear growth of S. india. Azospirillum used in this study could produce about 6.2 to13.5 µl indole ml-1 based on the cultural medium composition in the absence of Trp and adding Trp into medium had no significantly effect on IAA production by this bacteria. Our preliminary experiment showed that this bacterial strain prevented the IAA production by S. indica in the presence of Trp (Data not shown). On the other hand, although Trp inhibited S. indica growth, but introduced Asopirillum as co-culture could mitigate the adverse effect of Trp on S. indica growth (Fig. 1B). Bacteria might use Trp as carbon source.
3.2 Effect of Tryptophan on S. indica symbiosis with wheat seedling
Figure 2A shows the effect of Trp on infection level of colonized root with S. indica. Cultural medium supplemented with Trp significantly decreased the colonization rate by up to 21% (Fig. 2a). Lower S. indica root infection rate may be because of the inhibitory effect of Trp supplemented into the cultural medium. Figure 2B and Fig. 2C show the single spore germinated in co-culture with wheat and representative micrograph of colonization of wheat roots grown in PNM medium Supplemented with 1 g L-1, respectively.
3.3 Effect of Azospirillum and S. indica on wheat performances under salinity stress
Water contents, fresh and dry weights and photosynthetic pigments (Chla and b and carotenoids) of 70 day old wheat seedlings responses to S. indica and Azospirillum inoculation were measured under greenhouse conditions. Fresh and dry weights, photosynthetic pigments and water content significantly affected by the main and the interaction effects of the salinity, Azospirillum and S. indica. Water content, fresh and dry matter accumulations and photosynthetic pigments of shoots of un-inoculated 70-day old seedlings were significantly decreased due to salinity irrigation (Table 1). Salinity decreased fresh, dry weight, water content, chlorophyll a and b and carotenoids up to 169%, 156%, 44.73%, 72.8% and 14.65%, respectively as compared to non-salinity conditions. Plants co-inoculated with Azospirillum and S. indica showed better performances under both salinity and non-salinity conditions. It seems that A. zeae and S. indica could reverse the inhibitory effect of salinity on all of the recorded traits in 70-day old seedlings. Accumulation of proline was measured 70 days after sowing. The effect of salinity, Azospirillum and S. indica and interaction effect of them was significant on leaf proline acumulation. Proline contents in leaves increased significantly due to salinity stress (Fig. 3). The inoculation with S. indica increased proline accumulation in leaves (Fig. 3). Plants inoculated with Azospirillum had the same accumulation concentrations of proline both under non-salinity and salinity conditions. Co-inoculation with Azospirillum and S. indica reduced the proline accumulation in leaves both under non-salinity and salinity stress (Fig. 3).
Main and interaction effects of treatments (salinity, Azospirillum inoculation and S. indica) on nitrogen content were significant. Plants inoculated with Azospirillum and S. indica had higher N content in shoots as compared to control treatment (Fig. 4). Salinity decreased N content in shoots up to 48 (Fig. 4). This decrease was less in case of inoculation (Fig. 4). On the other hand, Bacterial and S. indica inoculation inhibited this decrease of N content.
|
Tabl. 1 Effect of the inoculation with S. indica and Azospirillum brasilense on some yield parameters of wheat cultivated under non-saline and salinity conditions |
||||||||||
|
|
|
|
|
Water content (g) |
Fresh weight (g) |
Dry weight (g) |
|
Photosynthetic pigment content (mg/g dry wt) |
||
|
|
|
|
|
|
|
|
|
Chla
|
Chlb |
Carotenoids |
|
Salinity |
Azospirillum |
S. indica |
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
0.3 dS/m |
T2 |
I2 |
|
0.71a |
1.98a |
0.17a |
|
31.26a |
25.80a |
23.4a |
|
T2 |
I1 |
|
0.66a |
1.81b |
0.15b |
|
30.20ab |
25.43a |
21.59b |
|
|
T1 |
I2 |
|
0.68a |
1.80b |
0.15b |
|
30.03ab |
24.63a |
20.59bc |
|
|
T1 |
I1 |
|
0.55b |
1.51c |
0.13cd |
|
28.13b |
23.23b |
19.44cd |
|
|
|
|
|
|
|
|
|
|
|
|
|
|
12 dS/m |
T2 |
I2 |
|
0.71a |
1.59c |
0.14bc |
|
24.91c |
22.26bc |
23.58a |
|
T2 |
I1 |
|
0.71a |
1.58c |
0.14c |
|
24.40c |
21.50c |
19.60cd |
|
|
T1 |
I2 |
|
0.64a |
1.46c |
0.13d |
|
22.99c |
21.46c |
18.91d |
|
|
T1 |
I1 |
|
0.38c |
0.56d |
0.049e |
|
16.75d |
20.26d |
16.64e |
|
|
LSD0.05 |
|
|
|
0.075 |
0.12 |
0.014 |
|
0.014 |
1.19 |
1.59 |
|
|
|
|
|
|
|
|
|
|
|
|
|
Significant |
|
|
|
|
|
|
|
|
|
|
|
Salinity (S) |
|
|
|
<0.0437 |
<0.0001 |
<0.0001 |
|
<0.0001 |
<.0001 |
<0.0008 |
|
Azospirillum (A) |
|
|
|
<0.0001 |
<0.0001 |
<0.0001 |
|
<0.0001 |
<0.0003 |
<<0.0001 |
|
S. indica (I) |
|
|
|
<0.0001 |
<0.0001 |
<0.0001 |
|
0.0004 |
<0.0048 |
<0.0001 |
|
S×A |
|
|
|
<0.0033 |
<0.0001 |
0.0002 |
|
0.0099 |
<0.2493 |
<0.0935 |
|
S×I |
|
|
|
<0.2580 |
<0.0001 |
0.0058 |
|
0.0933 |
<0.8648 |
<0.0440 |
|
A×I |
|
|
|
<0.0004 |
<0.0030 |
<0.0001 |
|
0.0075 |
<0.2075 |
<0.01333 |
|
S×A×I |
|
|
|
<0.0255 |
<0.0001 |
<0.0001 |
|
0.0355 |
<0.6029 |
<0.04884 |
|
CV |
|
|
|
|
4.80 |
6.06 |
|
4.9 |
2.95 |
4.45 |
Water contents, fresh and dry weights and photosynthetic pigments (Chla and b and carotenoids) of 70 day old seedling were measured under greenhouse condition. Table ---shows that water content and fresh and dry matter accumulations and photosynthetic pigments of shoots of un-inoculated 70-day old seedlings were significantly decreased due to salinity irrigation. Plants co-inoculated with Azospirillum and S. indica showed better performances under both salinity and non-salinity condition. It seems that A. zeae and S. indica could reverse the inhibitory effect of salinity on all of the recorded traits in 70-day old seedlings. .
conditions and after 72 h of salinity treatment. Significant difference (p < 0.05) was observed in shoot biomass of both Kh 65 and HD 2009 under salinity treatment. There was greater reduction in shoot biomass in the salt sensitive variety HD 2009 (53.3% reduction) as compared to tolerant Kh 65 (38.32% reduction). Table 15.3 shows that shoot height, root depth, water contents and fresh and dry weights of shoots and roots of un-inoculated 30-day old seedlings were signifi -cantly decreased with increasing NaCl levels. Giza 123 was more affected by NaCl in all un-inoculated seedlings compared with Giza 2000. A. brasilense inoculant reversed the inhibitory effect of salinity on all of the measured growth criteria of both cultivars but the response of Giza 123 was much greater.
Experiment 4: effect of Azospirillum and S. indica on P5CS expression and proline accumulation
Figure 5A shows the one of the gel photographs of isolated mRNAs of the leaves and Fig. 5B, resulting gel photographs of P5CS gene with specific primer (Fig. 5B).
Under salinity stress poline concentration in leaf was higher in plants inoculated with S. indica (Fig. 6BC). In the percent study, P5CS gene expression in response to salinity, Azospirillum and S. indica was investigated. P5CS is involved in proline biosynthesis. The relative expression of P5CR increased by salinity (Fig. 6A) while it was 1.3-fold in leaf blades under salt treatment and inoculation with S. indica.
S. indica is indole Trap-dependence (Hilbert 2012). In this study, adding high concentration of Trap (1 g L-1) into the cultural medium caused an inhibitory effect on S. indica growth. However, introducing A. zeae as co-culture promoted the linear growth of S. indica, especially when the cultural medium supplemented with Trp. L-tryptophan is synthesized from the precursor indole-3-glycerol phosphate. Ttryptophanase and tryptophan synthase are the enzymes that involved in tryptophan biosynthesis (Hamilton et al. 1985) according into following reactions:
S. indica has been reported to be tryptophan-dependent. Bacterial strain (Azospirillum zeae) used in this study was not indol Trap-dependence. Bacterial strain didn’t convert tryptophan into indole and indole derivatives. Indole and its derivatives have been reported to be highly toxic to microorganisms (Sun et al. 1987). Studying the microbial degradation of indole and its derivatives has increased recently (Fukuoka et al. 2015). It is worth noting that some bacteria induce plant growth by degrading exogenous IAA in plant roots (Zúñiga et al. 2013). Bacteria those have ability to degrade IAA play a vital role in plant growth-promoting traits (Zúñiga et al. 2013). These bacteria are necessary for efficient rhizosphere colonization. Root exudates contain various compounds such as amino acid, organic acid and sugar. These compounds act as a food source for bacteria. Root exudates contain tryptophan. The associated bacteria that are present around the root utilize tryptophan and other small molecules of the root exudates and convert them into IAA. Some of IAA secreted by these bacteria is taken up by the plant (Fig. 7). Endogenous plant-synthesized IAA together with bacterial IAA taken up can influence the plant. It can stimulate plant growth or by the plant enzyme ACC synthase convert into ACC, ethylene precursor, an inhibitory phytohormone to plant growth. In the present study, bacterial strain improved S. indica growth in broth culture supplemented with tryptophan. Bacterial strain might utilize tryptophan as a C-source or degrade it. Besides, co-inoculation of wheat with bacteria and S. indica resulted in amelioration of the detrimental effect of salinity. Figure 6 summarized a schematic model of possible mechanism of tryptophan involved in IAA producing in plants and plant symbiotanat such as Azospirillum and S. indica in response to salinity stress.
Plants inoculated with bacterial inoculums and S. indica had higher fresh and dry matter accumulations, water cntent nad chlrophyy pigments. These observation is in agreement with the results of Ashraf et al (2004), Bano and Fatima (2009), Abd El-Azeem et al. (2012), Ahmad et al. (2011, 2013), Zarea et al (2012), Chen et al. (2012), Chen et al. (2016), Atouei et al. (2019), which states that there was a better performances of plant growth due to plant growth promoting bacteria inoculation.
In the present study, the mechanism of the plant growth-promoting rhizobacteria Azospirillum zeae and endophytic fungus of Sebacinales iriformospora indica-stimulated tolerance against salinity stresses was investigated under greenhouse condition, salt stress reduced shoot fresh and dry matter accumulation. However, Plants inoculated with S. indica and Azospirillum showed a lesser reduction in shoot fresh and dry weights as compared to un-inoculated plants.
In the precent study, proline contents in leaves increased significantly due to salinity stress. plants inoculated with S. indica had higher proline accumulation in leaves than plant inoculated with bacteria. Co-inoculation of S. indica with bacteria also decreased proline under both non-stress and salinity stress conditions. Proline is an important compatible osmolyte that can stabilize protein and cell membranes, scavenge hydroxyl radical and can be a source of nitrogen and carbon (Kavi Kishor et al. 2005). Catabolism of proline starts with conversion of proline to P5C by proline dehydrogenase and then pyrroline-5-carboxylate dehydrogenase (P5CDH) converts P5C to glutamate (Lehmann et al., 2010).
Plants respond to a variety of stresses by accumulating compatible osmolytes such as proline. Plants exposed to salinity stress accumulate higher concentration of proline. It is worth noting that synthesis of nitrogen compounds such as proline due to salt stress can result in decrease in chlorophyll content (De la Rosa and Maiti 1995). In this study un-inoculated plants had lower concentration of chlorophyll content in leaves under salinity stress. Plants inoculated with S. indica also accumulated higher concentration of proline in leaves due to salinity stress. However, plants inoculated with S. indica had higher N percent in leaves. Proline can act as a reservoir of nitrogen and energy for plants during salinity stress (Rai et al. 2003; Silveira et al. 2003).
Results of the present study revealed that mechanisms by which plant growth promoting rhizobacteria and fungi improve plant responses to stress can be modulated by co-inoculation of bacteria and fungi. In the present study, Azospiriilum could affect the plant response to S. indica and, under in vitro experiment, influence the S. indica growth that can be considered in using PGPR/F in improving the productivity of crops grown under salinity stress.
Funding
The authors did not receive support from any organization for the submitted work.
Competing interests
The authors declare that they have no competing interests.
Consent for publication
Not applicable
Availability of data and materials
All data analyzed and generated during this study are included in this published article and its supplementary information files
Code availability
Not applicable
Authors' contributions
Mohammad Javad Zarea performed the experiments Material preparation, Software, Validation and Writing- Original draft preparation data collection and analysis were performed by and Zohreh Karimi assist in RNA extraction and PCR.
Ethics approval
Not applicable
Consent to participate
Not applicable
Consent for publication (include appropriate statements)
Not applicable
- Abd El-Azeem SAM, Elwan MWM, Sung JK, Ok YS (2012) Alleviation of salt stress in eggplant (Solanum melongena L.) by plant-growth-promoting rhizobacteria. Commun Soil Sci Plan 43: 1303-1315
- Ahmad M, Zahir ZA, Asghar HN, Asghar M (2011) Inducing salt tolerance in mung bean through coinoculation with rhizobia and plant-growth-promoting rhizobacteria containing 1-aminocyclopropane-1-carboxylate deaminase. Can J Microbiol 57: 578-589
- Ahmad M, Zahir ZA, Khalid M, Nazli F, Arshad M (2013) Efficacy of Rhizobium and Pseudomonas strains to improve physiology, ionic balance and quality of mung bean under salt-affected conditions on farmer’s fields. Plant Physiol Bioch 63: 170-176
- Albacete A, Ghanem ME, Martinez-Andujar C, Acosta M, Sanchez-Bravo J, Martinez V, Lutts S, Dodd IC, Pérez-Alfocea F (2008) Hormonal changes in relation to biomass partitioning and shoot growth impairment in salinized tomato (Solanum lycopersicum L.) plants. J Exp Bot 59: 4119-4131
- Ashraf M, Hasnain S, Berge O, Mahmood T (2004) Inoculating wheat seedlings with exopolysaccharide-producing bacteria restricts sodium uptake and stimulates plant growth under salt stress. Biol Fert Soils 40: 157-162
- Atouei MT, Pourbabaee AA, Shorafa M (2019) Alleviation of salinity stress on some growth parameters of wheat by exopolysaccharide-producing bacteria. Ir J Sci Technol Trans A 43: 2725-2733
- Bano A, Fatima M (2009) Salt tolerance in Zea mays (L) following inoculation with Rhizobium and Pseudomonas. Biol Fertil Soils 45: 405-413
- Bates LS, Waldren RP, Tear ID (1973) Rapid determination of free proline for water stress studies. Plant Soil 39: 205–207.
- Chen L, Liu Y, Wu G, Veronican Njeri K, Shen Q, Zhang N, Zhang R (2016) Induced maize salt tolerance by rhizosphere inoculation of Bacillus amyloliquefaciens SQR9. Physiol Plant 158: 34-44
- Cheng Z, Woody OZ, Mcconkey BJ, Glick BR (2012) Combined effects of the plant growth-promoting bacterium Pseudomonas putida UW4 and salinity stress on the Brassica napus proteome. Appl Soil Ecol 61: 255-263
- Das A, Kamal S, Shakil NA, Sherameti I, Oelmuller R, Dua M, Tuteja N, Johri AK, Varma A (2012) The root endophyte fungus Piriformospora indica leads to early flowering, higher biomass and altered secondary metabolites of the medicinal plant, Coleus forskohlii. Plant Sig Behav 7: 1-10
- De la Rosa IM, Maiti RK (1995) Biochemical mechanism in glossy Sorghum lines resistance to salinity stress. J Plant Physiol 146: 515–519.
- Delauney AJ, Verma DPS(1993) Proline Biosynthesis and Osmoregulation in Plants. Plant J 4: 215-223
- Franken P (2012) The plant strengthening root endophyte Piriformospora indica: potential application and the biology behind. Appl Microbiol Biotechnol 96:1455-1464
- Fukuoka K, Tanaka K, Ozeki Y, Kanaly RA (2015) Biotransformation of indole by Cupriavidus sp. strain KK10 proceeds through N-heterocyclic- and carbocyclic-aromatic ring cleavage and production of indigoids, Int Biodeter Biodegr 97: 13-24
- Gill SS, Gill R, Trivedi DK, Anjum NA, Sharma KK, Sharma KK, Ansari MW, Ansari AA, Johri AK, Prasad R, Pereira E, Varma A, Tuteja N (2016) Piriformospora indica: potential and significance in plant stress tolerance. Front Microbiol 7: 332
- Gohya T, Zhang X, Yoshida T, Migita C (2006) Spectroscopic characterization of a higher plant heme oxygenase isoform-1 from Glycine max (soybean): coordination structure of the heme complex and catabolism of heme. FEBS J 273:5384–5399
- Hamilton BK, Hsiao H, Swann WE, Andersen DM, Delente JJ (1985) Manufacture of Amino Acids with Bioreactors. Trends Biotech 1985: 3- 64-68
- Hare P, Cress W (1997) Metabolic Implications of Stress-Induced Proline Accumulation in Plants. Plant Growth Regul 21:79-102
- Hartmann A, Fischer D, Kinzel L, Chowdhury SP, Hofmann A, Baldani JI, Rothballer M (2019) Assessment of the structural and functional diversities of plant microbiota: Achievements and challenges – A review J Adv Res. 19:3-13
- Hayat R, Ali S, Amara U, Khalid R, Ahmed I (2010) Soil beneficialbacteria and their role in plant growth promotion: a review. Ann Microbiol 60:579-598
- Helman Y, Burdman S, Okon Y (2011) Plant growth promotion byrhizosphere bacteria through direct effects. In: Rosenberg E,Gophna U (eds) Heidelberg, Germany: Springer pp. 89-103
- Hu CA, Delauney AJ, Verma DPS (1992) A bifunctional enzyme (1-pyrroline- 5-carboxylate synthetase) catalyzes the first two steps in proline biosynthesis in plants. Proc Natl Acad Sci USA 89: 9354-9358
- Jha B, Thakur MC, Gontia I, Albrecht V, Stoffels M, Schmid M, Hartmann A (2009) Isolation, partial identification and application of diazotrophic rhizobacteria from traditional Indian rice cultivars. Eur J Soil Biol 45:62-72.
- Karimi N, Zarea MJ, Mehnaz S (2018) Endophytic Azospirillum for enhancement of growth and yield of wheat. Environ Sustain 1:149-158
- Kavi Kishor PB, Sangam S, Amrutha RN, Sri Laxmi P, Naidu KR, Rao KRSS, Rao S, Reddy KJ, Theriappan P, Sreenivasulu N (2005) Regulation of proline biosynthesis, degradation, uptake and transport in higher plants: Its implications in plant growth and abiotic stress tolerance. Curr Sci 88: 424-438
- Lecube ML, Noriega GO, Santa Cruz DM, Tomaro ML, Batlle A, Balestrasse KB (2014) Indole acetic acid is responsible for protection against oxidative stress caused by drought in soybean plants: the role of heme oxygenase induction. Redox Rep 19:242–250
- Lehmann S, Funck D, Szabados L, Rentsch D (2010) Proline metabolism and transport in plant development. Amino Acids 39, 949–962.
- Malhotra M, Srivastava S (2009) Stress-responsive indole-3-aceticacid biosynthesis by Azospirillum brasilense SM and its abilityto modulate plant growth. Eur J Soil Biol 1:73-80
- Mattioli R, Falasca G, Sabatini S, Costantino P, Altamura MM, Trovato M (2009) The proline biosynthetic genes P5CS1 and P5CS2 play overlapping roles in Arabidopsis flower transition but not in embryo development. Physiol Plant 137:72-85
- McGonigle TP, Miller MH, Evans DG, Fairchild GL, Swan JA (1990) A new method which gives an objective measure of colonization of roots by vesicular-arbuscular mycorrhizal fungi. New Phytol 115: 495-501
- Munns R, James RA, Läuchli A (2006) Approaches to increasing the salt tolerance of wheat and other cereals. J Exp Bot 57: 1025-1043
- Okon Y, Labandera-Gonzalez CA (1994) Agronomic applications of Azospirillum: an evaluation of 20 years world-wide field inoculation. Soil Biol Biochem 26:1591-1601
- Omar MNA, Osman MEH, Kasim WA, Abd El-Daim IA (2009) Improvement of Salt Tolerance Mechanisms of Barley Cultivated Under Salt Stress Using Azospirillum brasilense. In: Ashraf M, Ozturk M, Athar H (eds) Salinity and Water Stress. Springer Science + Business Media B.V. pp 133-147
- Peng Z, Lu Q, Verma DPS (1996) Reciprocal regulationofD1-pyrroline-5-carboxylate synthetaseandproline dehy-drogenasegenes control proline levels during and afterosmotic stress in plants. Molr Gen Genet 253: 334-341
- Pierik R, Testerink C (2014) The art of being flexible: how to escape from shade, salt, and drought. Plant Physiol 166:5-22
- Prakash L, Prathapasenan G (1990) NaCl-and gibberellic acid-induced changes in the content of auxin and the activities of cellulase and pectin lyase during leaf growth in rice (Oryza sativa). Ann Bot 65: 251-257
- Rai SP, Luthra R, Kumar S (2003) Salt-tolerant mutants in glycophytic salinity responses (GRS) genes in Catharanthus roseus. Theor Appl Genet 106: 221-230
- Rana V, Ram, S, Nehra, K, Sharma, I (2016) Expression of Genes Related to Na+ Exclusion and Proline Accumulation in Tolerant and Susceptible Wheat Genotypes under Salt Stress. Cereal Res Commun 44: 404-413
- Roy SJ, Nagrao S, Tester M (2014) Salt resistant crop plants. Current Opinion in Biotech 26: 115-124
- Silveira JA, Viegas Rde A, da Rocha IM, Moreira AC, Moreira Rde A, Oliveira JT (2003) Proline accumulation and glutamine synthetase activity are increased by salt-induced proteolysis in cashew leaves. J Plant Physiol 160: 115-123.
- Strain HH, Svec WA (1966) Extraction, separation, estimation and isolation of chlorophylls, In: Vernon LP, Seely GR (Eds) Academic Press, New York, pp. 21-66
- Sun Y, Li Y (1987) Indole and cholic acid effects on some biochemical changes during dimethylhydrazine carcinogenesis in mice large intestine. Chinese Medical J 100: 636-638
- Tavakoli1 M, Poustini K, Alizadeh H (2016) Proline Accumulation and Related Genes in Wheat Leaves under Salinity Stress. J Agr Sci Tech 18: 707-716
- Vadassery J, Ritter C, Venus Y, Camehl I, Varma A, Shahollari B, Nova´k O, Strnad M, Ludwig-Müller J, Oelmüller R (2008) The role of auxins and cytokinins in the mutualistic interaction between Arabidopsis and Piriformospora indica. Mol Plant Microb Interact 21: 1371-1383
- Varma A, Hartmann A, Bakshi M, Oelmueller R, Lou B (2012) Piriformospora indica: a novel plant growth-promoting mycorrhizal fungus. Agric Res 1(2):117-131
- Waller F, Achatz B, Baltruschat H, Fodor J, Becker K, Fischer M, Heier T, Hückelhoven R, Neumann C, Von Wettstein D, Franken P, Kogel KH (2005) The endophytic fungus Piriformospora indica reprograms barley to salt-stress tolerance, disease resistance, and higher yield. Proc Natl Acad Sci USA 102:13386-13391
- Weiß M, Waller F, Zuccaro A, Selosse MA (2016) Sebacinales - one thousand and one interactions with land plants. New Phytologist 211: 20-40
- Zarea MJ (2017) Azospirillum and wheat production. In: Kumar V, Kumar M, Sharma SH (Eds) Probiotics in agroecosystem. Springer, Singapore, pp 329-348
- Zarea MJ (2019) Applications of beneficial microbe in arid and semiarid agroecosystem: IAA-Producing Bacteria. In: Kumar V, Prasad R, Kumar M, Choudhary D (Eds) Microbiome in Plant Health and Disease. Springer, Singapore, pp 105-118.
- Zarea MJ, Hajinia S, Karimi N, Mohammadi Goltapeh E, Rejali F, Varma A (2012) Effect of Piriformospora indica and Azospirillum strains from saline or non-saline soil on mitigation of the effects of NaCl. Soil Biol Biochem 45: 139-146.
- Zhang X, Ervin EH, Evanylo GK, Haering KC (2009) Impact of biosolids on hormone metabolism in drought-stressed tall fescue. Crop Sci 49:1893–1901
- Zúñiga A, Poupin MJ, Donoso R, (2013) Quorum sensing and indole-3-acetic acid degradation play a role in colonization and plant growth promotion of arabidopsis thaliana by Burkholderia phytofirmans PsJN. MPMI, 26: 546–553.
- Reis VM, Baldani VLD, Baldani JI (2015) Isolation, Identification and Biochemical Characterization of Azospirillum spp. and Other Nitrogen-Fixing Bacteria. In: Cassán F, Okon Y, Creus C (eds) Handbook for Azospirillum. Springer, Cham, pp 3-26
No competing interests reported.