GOLPH3 promotes cell proliferation and malignancy in Hypopharyngeal squamous cell carcinoma via AKT-mTOR axis activation

doi:10.21203/rs.3.rs-1632758/v2

Download PDF

Article

GOLPH3 promotes cell proliferation and malignancy in Hypopharyngeal squamous cell carcinoma via AKT-mTOR axis activation

https://doi.org/10.21203/rs.3.rs-1632758/v2

This work is licensed under a CC BY 4.0 License

Version 2

posted

You are reading this latest preprint version

Hypopharyngeal squamous cell carcinoma (HSCC) is a type of the head and neck squamous cell carcinoma (HNSCC), and it tends to have malignant transformation and result in poor prognosis effected by oncogene. Studies have shown that Golgi phosphoprotein 3 (GOLPH3) is highly expressed in HNSCC, which can activate AKT-mTOR signaling pathway. However, the functions of GOLPH3 in HSCC was unclear. Based on the analysis of 520 patients from The Cancer Genome Atlas (TCGA) database, we employed GOLPH3 stable knockdown and overexpression of FaDu cell lines to investigated that function and impact of GOLPH3 on HSCC in vitro and vivo. The functions and pathway of genes that positively related to GOLPH3 via enrichment analysis and western blot. Our results showed that GOLPH3 promotes HSCC cells proliferation, migration and subcutaneous tumor in vivo. We confirmed the positive correlation between GOLPH3 and AKT-mTOR signal activation in vitro. Enrichment analysis indicated that GOLPH3 is critical for HSCC development. Taken together, GOLPH3 promotes tumor cells proliferation and malignancy via AKT-mTOR signal activation, and this mechanism may be a key factor for HSCC tumor malignancy. It may provide an important target for clinical treatment of HSCC.

Hypopharyngeal squamous cell carcinoma (HSCC) is one type of the head and neck squamous cell carcinoma (HNSCC) [1, 2]. Most patients were diagnosed at an advanced stage and have a poor prognosis in HSCC [3, 4]. To better find a diagnosis and treatment target of HSCC, further exploration of the cellular and molecular mechanisms of the tumorigenesis and development for HSCC are needed.

Golgi phosphoprotein 3 (GOLPH3) has been demonstrated as an oncogene that has a powerful transforming activity, and is involved in the development and leads to poor prognosis of multiple cancers [5-7]. Recent studies demonstrated that GOLPH3, as a key factor, can activate and enhance the mTOR pathway during tumorigenesis and development of HNSCC [6-8]. However, the correlation between GOLPH3 and HSCC remains unclear.

To gain a deeper understanding of the functions of GOLPH3 in HSCC tumorigenesis, we preliminarily demonstrated that GOLPH3 can promote tumor cell proliferation and metastasis via activating mTOR targets based on the experimental validation, enrichment analysis and correlation analysis. The results indicated that the mechanism mainly involved in AKT/mTOR axis.

GOLPH3 is upregulated in HNSCC tissue and FaDu cells

From The Cancer Genome Atlas (TCGA) database, comparing HNSCC and adjacent normal tissues, the result showed that GOLPH3 was upregulated in tumor sites (Fig. 1a, b). In addition, we found that the prognostic survival time was significantly and negatively correlated with the expression level of GOLPH3 in cancer tissues (R = 0.211, p = 0.008, n = 158) (Fig. 1c). Then, we explore whether the expression level of GOLPH3 is consistent with tumor tissue in vitro and we investigated WSU-HN30 and FaDu cells by qPCR and western blot. As expected, the expression of GOLPH3 was significantly upregulated in FaDu cells in mRNA and protein level (Fig. 1d). Therefore, it suggests that the expression level of GOLPH3 was closely related to HSCC.

GOLPH3 promotes proliferation of HSCC

To explore the effect of up-regulation of GOLPH3 on the development of HSCC, we constructed a FaDu cell line that has stable overexpression and knock-down effect of GOLPH3. This two stable FaDu cell lines have been verified by qPCR and western blot (Fig. 2a, b). The results of CCK8 and cells colony assay indicated that, compared with NC group, overexpression of GOLPH3 could significantly promote the proliferation and colony formation while GOLPH3 knockdown showed opposite effects (Fig. 2c and d - e). Taken together, the results of this part demonstrated that GOLPH3 was a necessary factor for cell proliferation process and development of HSCC.

GOLPH3 promotes migration of HSCC

To further explore the effect of GOLPH3 on migration of HSCC tumor cells, we performed the wound healing and trans-well migration assay. As expected, the results of wound closure (%) and number of cell migration showed that oeGOLPH3 group had a significant promotion on the migration of FaDu cells. Conversely, the two groups of knock-down (shGOLPH3#1 and #2) all displayed that the significant inhibition of migration ability (Fig. 3a and b, 3c and d). Taken together, the GOLPH3 expression level was positively correlated with migration ability of HSCC tumor cells.

GOLPH3 promotes HSCC tumor growth in vivo

To investigate whether the level of GOLPH3 will affect tumorigenesis in vivo, we injected nude mice with three FaDu cell lines: stable knockdown (shGOLPH3#1), overexpression (oeGOLPH3) and control (blank vector mix, CTL) respectively. Tumor was observed continuously for 15 days after injection, and the weight and volume of tumors were measured in this process. Our results showed that the weight and volume of tumors in shGOLPH3#1 group were significantly lower than that in group oeGOLPH3 and CTL (Fig. 4a - c). The results of immunochemistry showed that the expression trend of GOLPH3 was corresponded to tumorigenic experiments (Fig. 4d). Taken together, these results indicated that GOLPH3 significantly promotes tumorigenesis of HSCC in vivo.

GOLPH3 activates the AKT/mTOR axis in HSCC in vitro

Related studies have shown that GOLPH3 can activate mTOR signaling pathway in the process of promoting tumor growth [5, 9-11]. To verify and explore the correlation between GOLPH3 and mTOR signaling pathway in HSCC, we conducted an enrichment analysis online via Metascape system based on the genes positively correlated with GOLPH3 in HNSC (Pearson-CC ≥ 0.6) and the genes were gathered from TCGA database. The results showed that GOLPH3 was significantly associated with HNSCC and mTOR signaling pathway (Fig. 5a). We further investigated the expression trend of proteins AKT1, mTOR in HNSCC, and their correlation with GOLPH3 expression respectively. The results showed that the expression of AKT1 and mTOR was significantly upregulated with the tumor progression grade of HNSCC (Fig. 5b). Besides, correlations between the expression of GOLPH3 and AKT1, mTOR were significant and positive (Fig. 5c). It showed that the expression level of GOLPH3 was positively correlated with the expression and phosphorylation level of AKT and mTOR via western blot (Fig. 5d). Taken together, our results demonstrated that GOLPH3 can activates the AKT/mTOR axis in development of HSCC.

Many studies have found that the proto-oncogene GOLPH3 is highly expressed in different tumors, and its expression level is related to clinical stage and tumor grade [12–14]. At present, it has been confirmed that GOLPH3 activates mTOR signaling and downstream pathways in development of some tumors [5, 15, 16]. Mammalian mTOR is a serine/tyrosine kinase associated with PI3K, and the phosphorylated mTOR (p-mTOR, S2448) and AKT (p-AKT, S473) are characteristic markers in this pathway, which play important roles in cell growth, proliferation and survival [17, 18]. Studies have shown that the AKT-mTOR axis is the most frequently altered oncogenic pathway in HNSCC tumorigenesis[19, 20]. However, this mechanism of GOLPH3/AKT-mTOR has not been elucidated in HSCC.

The high expression level of GOLPH3 was closely related to tumor cells proliferation and poor prognosis in epithelioid tumor tissues [21, 22]. Analysis of TCGA data showed that the expression level of GOPLH3 was significantly higher than that in normal tissues from 520 HNSCC patients [19] (Fig. 1a). Meanwhile, we verified the differential expression of GOLPH3 based on squamous carcinoma cells in vitro (Fig. 1d). Studies have shown that GOLPH3 is highly expressed in esophageal squamous cell cancer (ESCC) and promotes tumorigenesis and progression [6, 10]. We explored the phenotype and subcutaneous tumorigenesis via the FaDu cells of stable knockdown and overexpressing of GOLPH3. We found that GOLPH3 significantly affected the growth, proliferation and migration of HSCC cells (Fig. 2–4). Therefore, it indicated that GOLPH3 was an important factor in HSCC tumorigenesis and progression.

The phenotype of GOLPH3 capable for activating the mTOR signaling pathway is well confirmed [23, 24], and PI3K-AKT-mTOR pathway activity is enhanced in most HNSCC [20]. However, GOLPH3 can also affect mTOR signaling to promote tumorigenesis and transformation via JAK2-STAT3 and Wnt/β-catenin axis [21, 25]. Therefore, the molecular mechanism of GOLPH3 activates the AKT-mTOR pathway needs further study. In this study, we analyzed the data of HNSCC patients from the TCGA database, and to further confirm the correlation between GOLPH3 and axis in HSCC (Fig. 5a - c). The expression levels of protein verified positive correlation between GOLPH3 and AKT-mTOR pathway in vitro (Fig. 5d). This part demonstrated that GOLPH3-AKT-mTOR axis was one of the key mechanisms for tumorigenesis and development of HSCC.

In conclusion, our study confirmed that GOLPH3 was highly expressed in HSCC tumors and promotes tumorigenesis and development. We further revealed the important correlation and mechanism between GOLPH3 and AKT-mTOR pathways in HSCC. However, we need to further explore the physiological and biochemical effects of the GOLPH3 on HSCC tumor cells, which is conducive to a deeper understanding of the function and mechanism. To summarize, this study provides a potential target for the treatment and research of HSCC.

GOLPH3 Expression Analysis

The RNA-seq transcriptome data and related clinical information were obtained from The Cancer Genome Atlas (TCGA) database (http://ualcan.path.uab.edu/cgi-bin/TCGAExResultNew2.pl?genenam=GOLPH3&ctype=HNSC). There are 520 HNSCC samples and 44 adjacent normal samples included in this study. Statistical analyses were performed using R software v4.0.3 (R Foundation for Statistical Computing, Vienna, Austria), p* < 0.05, p** < 0.01, p*** < 0.001.

Cell Culture

WUS-HN30 and FaDu cells were cultured in DMEM (Gibicol) supplied with 10% fetal bovine serum (FBS, Gibicol) and 1% penicillin - streptomycin (100 μg/mL) at 37°C in a humidified incubator with 5% CO₂.

Real-Time qPCR

Total RNA from cells or tissues was extracted using TRIzol reagent (Invitrogen). Quantitative PCR (qPCR) was applied using SYBR Green PCR Master Mix (Takara Bio) on a Quant Studio 3 (Thermo fisher). Relative expression was calculated by normalization to β-actin. The primers for GOLPH3 were designed by online tool Primer Bank (https://pga.mgh.harvard.edu/cgi-bin/primerbank/new_search2.cgi), and the primer sequences (Primer Bank ID: 14140240a1) are as followed:

Forward primer: TGGTAGAAAAGGGTGTACTGACG,

Reverse primer: TGATGAGACGCTGCTTAATGTTG.

Western Blot Assay

25 μg protein per sample extract were separated by 12 % SDS-PAGE. After transferring to a membrane and blocking, the primary antibodies were incubated overnight at 4 ℃. After incubation with the respective secondary antibodies for 1 h at room temperature, the protein bands were visualized using enhanced chemiluminescence reagents (Millipore). Antibodies used in the experiment included rabbit polyclonal antibody GOLPH3 (ab236296, Abcam), mouse monoclonal antibody α-Tubulin (YM3035, Immunoway) and Goat anti-rabbit/Mouse HRP (HA1001, HA1006, HUABIO).

Colony Formation Assay

About 200 cells per well were seeded and incubated for 14 days. The colonies were fixed using 100% methanol for 10 min at room temperature and stained with 0.1% crystal violet for 20 min at room temperature.

Trans-Well Assay

Migration assessed using Trans-well plate. About 5 × 10⁴ cells were resuspended in 250 μL of serum free medium in the upper chamber (8-μm pore size, Corning) while the lower chambers were filled with 750 μL of complete medium. After incubating for 24 h at incubator, the upper chambers were fixed with 100% methanol for 10 min and stained with 0.1% crystal violet at room temperature. The number of transmembrane cells was calculated under a microscope at three random perspectives (Nikon).

Wound Healing Assay

FaDu cells were seeded into the 6-well plate. After incubation for overnight, the cell density reached 100%. Equal wounds were made by 10 μL tips. The images of wound were obtained under a microscope (Nikon) at 100 × magnification.

Cell Counting Kit-8 (CCK-8) Assay

500 cells per well were seeded into 96-well plates. The viability of cells was determined using a CCK-8 assay (Bimake) everyday by measuring the absorbance at 450 nm (BioTek). The absorbance was normalized to the baseline.

Immunohistochemistry (IHC)

Tissue sample was fixed in 4% neutral formaldehyde solution for 48 hours, then embedded in paraffin, section, dewaxing, and antigen retrieval, and the rest of steps were completed according to the immunohistochemical protocol [26]. The images were collected by light microscope (200 ×, Nikon). Antibodies used in the experiment included rabbit polyclonal antibody GOLPH3 (ab236296, Abcam), Donkey anti rabbit HRP (bs-0295D, BIOSS).

Statistical Analysis

Statistical analysis was performed using SPSS version 16.0 (SPSS Inc., Chicago, IL, USA). The results of data are displayed as the mean ± SD. Student’s t - test was applied to determine the difference in data. All experiments were repeated at least three times. *p < 0.05, **p < 0.01, ***p < 0.001.

Enrichment Analysis and Correlation analysis

The genes that positively correlated with GOLPH3 in HNSC were gathered from UALCAN database (http://ualcan.path.uab.edu/cgi-bin/TCGAExCorrel.pl?genenam=GOLPH3&cancer=HNSC). Enrichment analysis was performed by Metascape online (https://metascape.org/gp/index.html#/reportfinal/t3o8aos2t). p < 0.01 and an enrichment factor > 1.5 indicate statistical significance of the results. Correlation analysis was performed by GEPIA2 online (http://gepia2.cancer-pku.cn/#correlation).

Acknowledgements

This work was approved and supported by the De Yang city 2015 applied technology research and development fund project plan (Grant numbers: 2015SZ0028).

Author contributions

Study concept and design: JM.L, T.Z and M.Z; Acquisition of data: JM.L, T.Z; Analysis and interpretation of data: JM.L, T.Z, YK. W; Statistical analysis: YK.W, SW.G; Drafting of the manuscript: JM.L, T.Z, M.Z; Critical revision and final approval of the manuscript: M.Z. All authors contributed to the article and approved the submitted version.

Conflict of interests

The authors declare that they have no competing interests.

Ethics Statement

The studies involving animal experiments were reviewed and approved by the Animal Care and Use Committee of People's Hospital of Deyang city (Sichuan, China). All animal experiments were carried out in accordance with ARRIVE guidelines (https://arriveguidelines.org).

Johnson DE, Burtness B, Leemans CR, Lui VWY, Bauman JE, Grandis JR: Head and neck squamous cell carcinoma. Nat Rev Dis Primers 2020, 6:92.
Newman JR, Connolly TM, Illing EA, Kilgore ML, Locher JL, Carroll WR: Survival trends in hypopharyngeal cancer: a population-based review. Laryngoscope 2015, 125:624–629.
Kwon DI, Miles BA, Education Committee of the American H, Neck S: Hypopharyngeal carcinoma: Do you know your guidelines? Head Neck 2019, 41:569–576.
Bova R, Goh R, Poulson M, Coman WB: Total pharyngolaryngectomy for squamous cell carcinoma of the hypopharynx: a review. Laryngoscope 2005, 115:864–869.
Scott KL, Kabbarah O, Liang MC, Ivanova E, Anagnostou V, Wu J, Dhakal S, Wu M, Chen S, Feinberg T, et al: GOLPH3 modulates mTOR signalling and rapamycin sensitivity in cancer. Nature 2009, 459:1085–1090.
Wang JH, Yuan LJ, Liang RX, Liu ZG, Li BH, Wen ZS, Huang ST, Zheng M: GOLPH3 promotes cell proliferation and tumorigenicity in esophageal squamous cell carcinoma via mTOR and Wnt/betacatenin signal activation. Mol Med Rep 2017, 16:7138–7144.
Chen S, Li H, Li X, Chen W, Zhang X, Yang Z, Chen Z, Chen J, Zhang Y, Shi D, Song M: High SOX8 expression promotes tumor growth and predicts poor prognosis through GOLPH3 signaling in tongue squamous cell carcinoma. Cancer Med 2020, 9:4274–4289.
Cui GH, Li WX, Lin ZY, Zhang WQ, Hu ZH, Wang L: Short interfering RNA directed against the GOLPH3 gene enhances the effect of chemotherapy against oral squamous cell carcinoma by regulating Caspase3, Bcl2 and cytochrome-c expression. Int J Clin Exp Med 2015, 8:13007–13012.
Liu H, Wang X, Feng B, Tang L, Li W, Zheng X, Liu Y, Peng Y, Zheng G, He Q: Golgi phosphoprotein 3 (GOLPH3) promotes hepatocellular carcinoma progression by activating mTOR signaling pathway. BMC Cancer 2018, 18:661.
Wang JH, Chen XT, Wen ZS, Zheng M, Deng JM, Wang MZ, Lin HX, Chen K, Li J, Yun JP, et al: High expression of GOLPH3 in esophageal squamous cell carcinoma correlates with poor prognosis. PLoS One 2012, 7:e45622.
Yu T, An Q, Cao XL, Yang H, Cui J, Li ZJ, Xiao G: GOLPH3 inhibition reverses oxaliplatin resistance of colon cancer cells via suppression of PI3K/AKT/mTOR pathway. Life Sci 2020, 260:118294.
Kuna RS, Field SJ: GOLPH3: a Golgi phosphatidylinositol(4)phosphate effector that directs vesicle trafficking and drives cancer. J Lipid Res 2019, 60:269–275.
Zeng Z, Lin H, Zhao X, Liu G, Wang X, Xu R, Chen K, Li J, Song L: Overexpression of GOLPH3 promotes proliferation and tumorigenicity in breast cancer via suppression of the FOXO1 transcription factor. Clin Cancer Res 2012, 18:4059–4069.
Tokuda E, Itoh T, Hasegawa J, Ijuin T, Takeuchi Y, Irino Y, Fukumoto M, Takenawa T: Phosphatidylinositol 4-phosphate in the Golgi apparatus regulates cell-cell adhesion and invasive cell migration in human breast cancer. Cancer Res 2014, 74:3054–3066.
Sechi S, Frappaolo A, Karimpour-Ghahnavieh A, Piergentili R, Giansanti MG: Oncogenic Roles of GOLPH3 in the Physiopathology of Cancer. Int J Mol Sci 2020, 21.
Hara K, Maruki Y, Long X, Yoshino K, Oshiro N, Hidayat S, Tokunaga C, Avruch J, Yonezawa K: Raptor, a binding partner of target of rapamycin (TOR), mediates TOR action. Cell 2002, 110:177–189.
Sarbassov DD, Guertin DA, Ali SM, Sabatini DM: Phosphorylation and regulation of Akt/PKB by the rictor-mTOR complex. Science 2005, 307:1098–1101.
Hay N: The Akt-mTOR tango and its relevance to cancer. Cancer Cell 2005, 8:179–183.
Cancer Genome Atlas N: Comprehensive genomic characterization of head and neck squamous cell carcinomas. Nature 2015, 517:576–582.
Wang Z, Valera JC, Zhao X, Chen Q, Gutkind JS: mTOR co-targeting strategies for head and neck cancer therapy. Cancer Metastasis Rev 2017, 36:491–502.
Sun J, Yang X, Zhang R, Liu S, Gan X, Xi X, Zhang Z, Feng Y, Sun Y: GOLPH3 induces epithelial-mesenchymal transition via Wnt/beta-catenin signaling pathway in epithelial ovarian cancer. Cancer Med 2017, 6:834–844.
Wang R, Ke ZF, Wang F, Zhang WH, Wang YF, Li SH, Wang LT: GOLPH3 overexpression is closely correlated with poor prognosis in human non-small cell lung cancer and mediates its metastasis through upregulating MMP-2 and MMP-9. Cell Physiol Biochem 2015, 35:969–982.
Rizzo R, Parashuraman S, D'Angelo G, Luini A: GOLPH3 and oncogenesis: What is the molecular link? Tissue Cell 2017, 49:170–174.
Makowski SL, Tran TT, Field SJ: Emerging themes of regulation at the Golgi. Curr Opin Cell Biol 2017, 45:17–23.
Wu S, Fu J, Dong Y, Yi Q, Lu D, Wang W, Qi Y, Yu R, Zhou X: GOLPH3 promotes glioma progression via facilitating JAK2-STAT3 pathway activation. J Neurooncol 2018, 139:269–279.
Hofman FM, Taylor CR: Immunohistochemistry. Curr Protoc Immunol 2013, 103:21 24 21–21 24 26.

No competing interests reported.

Download PDF

Version 2

posted

You are reading this latest preprint version

GOLPH3 promotes cell proliferation and malignancy in Hypopharyngeal squamous cell carcinoma via AKT-mTOR axis activation

Status:

Version 2

Abstract

Figures

Introduction

Results

Discussion

Materials And Methods

Declarations

References

Additional Declarations

Status:

Version 2