An atypical case of Babesia bigemina parasitising a dogfrom a rural area of eastern Mexico

doi:10.21203/rs.3.rs-1631028/v1

Download PDF

Case Report

An atypical case of Babesia bigemina parasitising a dogfrom a rural area of eastern Mexico

https://doi.org/10.21203/rs.3.rs-1631028/v1

This work is licensed under a CC BY 4.0 License

Version 1

posted

You are reading this latest preprint version

One dog that shared habitat with domestic animals in a cattle farm and that was exposed to wildlife was taken to a private practitioner for clinical examination. The analyses conducted on the patient revealed a babesiosis due to Babesia bigemina by a molecular test. Clinical signs of the infection were observed in the patient. The animal was treated with imidocarb dipropionate (two doses each 0.5 ml/10 kg b.w. at an interval of 14 days). On treatment day 7, the clinical signs were mostly reduced. On day 30, PCR was carried out to assess the efficacy of the treatment, with a negative result. This case represents the first report of babesiosis due to B. bigemina in a dog living on a cattle farm in Mexico. It indicates the lower host specify of these pathogens and that dogs can play a role as sentinels of vector-borne parasites in livestock animals.

Animal Science

Parasitology

Veterinary Epidemiology

Small Animal Medicine

Molecular Biology

Piroplasms

Tick-borne disease

Phylogenetic analysis

Canine babesiosis

Um cão que compartilhava habitat com animais domésticos em uma fazenda de gado e que foi exposto à vida selvagem foi levado a um clínico particular para exame clínico. As análises realizadas no paciente revelaram uma babesiose por Babesia bigemina por um teste molecular. Os sinais clínicos da infecção foram observados no paciente. O animal foi tratado com dipropionato de imidocarb (duas doses cada 0,5 ml/10 kg de peso corporal em um intervalo de 14 dias). No dia de tratamento 7, os sinais clínicos foram principalmente reduzidos. No dia 30, foi realizada PCR para avaliar a eficácia do tratamento, com resultado negativo. Este caso representa o primeiro relato de babesiose por B. bigemina em um cão que vive em uma fazenda de gado no México. Isso indica que o hospedeiro inferior especifica esses patógenos e que os cães podem desempenhar um papel como sentinelas de parasitas transmitidos por vetores em animais de criação.

Palavras-chave: Piroplasmas, Doença transmitida por carrapatos, Análise filogenética, Babesiose canina

Canine babesiosis is one of the most widespread tick-borne diseases which affects dog populations worldwide. The disease may cause a multi-organ dysfunction syndrome, which can compromise the life of the host. It is caused by several species of the protozoan genus Babesia. Based on the size of the intraerythrocytic stages of the parasite, two main groups have been recognised: the large group (Babesia canis, Babesia rossi and Babesia vogeli) and the small group (Babesia gibsoni, Babesia conradae, Babesia microti-like, Theileria annae or Babesia vulpes) (Baneth et al., 2015; Bawm et al., 2021). Among them, B. vogeli is most widely distributed in canids throughout the tropical and subtropical regions (Penzhorn, 2020). It has been postulated that the species of the genus Babesia has been considered as highly specific for a given host species or group. However, the specificity of these piroplasms is probably lower than expected (Uilenberg, 2006). Since the implementation of molecular methods, which has increased the sensitivity for the detection of infectious agents, unusual parasite-host associations have started to be described more frequently in dogs. Such is the case of piroplasms from livestock and wild artiodactyls (Theileria annulata, Theileria equi, Theileria sinensis, Theileria velifera and uncharacterized Theileria), which have been reported in dogs from different countries of the Afrotropical and Oriental regions (Nayyar-Ghauri et., 2019). On the other hand, on cattle farms, canids may share ectoparasites (that act as vectors of several pathogens) with livestock and wildlife. However, the role of dogs as sentinels of tick-borne parasites in livestock is not fully understood. Thus, considering the high prevalence of several tick’s species in canine populations throughout Mexico, it is not surprising to find these shared pathogens among species of hosts that are infested by the same tick species (Ojeda‐Chi., et al. 2016). This report is the first record of the livestock piroplasm Babesia bigemina in a dog and describes the clinical features of the infection.

A 4-year-old male mixed-breed dog that shared habitat with livestock and was exposed to wildlife was taken to a private practice in the municipality of Jesus Carranza (southern Veracruz, Mexico) with a 1-week history of anorexia, pigmented faeces, haematuria, fever, and lethargy. The dog had not travelled outside of the state of Veracruz and had never received a blood transfusion. After the first physical examination, the dog was evaluated via a baseline assessment consisting of a complete blood count, serum biochemistry and screening for vector-borne diseases, using a immunochromatographic test SNAP 4Dx followed by a blood smear stained with Giemsa and observed at100x. Additionally, ticks on the dog´s body were removed using forceps, and each one was kept in a small flask with 70% ethanol. Ticks were identified according to the morphologic characteristics as described elsewhere (Guzman-Cornejo et al., 2011; Nava et al., 2014). According to taxonomic keys, we identified the tick species Amblyomma mixtum on the dog (Fig. 1a). Blood and serum analyses revealed anaemia; thrombocytopenia, leucocytosis, eosinophilia, blood urea nitrogen and creatinine levels were increased (Table 1). The SNAP 4Dx test was negative. However, light microscopy of the blood smear revealed the presence of pyriform structures inside erythrocytes (Fig. 1b). To confirm the identification of piroplasms, a fragment of the 571-bp region of the 18S ribosomal gene (18S-rDNA) was amplified with the primers BAB01 (5′CCGTGCTAATTGTAGGGCTAATACA3′) and BAB02 (5′ GCTTGAAACACTCTARTTTTCTCAAAG 3′) as described previously (Almeida et al., 2012; Sarma et al., 2019). Genomic DNA was extracted from 100 μL of whole blood using the QIAampDNA Minikit (Qiagen, Germany). Amplification product were submitted for purification and sequencing at Macrogen Inc., Korea, and the obtained sequence were deposited in GenBank under accession number: OM530520. Subsequently, the sequence was compared with those available in GenBank using the Basic Local Alignment Search Tool (BLASTn tool). The BLAST analysis revealed the highest nucleotide identity (i.e.,100% and 99.2%) with reference sequences of Babesia bigemina deposited in GenBank (OK605299, MH050387) reported in cattle and tick Rhipicephalus microplus from China and India. Additionally, sequence generated in this study and those of other Babesia species deposited in GenBank were aligned using the algorithm Muscle in MEGA 11. Subsequently, a phylogenetic reconstruction using the Maximum likelihood method was performed, also in MEGA 11 (Kumar et al., 2018). Branch support was estimated using 1,000 non-parametric bootstraps. The phylogenetic analysis supported the finding of B. bigemina. The sequence generated in this work were grouped with those of B. bigemina in a monophyletic group with support values that varied from 95–100 (Fig. 2).

The dog was treated with imidocarb dipropionate (two doses each 0.5 ml/10 kg b.w. at an interval of 14 days, intramuscularly) and fluid therapy. Additionally, a single dose of a chewable tablet that contained afoxolaner (2.5–5 mg/kg) and milbemycin oxime (0.5–1 mg/kg) NexGard Spectra ® was given orally. On day 7 of treatment, clinical signs in this patient were mostly reduced, with a rapid resolution. On day 20, the dog underwent a physical exam, and blood and serum analysis showed normal values. In day 30, a PCR was carried out again to assess the efficacy of the treatment, and Babesia DNA was no longer detectable. The treatment showed good tolerance and safety, with scarce adverse events observed. The case resolved favorably, and the patient was discharged

In this report, we describe the first record and characterisation of B. bigemina in a dog with clinical and haematological abnormalities consistent with babesiosis in Mexico. Previous records in Mexico have shown that dogs in rural areas can be infested by several hard tick species such as Amblyomma mixtum, Amblyomma ovale, Amblyomma near parvum, Ixodes near affinis, Rhipicephalus microplus, Rhipicephalus sanguineus s.l. and Amblyomma near oblongoguttatum. The tick A. mixtum, detected in this case, is the same as that previously reported attacked to dogs in rural communities in Yucatan (Ojeda-Chi et al., 2019). Additionally, A. mixtum parasitises a wide range of hosts and can take advantage of the nutritional resources present in the area (Guzman-Cornejo et al., 2011). For this reason, it is likely that this tick is a potential transmitter of Babesia species and exchanges several pathogens between domestic animals and wildlife.

The main clinical sign observed in canine babesiosis is anaemia. Some reports state that oxidative stress and lipid peroxidation play a role in the pathogenesis of anaemia in some protozoan diseases. In biological membranes, these mechanisms induce disturbances of the structural integrity, leading to the rupture of the membrane and the release of red blood cell contents, which causes lysis (Holovakha et al., 2018) Other clinical signs of canine babesiosis include fever, anorexia, depression and lethargy (Crnogaj et al., 2010), which coincide with our case. The abnormalities in the elevation of white blood cells could be related to the Babesia infection, with the likely exception of the peripheral eosinophilia. However, absolute eosinophilia cannot be considered a marker of babesiosis, considering that it is not a specific alteration of the infection in dogs but a common finding secondary to several helminths parasitic or allergic diseases (Chidumayo, 2018). Low platelet count is well described in canine babesiosis as well as in other diseases caused by protozoa, such as malaria and trypanosomiasis. However, the mechanism of thrombocytopenia seen in babesiosis is not clear. The severity and rapid recovery of the platelet counts has led to the suggestion that immune-mediated mechanisms are involved (Rautenbach et al., 2018). Higher serum urea levels are not uncommon in dogs with babesiosis, and this elevation is often disproportionate to the rise in creatinine levels. This is probably due to increased protein catabolism and urea production resulting from gastrointestinal haemorrhage or protein catabolism due to the febrile inflammatory illness (Ullal et al., 2018). Regarding treatment, imidocarb is the only agent licensed for treating babesiosis in the United States and has direct action against the parasite DNA, causing unwinding and denaturation. However, a few drugs and drug combinations are used in the treatment of canine babesiosis, often without complete parasite elimination, and the dogs usually become chronic carriers or present with recurrent episodes of acute infection (Baneth, 2018). In this new scenario, veterinarians should be aware of unexpected Babesia species in dogs that, as known for this species, may be even worse than in livestock, considering the rapid manifestation of the clinical signs. In conclusion, the spectrum of Babesia pathogens that infect dogs is gradually being elucidated with the aid of new molecular techniques and meticulous clinical investigation. Additionally, chemoprophylaxis should also be adopted for dogs living in an endemic area, with the primary means of prevention being tick control.

Acknowledgements

All authors would like to thank MVZ. DDM for providing the data for case.

Funding

The authors declare that no funds, grants, or other support were received during the preparation of this manuscript

Conflict of interest

On behalf of all authors, the corresponding author states that there is no conflict of interest

Competing Interests

The authors have no relevant financial or non-financial interests to disclose.

Code or data availability

The data that support the findings of this study are available in GenBank under accession number: OM530520

Author Contributions

All authors contributed to the study conception and design. SSM: Writing – original draft, Formal analysis, Investigation. GGBG: Project administration, Resources. DRS: Investigation, Validation. AOM: Investigation, Validation, JGP: Visualization, Data curation. JLBR: Project administration, Conceptualization, Writing – review & editing.

Ethical approval

All applicable international, national, and/or institutional guidelines for the care and use of animals were followed. No approval was required. Anesthesia, euthanasia, or any other kind of animal sacrifice was not a part of the study.

Consent to participate

Not applicable

Consent for publication

Not applicable

Almeida, A.P., Marcili, A, Leite R.C, Nieri-Bastos, F.A, Domingues, L.N, Martins, J.R, et al. Coxiella symbiont in the tick Ornithodoros rostratus (Acari: argasidae). Ticks Tick. Dis 2012 3:203–206 https://doi.org/10.1016/j.ttbdis.2012.02.003

Baneth, G, Florin-Christensen, M, Cardoso. L, Schnittger. L. Reclassification of Theileria annae as Babesia vulpes sp. nov. Parasit. Vectors 2015 8 (1): 1-7 https://doi.org/ 10.1186/s13071-015-0830-5.

Baneth, G. Antiprotozoal treatment of canine babesiosis. Vet Parasitol 2018 254:58-63

Bawm, S, Myaing, T.T, Thu, M.J, Akter, S, Htun, L.L., Win, M.M et al. PCR detection and genetic characterization of piroplasms from dogs in Myanmar, and a possible role of dogs as reservoirs for Theileria parasites infecting cattle, water buffaloes, and goats. Ticks Tick. Dis 2021 12(4) https://doi.org/10.1016/j.ttbdis.2021.101729

Chidumayo, N.N. Epidemiology of canine gastrointestinal helminths in sub-Saharan Africa Parasit. Vectors 2018 11(1):1-7 https://doi.org/10.1186/s13071-018-2688-9

Crnogaj, M., Petlevski, R., Mrljak, V., Kis, I., Torti, M., Kucer, N., Stokovic, I. Malondialdehyde levels in serum of dogs infected with Babesia canis. Vet Med 2010 55(4):163-171

Guzmán-Cornejo C., Robbins R.G., Guglielmone A.A., Montiel-Parra G., Pérez T.M. The Amblyomma (Acari: Ixodida: Ixodidae) of Mexico: identification keys, distribution and hosts. Zootaxa. 2011 2998(1):16–38

Holovakha, V.I., Piddubnуak, О.V., Bakhur, T.I., Vovkotrub, N.V., Antipov, A.A., Anfiorova, M.V., Macynovich, A.O. Changes in erythrocytopoesis indices in dogs with babesiosis Regul mech Biosyst 2018 9 (3):379-383

Kumar, S., Stecher, G., Li, M., Knyaz, C., Tamura, K. MEGA X: molecular evolutionary genetics analysis across computing platforms. Mol. Biol. Evol 2018 35(6): 1547–1549 https://doi.org/10.1093/molbev/msy096

Nava S., Beati L., Labruna M.B., Cáceres A.G., Mangold A.J., Guglielmone A.A. Reassessment of the taxonomic status of Amblyomma cajennense with the description of three new species, Amblyomma tonelliae n. sp., Amblyomma interandinum n. sp. and Amblyomma patinoi n. sp., and reinstatement of Amblyomma mixtum, and Amblyomma sculptum (Ixodida: Ixodidae) Tick Tick-Borne Dis 2014 5(3):252–276. https://doi.org/10.1016/j.ttbdis.2013.11.004

Nayyar-Ghauri, H., Ijaz, M., Farooqi, S.H., Ali, A., Ghaffar, A., Saleem, S., et al. A comprehensive review on past, present and future aspects of canine theileriosis. Microb. Pathog 2019 12: 116–122. https://doi.org/10.1016/j.micpath.2018.10.033

Ojeda‐Chi, M.M., Rodriguez‐Vivas, R.I, Esteve‐Gasent, M.D, Pérez de León, A.A.., Modarelli, J.J., Villegas‐Perez, S.L. Ticks infesting dogs in rural communities of Yucatan, Mexico and molecular diagnosis of rickettsial infection. Transbound Emerg Dis 2019 66 (1): 102-110 https://doi.org/10.1111/tbed.12990

Penzhorn, B.L. Don’t let sleeping dogs lie: unravelling the identity and taxonomy of Babesia canis, Babesia rossi and Babesia vogeli. Parasit. Vectors 2020 13 (1): 1-9 https://doi.org/10.1186/s13071-020-04062-w

Rautenbach, Y., Schoeman, J., Goddard, A. Prevalence of canine Babesia and Ehrlichia co-infection and the predictive value of haematology. Onderstepoort J. Vet. Res 2018 85(1):1-5 https://hdl.handle.net/10520/EJC-1235a7d44e

Sarma, K., Nachum-Biala, Y., Kumar, M., Baneth, G. Molecular investigation of vector-borne parasitic infections in dogs in Northeast India. Parasit. Vectors 2019 12(1): 1-8 https://doi.org/10.1186/s13071-019-3389-8

Uilenberg, G. Babesia – a historical overview. Vet. Parasitol 2006 138(1-2): 3–10 https://doi.org/10.1016/j.vetpar.2006.01.035

Ullal, T., Birkenheuer, A., Vaden, S. Azotemia and proteinuria in dogs infected with Babesia gibsoni. J Am Anim Hosp Assoc 2018 54(3):156-160 https://doi.org/10.5326/JAAHA-MS-6693

Table 1. Hematological and biochemical analyses in a dog with B. bigemina during treatment with imidocard dipropionate

	Parameters	Reference value	Day 1	Day 20
Hematology	RBC × 10⁶ /μL	4.5-7.1	3.2	6.5
	WBC	7.0-10.0	12.2	8.9
	Hb g/dl	11.3-15.5	9.2	13.2
	Ht (%)	50.2-55.6	48.2	52.2
	PLT ×103 /μL
	Eosinophils %	0-2	12	1
	Eosinophils ×10³ /μL	0-0.8	2.9	0.4
Biochemical	BUN (mg/dl)	25-30	32	30
	Creatinine (mg/dl)	0.6-1.2	1.5	1.3
	Total bilirubin (μmol/l)	0.0-0.3	1.1	0.3

Download PDF

Version 1

posted

You are reading this latest preprint version

An atypical case of Babesia bigemina parasitising a dogfrom a rural area of eastern Mexico

Status:

Version 1

Abstract

Figures

Resumo

Full Text

Declarations

References

table

Status:

Version 1