DOI: https://doi.org/10.21203/rs.3.rs-1634958/v1
Uropathogenic Escherichia coli (UPEC) strains are the most common cause of urinary tract infection (UTI) in hospitalized and community patients. The aim was to compare the genetic characteristics of E. coli isolated from inpatients (IPs) and outpatients (OPs) with UTI regarding their phylogenies, virulence traits, and resistance trends.
In this cross sectional study, a total of 130 unrelated E. coli isolates were collected from patients with UTI. Extended spectrum beta lactamase (ESBL) production was detected by combination disk method. Detection of UPEC and intestinal pathogenic E. coli (IPEC) virulence genes were performed by polymerase chain reaction. The isolates were analyzed for phylogenetic grouping.
Out of the 130 isolates, 62.3% were from the OPs and 37.7% from the IPs. About 35.8% of the OPs and 49% of the IPs were ESBL positive. Moreover, 56.8% of the OPs and 59.2% of the IPs were positive for the UPEC virulence genes. Notably, 50% of the isolates from each group exhibited IPEC virulence properties. The predominant phylogroup was B2 (43.2% in the OPs and 40.8% in the IPs). No significant differences were found between the IP and OP isolates (P > 0.05).
The marked genetic plasticity of E. coli has allowed the emergence of strains showing arrays of genes from different pathotypes. Our results may indicate that consideration should also be given to hygienic standard in the community. Characterization of local E. coli isolates in different areas can guide the selection of effective infection control strategies.
Escherichia coli (E. coli) is an important inhabitant of human intestine; however, some types are able to produce serious infections. E. coli pathogenic strains are divided into two groups: intestinal pathogenic E. coli (IPEC) and extra-intestinal pathogenic E. coli (ExPEC), of which the latter is frequently associated with urinary tract infections (UTIs). Intestinal pathogenic strains include: Shiga toxin-producing E. coli (STEC), enteropathogenic (EPEC), enteroaggregative (EAEC), enterotoxigenic (ETEC), enteroinvasive (EIEC) and diffusely adherent E. coli (DAEC)(1).
E. coli may be classified into several phylogenetic groups (distinct pathogenic lineages or phylogroups) based on the presence of PAI and virulence factor expression. Currently, there are eight phylogroups: A, B1, B2, C, D, E, F, and clade I, which appear to be composed by strains that differ in their ecological niches, antibacterial resistance, propensity to cause disease, and virulence (2, 3). In general, ExPEC strains are derived from groups B2 and D, while most IPEC strains belong to groups A, B1, and E. E. coli strains have an extensive genetic diversity and phylogenetic characterization is of great importance for understanding the populations of E. coli and predicting disease progression (2).
Uropathogenic E. coli (UPEC) strains are the most common cause of UTI in humans, mainly among women, and account for 90% of community-acquired UTIs and up to 50% of nosocomial UTIs. These strains are successful pathogens in the urinary tract, as they possess specific virulence factors that allow them to adhere and damage urinary tract cells. Cytotoxic necrotizing factor type 1 (cnf-1 gene), pyelonephritis-associated pilus (pap gene), hemolysin (hlyA gene), and afimbrial adhesin (afa gene) have found to be instrumental in the pathogenesis of UTIs and located in large genetic elements known as pathogenicity islands (PAIs) that through this they can be transmitted to other bacteria by horizontal transmission (1, 4).
The virulence genes in both intestinal and extraintestinal strains are often located within mobile genetic elements. Furthermore, a marked genome plasticity of E. coli has allowed the emergence of various strains with an unusual virulence gene repertoire (1). Some IPEC strains have the potential to cause UTIs. Alternatively, UTI strains may acquire the IPEC markers becoming a potential cause of diarrhea (5, 6). In hospital settings, many patients are immunocompromised and are exposed to numerous antimicrobial compounds that might promote UTIs caused by various E. coli strains that are not normally considered typical uropathogens(1).
Currently, there is an increasing resistance to the conventional antibiotics among E. coli strains causing UTIs both in the community and in hospitals. Particularly, extended-spectrum beta-lactamase (ESBL)-producing E. coli strains are of great concern because their resistance to antibiotics reduces considerably the treatment options and increases morbidity and mortality, particularly in hospitals and in severely immunocompromised patients (7, 8).
It is assumed that hospitals constitute a threatening environment with a special bacterial flora, which due to the pressure of antibiotics, may be more resistant than the flora in the community. In addition, strains isolated from hospitals may be more virulent than those isolated from the community, partly because resistance plasmids, may also code for virulence factors (9). Moreover, nosocomial E. coli isolates may differ in their virulence characteristics from the community-acquired UTI isolates (10).
Regarding the changing epidemiology of infectious diseases (8), characterization of E. coli isolates from the community and hospitals in different regions can develop guidelines for selecting effective antibiotics and implementation of strategies to prevent and control the spread of antimicrobial- resistant microorganisms. The aim of this study was to describe and compare the characteristics of E. coli isolates collected from inpatients (IPs) and outpatients (OPs) with UTIs regarding their resistance, phylogenies and IPEC or UPEC virulence traits.
In this cross sectional study, a total of 130 epidemiologically unrelated E. coli were isolated from urine specimens of UTI patients who were referred to the hospitals affiliated with the Kurdistan University of Medical Sciences in Sanandaj (the capital of Kurdistan Province), west of Iran. These are important hospitals in Sanandaj and patients are referred to them from all parts of the province. Repetitive extragenic palindromic-polymerase chain reaction (REP-PCR) method was used to determine genotypic differences between isolates (11).
UTI was defined using the European Association of Urology guidelines (12). Identification of E. coli isolates was performed by the tests including lactose fermentation, citrate test, motility, indole production, methyl red, Voges-Proskauer, and lysine decarboxylation (13). The isolates were preserved in Trypticase soy broth (Merck, Germany) amended with 20% glycerol at -70°C.
Antimicrobial susceptibility testing was performed by the disk diffusion method according to the 2020 Clinical and Laboratory Standards Institute (CLSI) standards (14).The following antimicrobial disks (Mast, UK) were used: beta lactam [cefotaxime (CT, 30 µg), ceftazidime (TZ, 30 µg), cefepime (PM, 30 µg), cefoxitin (CX, 30 µg), amoxicillin/clavulanic acid (XL, 20/10 µg), aztreonam (AT, 30 µg), and imipenem (IMI, 10 µg)]; quinolone [nalidixic acid (NA, 30 µg), ciprofloxacin (CI, 5 µg), and norfloxacin (NX, 10 µg)]; aminoglycosides [gentamicin (CN, 10 µg) and amikacin (AK, 30 µg)]; trimethoprim-sulfamethoxazole (TS, 1.25/23.75 µg), tetracycline (TC, 30 µg), and nitrofurantoin (FT, 300 µg).
The isolates resistant to cefotaxime or ceftazidime were examined for ESBL production by combination disk method according to the CLSI guidelines (14). The test was performed using four disks: cefotaxime (30 µg) and ceftazidime (30 µg) disks each alone and in combination with clavulanic acid (10 µg). An increase of ≥ 5 mm in a zone diameter for either cefotaxime or ceftazidime in combination with clavulanic acid versus the zone diameter of the agent when tested alone confirmed the presence of ESBL producing isolates.
Boiling method was used to extract total DNA from the isolates. Briefly, bacteria were pelleted from an overnight culture, suspended in sterile deionized water, and heated at 100°C for 10 min. The suspensions were immediately incubated on ice for 5 min and centrifuged. After quantitative and qualitative evaluation, the supernatants containing the extracted DNA were stored at -20°C until analysis.
The following primers were used to amplify the sequences of pap, hly, cnf-1, and afa genes which are instrumental in the pathogenesis of UTIs and found in PAIs: 5′GACGGCTGTACTGCAGGGTGTGGCG3′, 5′ATATCCTTTCTGCAGGGATGCAATA3′ (for pap, amplicon size: 328 bp);5′AACAAGGATAAGCACTGTTCTGGCT3′, 5′ACCATATAAGCGGTCATTCCCGTCA3′ (for hly, amplicon size: 1177 bp); 5′TGCGGGTGTAAATTCAGTGC3′, 5′TCTCGTTGAGCCTCACTGTT3′ (for cnf, amplicon size: 186bp), and 5′CGGGACCAGTAAGCAGTTTG3′,5′CATCAAAGGAGTAGGTGCGC-3′ (for afa, amplicon size: 200 bp) by polymerase chain reaction (PCR). Primers were either previously developed (15, 16) or selected by Primer3 online tool (https://primer3.ut.ee).
The PCR reactions were carried out in a thermal cycler (Eppendorf, Germany) under the following conditions: Initial denaturation at 94°C for 5 min; then 30 cycles of denaturation at 94°C for 1 min, annealing of 1 min at (65°C for hly and pap, 58°C for cnf and afa), and extension at 72°C for 1 min followed by a final elongation of 5 min at 72°C.
PCR assays were used to detect the following genes associated with four main IPEC pathotypes (EPEC, STEC, ETEC, and EAEC) (6, 17): eaeA (the gene for intimin of EPEC), bfpA (the bundle-forming pilus structural gene of EPEC), estA and/or eltB (heat-stable (ST) and heat-labile (LT) enterotoxin genes of ETEC), stx1 and/or stx2 (type 1 and type 2 Shiga toxins (Stx) of STEC), and CVD432 gene (also called aatA) to detect EAEC strains (6, 18)(Table 1). The minimum requirements for definition of IPEC were: detection of bfpA and eaeA confirmed the presence of typical EPEC, while the detection of only eaeA indicated atypical EPEC (aEPEC), detection of either the stx1 or the stx2 confirmed the presence of STEC (the additional presence of eaeA indicated typical STEC), determination of ETEC was based on the presence of eltB and/or estA, while the presence of CVD confirmed EAEC(17).
Amplification was performed using a thermal cycler (Analytica, Germany). The PCR cycling conditions were: an initial denaturation for 5 min at 95 ºC, followed by 30 cycles of 1 min denaturation at 94ºC, annealing for 1 min at different temperatures, and elongation for 1 min at 72°C. The final extension step was carried out at 72°C for 5 min (Table 1).
[Table 1 is here]
| DEC type | Target gene | Primer sequence (5′ to 3′)a | Fragment size (bp) | Annealing temperature (°C) | Reference |
|---|---|---|---|---|---|
| ETEC | eltB | TCTCTATGTGCATACGGAGC CCATACTGATTGCCGCAAT | 322 | 54 | (17) |
| estA | GCTAAACAAGTARGGTCTTCAAAA CCCGGTACARGCAGGATTACAACA | 147 | 60 | (17) | |
| EPEC | eaeA | CTGAACGGCGATTACGCGAA CCAGACGATACGATCCAG | 917 | 55 | (19) |
| bfpA | TTCTTGGTGCTTGCGTGTCTTTT TTTTGTTTGTTGTATCTTTGTAA | 367 | 50 | (17) | |
| STEC | stx1 | ATAAATCGCCATTCGTTGACTAC AGAACGCCCACTGAGATCATC | 180 | 62 | (19) |
| stx2 | GGCACTGTCTGAAACTGCTCC TCGCCAGTTATCTGACATTCTG | 255 | 62 | (19) | |
| EAEC | pCVD | CTGGCGAAAGACTGTATCAT CAATGTATAGAAATCCGCTGTT | 630 | 56 | (17) |
| a R: G/A | |||||
PCR was carried out in a 20 µL reaction mixture containing 10 µL of 2X PCR Master Mix (0.08 U of Taq polymerase/µL, 0.4 mM of each dNTP, and 3 mM MgCl2: SinaClon, Iran), 0.4 µM of each primer, and 2 µL DNA extract. The products were separated by electrophoresis on a 1.5% agarose gel in 0.5X Tris-Borate EDTA (TBE) buffer. The fragments were then stained with Safe Stain and visualized under UV. A 100 bp ladder (SinaClon) was used as a DNA size marker.
Phylogroups of the isolates were determined according to the method of Clermont et al. and phylogentic groups were assigned according to the previously defined criteria (2).
All assays were repeated three times and controls were used. SPSS Version 16 (IBM SPSS Statistics, USA) was used for data analysis. Descriptive statistics, Pearson Chi-square or Fisher's exact test were used to evaluate the relationship between the variables. A P value of < 0.05 was considered significant.
Out of 130 E. coli isolated from UTI, 81 (62.3%) were from OPs and 49 (37.7%) were isolated from IPs in different wards including pediatric (n = 20), women (n = 14), emergency (n = 7), men (n = 4), and other wards (n = 4).
In both groups, females were more prone to UTI (70 of the 81 OPs (86.4%) and 35 of the 49 IPs (71.4%) were female). The age of patients ranged from 1 to 64 years old in the OP group and from 1 to 93 years old in the IPs.
Some of the most relevant virulence factors expressed in urinary E. coli belongs to the PAI. Thus, we investigated the presence of these virulence determinants in the isolates(20).
The cnf, pap, hly and afa genes were found in 26 (32.1%), 25 (30.9%), 15 (18.5%), and 9 (11.1%) of the 81 OPs, respectively; while 46 isolates (56.8%) were positive for the genes (Table 2). In the 49 IPs, the cnf was found in 13 isolates (26.5%), the pap in 18 isolates (36.7%), the hly in 10 isolates (20.4%), and the afa in 4 isolates (8.2%); 29 isolates (59.2%) were positive for the genes. No obvious differences could be found between the IP and OP isolates regarding the virulence factors. Thirteen urovirulence patterns (combinations of virulence genes) were identified in the IPs and OPs (Table 2), of which the patterns consisted of one gene, were the predominant in both groups (27.2% in the OPs and 36.7% in the IPs). The patterns consisted of two genes were found in 23.5% of the OPs and in 14.3% of the IPs. The prevalence of the patterns with three genes was similar in both groups (approximately 6%).
[Table 2 is here]
| Virulotype | Number of isolates in (%) | ||
|---|---|---|---|
| Outpatients (n = 81) | Inpatients (n = 49) | ||
| One gene | cnf | 10 (12.3) | 6 (12.2) |
| pap | 7 (8.6 ) | 8 (16.3) | |
| hly | 2 (2.5) | 3 (6.1) | |
| afa | 3 (3.7) | 1 (2) | |
| Two genes | pap,cnf | 6 (7.4) | 3(6.1) |
| hly, pap | 5 (6.2) | 2 (4.1) | |
| hly, cnf | 2 (2.5) | 1 (2) | |
| afa,pap | 2(2.5) | 1 (2) | |
| afa,cnf | 3(3.7) | 0 | |
| hly,afa | 1 (1.2) | 0 | |
| Three genes | hly,pap,cnf | 5 (6.2) | 2 (4.1) |
| hly,afa,pap | 0 | 1(2) | |
| Four genes | hly,pap,cnf,afa | 0 | 1(2) |
| Negative | 35 (43.2 ) | 20(40.8) | |
Among the 81 isolates from OPs, about 49.4% (n = 40) carried at least one IPEC virulence gene. Of these 40 isolates, 8 isolates (20%) were classified as STEC because they carried genes coding for Shiga toxins (the stx2 was found in 8 isolates, while stx1 was not found), 6 isolates (15%) were categorized as ETEC due to the presence of elt (the est was not found), and 4 isolates (10%) were EAEC as evidenced by the presence of CVD. Furthermore, 6 isolates (15%) carried eae which codes for intimin, of which only one isolate carried both eae and the bundle-forming pilus gene bfp, thus it was classified as typical EPEC and other 5 isolates were atypical EPEC (aEPEC) because they did not harbor the bfp (this gene was found in 25 isolates).
Notably, no EPEC was found in the IPs (the bfp was found in 19 isolates, while eae was not found). About 51% of the isolates from the IPs (25/49) carried at least one IPEC virulence gene. Of these 25 isolates, 7 isolates (28%) were classified as STEC due to the presence of stx2 in 6 and stx1 in one isolate, 4 isolates (16%) were categorized as ETEC due to the presence of the elt (the estA was not found), and 2 isolates (8%) were EAEC as evidenced by the presence of CVD sequence.
Three IPs were colonized with more than one IPEC pathotype (ETEC + EAEC in 2 isolates and STEC + ETEC in one isolate). In the OP group, four different combinations were found: STEC + ETEC (n = 1), ETEC + EAEC (n = 1), aEPEC + ETEC (n = 2), and aEPEC + EAEC (n = 1). Furthermore, combination of UPEC and IPEC pathotypes was investigated. In the IPs, 4 different combinations were detected: UPEC + STEC (n = 2), UPEC + ETEC (n = 1), UPEC + ETEC + EAEC (n = 1), and UPEC + STEC + ETEC (n = 1). While, in the OPs, 8 combinations were identified: UPEC + STEC (n = 5), UPEC + ETEC (n = 1), UPEC + ETEC + EAEC (n = 1), UPEC + STEC + ETEC (n = 1), and four more combinations: UPEC + EPEC (n = 1), UPEC + aEPEC (n = 2), UPEC + EAEC (n = 1), and UPEC + aEPEC + ETEC (n = 1).
Out of 81 isolates from the OPs, 29 isolates (35.8%) were phenotypically ESBL positive, while in the 49 IPs, 24 isolates (49%) were ESBL positive. In both groups, most susceptibilities were seen to FT, CX and IMI; they were excluded from analysis of difference among groups. The least effective antibiotics in both groups were CI and TS. The overall resistance in the IP group was higher than that in the OP group; however, no significant difference was found between the IPs and OPs except for CX (P < 0.05) (Fig. 1).
[Figure 1 is here]
Furthermore, frequency of the hlyA, cnf1 and pap virulence genes in the antibiotic susceptible or resistant isolates of IPs and OPs was investigated (Fig. 2). these genes are physically linked within PAIs, which through this they can be transmitted between various isolates (20). In the IP group, pap was generally more prevalent in the resistant isolates; whereas, among the OPs the pap was more prevalent in the beta-lactam and quinolone susceptible isolates; and in the isolates resistant to aminoglycosides, TS, and TC.
The hly was generally found to be more prevalent in the beta-lactam and quinolone susceptible isolates of IPs and OPs than in the resistant isolates. Moreover, in both IP and OP groups, the cnf was more prevalent in the susceptible isolates.
[Figure 2 is here]
Out of the 130 isolates, 91 isolates (70%) were assigned to 7 of the 8 groups using the quadruplex PCR method (2). Group B1 was not found.
In the 81 OPs, the predominant phylogroup was B2 (n = 35, 43.2%), followed by E (n = 7, 8.6%), clade 1 (n = 5, 6.2%), and A (n = 4, 4.9%). Groups F and C were each represented by 3 isolates and lineage D was represented by 2 isolates. Twenty-two isolates (27.2%) could not be assigned to a phylogenetic group.
In the 49 isolates from the IPs, the predominant group was B2 (n = 20, 40.8%), followed by clade 1(n = 4, 8.2%), E (n = 3, 6.1%) and D (n = 2, 4.1%). Groups A, F, and C were each represented by one isolate. Seventeen isolates (34.7%) were classified as non-typeable.
Although all of our isolates were ExPEC and were principally distributed in group B2; the detected IPEC strains were E. coli with genetic backgrounds, such as phylogroups A, C, and E(Table 3), which have not been typically associated with ExPEC virulence potential(2).
[Table 3 is here]
| Virulence gene | Status | Number of isolates | |||
| Pylogroup B2 | Non-typeable | Other (A,E,C) | Total | ||
| stx2 | Outpatients (n = 81) | 3 | 2 | 3 | 8 |
| Inpatient (n = 49) | 4 | 1 | 1 | 6 | |
| stx1 | Outpatients (n = 81) | 0 | 0 | 0 | 0 |
| Inpatient (n = 49) | 0 | 1 | 0 | 1 | |
| elt | Outpatients (n = 81) | 0 | 1 | 5 | 6 |
| Inpatient (n = 49) | 0 | 3 | 1 | 4 | |
| cvd | Outpatients (n = 81) | 0 | 1 | 3 | 4 |
| Inpatient (n = 49) | 0 | 1 | 1 | 2 | |
| eae | Outpatients (n = 81) | 0 | 4 | 2 | 6 |
| Inpatient (n = 49) | 0 | 0 | 0 | 0 | |
E. coli has been found as the most common causative agent of UTIs in both community and healthcare settings (21). The extraordinary genetic diversity in E. coli drives the emergence of strains harboring unusual arrangement of virulence genes, including genes from different pathotypes. The significance of such strains to cause infection is not only dependent on their virulence factors, but also on risk factors, such as older age, immunosuppression, frequent use of antimicrobials, and prolonged urinary catheterization in hospitals (21). Here, we characterized 130 E. coli isolates from patients with UTIs during IP or OP therapy in terms of phylogroup, presence of IPEC or UPEC virulence genes, and antimicrobial resistance.
The relatively lower prevalence of E. coli in our IP isolates is attributable to the more pronounced diversity in the causative agents of nosocomial UTIs (8). In line with previous studies (8, 22, 23), there was a predominance of females, among the affected population in both groups. A number of risk factors, including physiological and anatomical changes contribute to the higher UTI prevalence in women (21, 23). The most common phylogroup in our isolates from both IPs and OPs was B2, in agreement with previous studies showing a high prevalence of this group in ExPEC strains (23–25). Isolates of group B1 were not detected in our study in contrast to other studies (3, 22, 24), which may due to the differences in the populations that comprised the study groups. Although it was not our aim, studies have shown that extraintestinal isolates belonging to group B2 are associated with higher virulence and antibiotic resistance compared to other groups such as F or B1. The phylogenetic groups of E. coli have a good correlation with the ESBL production and the virulence potential of isolates (22, 24, 26).
Some studies found that virulence genes are more prevalent among UTI isolates from OPs compared to those obtained from IPs (10). Regarding the virulence markers detected in our isolates, no significant differences could be found between the IP and OP isolates. The cnf was the most common virulence gene in the OPs, while in the IPs, the pap was more prevalent. In several studies, the cnf showed a lower prevalence than the hly and pap (6, 22). The rate of non-virulent isolates was almost similar between the two groups.
Despite the frequent genetic exchange among E. coli strains, there are few studies on the presence of specific virulence traits related to the IPEC pathotypes in UTI-associated strains. In the study of Toval et al., 10.9% of the urine isolates carried IPEC virulence genes, which of them, 89.3% were isolated from IPs(21). In our study, IPEC virulence genes were detected in 49.4% of the OPs and in 51% of the IPs. The eae gene representing EPEC pathotype was not found in the IPs. This adhesin is able to accumulate actin in kidney cells and it may play a certain role in UPEC pathogenesis (6). Additionally, there was a widespread presence of the bfp in our isolates from both groups, suggesting that it may play an important role in the adherence of UPEC to the host. Moreover, we found intermediary strains with characteristics of both IPEC and UPEC. Isolates from the OPs showed relatively more diversity than those from the IPs, regarding the virulence properties of the IPEC. The emergence of novel E. coli variants due to a combination of pathotype-associated traits represents a serious health issue, as was demonstrated by a food-borne outbreak caused by a Shiga toxin-producing EAEC strain (27) or the documentation of an UTI outbreak caused by an EAEC strain(28). The finding that approximately 50% of our isolates from hospitals and the community exhibited virulence properties of IPEC indicates that IPEC virulence markers could be also considered in the risk assessment of UPEC. Regarding the uropathogenic ability of some diarrheagenic genes such as the EAE adhesin or Shiga toxins (6, 29), whether these genes are expressed in vivo and contribute to infection of the human urinary tracts remain to be clarified.
No significant differences could be found between the IP and OP strains regarding virulence factors in the present study and the distribution of virulence factors in both groups was almost similar. It is sometimes assumed that IP isolates may be more virulent than OP isolates, partly because resistance plasmids, selected by antibiotic use, may also code for virulence factors. The similarity in virulence between the IP and OP isolates may indicate that selection of virulent strains takes place as much in the community as in hospitals(30).
Treatment of E. coli infections has been increasingly complicated by the emergence of resistance to the critically important antimicrobials(8). Our isolates showed high resistance rates to some of the first-line empirical therapies (fluoroquinolone and TS) in the community and hospitals. This could be attributed to their inappropriate use in both settings due to their availability and low price (31, 32). Meanwhile, low resistance rates to IMI and FT were observed, indicating these antibiotics as appropriate therapies for UTI in both settings (23, 32, 33). Research suggests that uropathogens isolated from IPs are more resistant to antibiotics than those obtained from OPs (8, 33, 34). A greater proportion of our IP samples showed resistance to antimicrobials than the OP samples and ESBL-producing isolates were more frequently found in the hospital patients, although it was not significant. However, we still found around 36% of ESBL resistance in E. coli isolated from the OPs, which indicate that they are also exposed to high antibiotic selective pressure. In this context, OPs may serve as a source amplifying the spread of resistant E. coli to hospitals. Although carbapenem resistance in our isolates was limited (approximately 10% in each setting), this constitutes a serious threat to health care systems because carbapenems in many cases constitute the last line of therapy and the overuse of these drugs will lead to selection pressure (8, 23). Over the years, we have focused on antibiotic consumption in hospitals as a risk factor for development of antibiotic-resistant bacteria. Special attention should also be paid to consumption of antibiotics in community in order to control the prevalence of antimicrobial resistance.
The emergence of resistance to multiple antibiotics complicates therapy of E. coli -associated UTIs. This difficulty has increased due to the presence of virulence genes in UPEC strains, enhancing the pathogenicity of strains(24). We found associations between virulence and resistance in the isolates from the OPs and the IPs. Carrying virulence genes can confer some benefit on bacteria during the infection processes, which favors the resistant strains (9). The signaling by concentration of antibiotics in an environment plays a predominant role in bacterial responses and evolution in that niche and the most resistant pathogens will be selected. In some cases, there is a positive relationship between the acquisition of resistance and virulence; in other examples, the increased resistance is associated to lower virulence of the microorganisms; and there is also another option, in which there is no significant impact on virulence (35). Future research will reveal whether or not bacteria are becoming more virulent and more resistant in the community or hospitals.
Conclusion
In summary, E. coli isolates from the IPs showed similar virulence and antimicrobial resistance compared to the isolates from OPs. Our results may indicate that consideration should also be given to restrictive antibiotic policy and hygienic standard in the community in order to control the prevalence of antimicrobial resistant and virulent strains. Pathogenic E. coli strains have significant genomic plasticity and many unique genomic traits. In this context, continuous surveillance of virulence and antimicrobial resistance patterns of isolates in different regions is essential. Since resistance and virulence is attributed to local epidemiological factors and uncontrolled use of antimicrobials, further studies involving a large number of cases from different areas are needed.
Statements & Declarations
Funding: This study was supported by a grant [IR.MUK.REC.1398.244] from Faculty of Medicine, Kurdistan University of Medical Sciences, Sanandaj, Iran.
Competing interests: The authors declare that they have no competing interests.
Ethics approval and consent to participate:IR.MUK.REC.1398.244, Research Ethic Committee (REC), Faculty of Medicine, Kurdistan University of Medical Sciences
Availability of data and materials:All data generated or analyzed during this study are included in this article.