2,4-dinitroyoluene (2,4-DNT) exposure induced liver developmental damage and perturbs lipid metabolism and oxygen transport gene expression in zebrafish (Danio rerio)

doi:10.21203/rs.3.rs-1636402/v1

Download PDF

Research Article

2,4-dinitroyoluene (2,4-DNT) exposure induced liver developmental damage and perturbs lipid metabolism and oxygen transport gene expression in zebrafish (Danio rerio)

https://doi.org/10.21203/rs.3.rs-1636402/v1

This work is licensed under a CC BY 4.0 License

Journal Publication

published 26 May, 2023

Read the published version in Environmental Science and Pollution Research →

You are reading this latest preprint version

2,4-dinitrotoluene (2, 4-DNT) is a common environmental pollutant. The toxic effect on mammalian of 2,4-DNT has been well studied, but its toxicity on aquatic organisms is little known. In this study, zebrafish (Danio rerio) were exposed to 0, 2, 4, 8, 12 and 16 mg/L 2,4-DNT to first determine 96 h semi-lethal concentrations (LC₅₀), and then exposed to 0, 2, 4 and 8 mg/L for 5 d, determine liver toxicity of 2,4-DNT. Exposed zebrafish developed hypoxia features, such as floating head and breathing rapidly, and then died. 96h LC₅₀ of 2,4-DNT in zebrafish was 9.36 mg/L. Histological data revealed that 2,4-DNT severely damaged the liver tissues, following with the round nucleus, dense interstitial tissue, dense arranged hepatocyte cords and more inflammatory cells. Additionally, the results of qPCR result indicated that the lower levels of lipid transport and metabolism (apoα2, mtp, ppar-α and acox) were noticed. But, exposed to 2,4-DNT for 5 d significantly upregulated the expression levels of genes involved in respiration (hif1a, tfa and ho1.). These results indicated that 2,4-DNT exposure disturbed lipid transport and metabolism and oxygen supply in zebrafish, which could contribute to severe damage in liver and death.

4-dinitrotoluene

zebrafish

liver

lipid metabolism

oxygen transport

Nitrotoluenes, an important industrial material, is extensively used in the manufacture of munitions, dyes, and other industrial products such as polyurethane foams and pesticides (Walia et al. 2002; Xiong et al. 2019; Xu and Nan 2012). In the course of using, a series of intermediates and by-products, such as trinitrotoluene (TNT), 2,4-dinitrotoluenes (2,4-DNT) and 2,6-DNT, are generated (Xu and Nan 2012). These intermediates and by-products have been detected in river, lake, and other aquatic systems (Nivedita et al. 2018). Among these pollutants, 2,4-DNT is a priority pollutant in Chinese water systems. For example, previous survey indicates that concentrations ranging from 0.072 to 0.451 ug/L have been detected in the Yangtze River upstream (Pang et al. 2011). In addition, Songhua River has been shown to have 2,4-DNT concentrations up to 0.88 µg/L (Changrong et al. 1995).

Numerous studies demonstrated that aquatic environmental exposure to 2,4-DNT may result in bioaccumulation of nitrotoluenes in tissues of aquatic organisms. Nitrotoluenes bioaccumulation can cause virous toxicity symptoms, including developmental toxicity, reproductive toxicity and histological alternations. As a potent hepatocarcinogen in animals, 2,4-DNT exposure has also been shown to perturb the liver development of zebrafish (Danio rerio) larvae (Xiong et al. 2019) and reduce enzyme activity and energy reserves in the liver of adult common carp (Xu and Nan 2012). Moreover, Wintz et al. (2006) indicated that 2,4-DNT exposure significantly affected the expression of lipid metabolism and oxygen transport gene in adult fathead minnow. However, only a few genes have been verified due to limited genomic information in fathead minnow. Therefore, it is necessary to advance the comprehensive understanding of molecular mechanisms of how 2,4-DNT affects lipid metabolism and oxygen transport in fish species.

Zebrafish, as an international model animal, has numerous experimental advantages including small size, ease of husbandry and short reproductive cycle, which render it be cultured for use as an experimental animal in toxicology studies (Capriello et al. 2019; Ni et al. 2019). In previous studies, 2,4-DNT exposure has been shown to perturb the liver development and significantly increase the expression of respiration gene in zebrafish larvae (Xiong et al. 2019). Meanwhile, the whole genomic information on zebrafish has been disclosed. Thus, it is feasible to select zebrafish as the research object of this study.

In this paper, acute 2,4-DNT toxicity LC₅₀ values for adult zebrafish, histological analyses in the liver tissues and expression of lipid metabolism gene (apoa2, fabp, mtp, ppar-γ, ppar-α, acox) and oxygen transport gene (hif1-α, tfa and ho1) performed by real-time quantitative reverse transcription PCR (RT-qPCR) in liver tissues, are reported. The objectives of the present study were: 1) to determine the effect of 2,4-DNT on the liver tissues of adult zebrafish, and 2) to improve our understanding of molecular mechanisms of the lipid metabolism and oxygen transport in response to 2,4-DNT toxicity in the liver of zebrafish.

Chemicals

2,4-DNT was purchased from Sigma-Aldrich (Louis, MO, USA). Acetone, as the solvent of 2,4-DNT, was purchased from Sinopharm chemical reagent Co. Ltd (Shanghai, China). A 200 mg/mL 2,4-DNT stock solution was dissolved in acetone at the beginning of experiment and stored at 4 ℃ until use in the experiments. Stock solution was away from light.

Experiment animal and water quality

Two hundred and sixteen adult female wide-type AB line zebrafish (Danio rerio) used in this study were obtained from China zebrafish resource center, Institute of Hydrobiology, Chinese Academy of Sciences. Prior to the experiment, these adult female zebrafish had been acclimated in several 3-L circular resinous tanks. No dead fish were recorded during the 7-d acclimatization period. During the acclimatization and experimental periods, the photoperiod was artificially controlled at 14L:10D from 08:00 to 22:00. Water temperature, pH, and dissolved oxygen were monitored daily and maintained at 27±1 ℃, .respectively. Experimental fish were fed to satiation with ozone-disinfected frozen red worms twice daily. All of the experimental procedures were approved by the Animal Care and Use Committee of Wuhan polytechnic university (Approval protocol No. WPU-F20150701) and were in accordance with the National Guiding Principles for the Care and Use of Laboratory Animals.

Acute toxicity test

From the acclimatized fish, randomly selected 126 zebrafish were used in this experiment. These zebrafish were exposure to 2,4-DNT at concentrations of 2, 4, 8, 12 and 16 mg/L (n=6). All exposure treatment groups received 0.1mL/L acetone. In addition, a blank control group without 2,4-DNT and acetone, and a solvent control group with 0.1 mL/L of acetone were also prepared (n=6). Three replicates were collected per group. Fish were not fed during the experiment, and time of death and number of deaths were recorded. The fish were observed continuously for 96 h, with dead fish and the excrement being promptly removed. And 2/3 of exposure solution was replaced daily to keep appropriate concentrations.

Selected genes trail

Exposure experiment

An additional exposure experiment was performed in 30 separate square glass aquaria (20 cm×12 cm 12cm) containing 6 adult female zebrafish. In according to results of the toxicity test, fish were exposed to 2,4-DNT at concentrations of 2, 4 and 8 mg/L. Two other groups were used as contrast groups, a control group exposure to clean freshwater and a solvent group exposure to 0.1mL/L acetone. Fish were fed twice daily, with dead fish and the excrement being promptly removed. The entire exposure period lasted for 5 d with 2/3 of the solution in each tank renewed daily.

Sampling

After exposure, surviving fish in per group were anesthetized with MS-222 (200mg/L, buffered with 200 mg/L NaHCO3) and dissected to collect liver tissues for further analysis. One liver of each fish was fixed individually in 4% paraformaldehyde solution for histological analysis. And another liver was quickly frozen with liquid nitrogen and stored at -80 ℃ until further procedures.

Liver histology

The fixed livers were washed with 50% ethanol, dehydrated, and finally embedded in paraffin, serially sectioned (5-6 µm) transversely, and stained with hematoxylin and eosin (H&E). All of these sections were processed by Wuhan ServiceBio Technology Co., Ltd. Sections of liver were examined by light microscopy to observe liver morphology in all groups.

Quantitative real-time PCR assay

Approximately 50 mg of the liver tissue stored at -80 ℃ were used for extraction of total RNA using Trizol reagent (Invitrogen, USA) following manufacturer instructions. The quality of total RNA was checked using its optical density at 260 and 280 nm and samples were quantified by spectrophotometry (Thermo, Waltham, USA). And the integrity of RNA in each sample was checked using 1% agarose gel electrophoresis, which showed clearly visible 28 S, 18 S and 5 S ribosomal RNA bands. When the 28 S:18 S ribosomal RNA ratio ≥ 1.8, a 1 μg sample of total RNA was used for generation of first-strand complementary DNA by reverse transcription using Moloney murine leukemia virus (M-MLV) reverse transcriptase (Takara Bio Inc., Kusatsu, Shiga, Japan) with oligo d(T) primer, as recommended by the manufacturer to obtain a final volume of 20 μL. The reaction was terminated by heating at 70 °C for 10 min and the cDNAs were stored at −20 °C till further use.

Key genes involved in lipid metabolism and hypoxic stress were chosen to determine their expression. Quantitative real-time PCR (qRT-PCR) primers were designed according to zebrafish sequences in the GeneBank database and were listed in Table 1. Real-time PCR was carried out with a fluorescense quantitative PCR instrument (Applied Biosystems, Inc., Foster City, CA, USA) using SYBR Green PCR master mix (Hoffmann-La Roche Ltd., Basel, Switzerland). The reagent comprised 1 μL cDNA, 3.4 μL nuclease-free water, 5 μL SYBR Green PCR master mix, 0.2 µL of ROX reference Dye II and 0.2 μL each primer set. The PCR cycling conditions involved an initial denaturation at 95 °C for 10 min, followed by 40 cycles at 95 °C for 15 s, 60 °C for 30 s and 72 °C for 30 s, and simultaneous detection of fluorescence signals. Reactions were run in triplicate. The gene expression level relative to the internal control (β-actin) was determined by comparative threshold cycle method (2-△△Ct method) with β-actin as reference gene.

Table 1. Primers used in this experiment

Primer Name	Sequence (5′–3′)
ppar-γ-F	CGCAGGCTGAGAAGGAGAAGC
ppar-γ-R	CATGTATCTGCAGTTGATCATC
ppar-α-F	CATCACCAGAGAGTTTCTGAAG
ppar-α-R	GCGGCGTTCACACTTATCGTAC
acox-F	AAGGACATCGAGCGAATGATG
acox-R	ACTATAAAAGAGTGGAGGCCG
apoa2-F	ATGAAGCTGACATTCGCTCTC
apoa2-R	TAGTGCTGGCTCAACTGCAG
fabp-F	ATGGCCTTCAGCGGGACGTGG
fabp-R	TGAGCTTCTTGCCGTCCATAG
mtp-F	ATGAACATTTACGGTCAGAGC
mtf-R	CACCACATTGATAGGATCTCC
hif1-α-F	GTCAGCAAGAGCATGGGCCTC
hif1-α-R	GAAGAACCTTCCACGTCGCAG
ho1-F	GCGGCAGAGAACACTGGCAGT
ho1-R	CTGCACTGCTGGGTGGTCTGC
tfa-F	GAAGGTCCTGCTCATCTCTTTG
tfa-R	CAGATAATTATTTAGTCCACCAG
β-actin-F	CATGGATGAGGAAATCGCTGC
β-actin-R	GTTAGTCACAATACCGTGCTC

Statistics

Data were checked for normality and assumptions of homogeneity of variance using Kolmogorov-Smirnov and Levene tests, respectively. Because normality and homogeneity of variance assumptions were satisfied, data were analysed by one-way analysis of variance (ANOVA). If there was a significant difference between treatment groups and control group, data were analysed by Duncan’s multiple range tests. All statistical analyses were carried out using SPSS 19.0 (IBM, Armonk, NY) with P < 0.05 deemed statistically significant. All figures were created using OriginPro 8.0 (OriginLab, Northampton, USA) and Photoshop CS 7.0 (Adobe, San Jose, CA). Data were shown as mean ± SD.

Acute toxic effects of 2,4-DNT exposure on zebrafish

Among the control and acetone groups, no abnormal behaviors and death of adult zebrafish were observed in the whole experiment. While, visible acute toxicity symptoms were detected in the 2,4-DNT treatment groups like reducing feeding, breathing rapidly, losing of body balance and flatting swimming on the top of water. Mortality did not appear in the first 24 h after exposure 2,4-DNT, and mainly occurred 48-72 h. The 72 h mortality of adult zebrafish exposed to 8, 12, and 16 mg/L of 2,4-DNT were 16.67 ± 0.00 %, 22.22 ± 9.62 %, and 61.11 ± 9.62 %, respectively (Table 2). In addition, the relationship between 96 h mortality and 2,4-DNT concentration fitted using a linear regression, which could be described by the following equation, y (%) =6.961x-15.142 (mg/L), R²=0.987. The 96 h LC₅₀ value for exposure to 2,4-DNT was 9.36 mg/L with a 95 % confidence interval (CI) of 8.09~10.27 mg/L based on the linear regression analysis.

Table 2. Cumulative percentage mortality and median lethal concentration (LC50) of zebrafish exposed to 2,4-DNT after 96 h (mean ± SD, n=6)

Concentration (mg/L)	Cumulative mortality (%)
Concentration (mg/L)	24 h	48 h	72 h	96 h
0	0±0.00	0±0.00	0±0.00	0±0.00
Acetone	0±0.00	0±0.00	0±0.00	0±0.00
2	0±0.00	0±0.00	0±0.00	0±0.00
4	0±0.00	0±0.00	0±0.00	16.67±0.00
8	0±0.00	0±0.00	16.67±0.00	33.33±0.00
12	0±0.00	0±0.00	22.22±9.62	72.22±9.62
16	0±0.00	22.22±9.62	61.11±9.62	100.00±0.00
LC₅₀	9.36 (8.09~10.27 mg/L)

Histologic observation of liver in 2,4-DNT treated zebrafish

2,4-DNT adversely affected the liver development of adult zebrafish (Fig.1). The structure of liver in the control group was normal, which characterized as round nucleus, dense interstitial tissue, dense arranged hepatocyte cords and more inflammatory cells (Fig. 1A). There was no obvious change in the liver structure of adult zebrafish exposed to acetone. In contrast, histological analysis showed that 2 mg/L 2,4-DNT induced slight hepatocytes changes, including loose interstitial tissue, slight cytoplasmic vacuolization, and pyknotic nucleus. As the concentration of 2,4-DNT increased, more obvious histological changes of liver were observed. Exposed to 8 mg/L 2,4-DNT resulted in more obvious histological changes, including more loose interstitial tissue, more severe cytoplasmic vacuolization, and absence of nucleus (Fig. 1D).

Effect of 2,4-DNT on the expression of genes related to lipid transport and metabolism

To illuminate the effect of 2,4-DNT on the endotrophic lipid consumption in adult zebrafish, we investigated the transcriptional levels of genes involving in lipid transport, such as apolipoprotein α 2 (apoα 2), fatty acid binding protein (fabp) and microsomal triglyceride transfer protein (mtp), and some genes encoding lipid metabolism, including peroxisome proliferator-activated receptor γ (ppar-γ), peroxisome proliferator-activated receptor α (ppar-α) and acyl-CoA oxidase (acox). The mRNA expression levels of lipid transport and metabolism-related genes in the liver of adult zebrafish exposed to 2,4-DNT were depicted in Fig. 2. Compared with the control group, acetone group have little effects on the transcriptional levels of related gene. Meanwhile, the expression of lipid transport gene and lipid metabolism gene except acox in the liver of adult zebrafish exposed to 2 mg/L 2,4-DNT was not significant in comparison to the control levels. But, as 2,4-DNT water exposure concentration added, significant difference in these seven gene appeared. For example, in comparison to the control levels, apoα 2, fabp, ppar-α and acox mRNA levels in a nominal concentration of 4 and 8 mg/L of 2,4-DNT group decreased significantly (p<0.05), and mtp and ppar-γ mRNA levels increased significantly (p<0.01).

Effect of 2,4-DNT on the expression of genes related to respiration

The present clinical manifestation indicated that 2,4-DNT could cause tachypnea in adult zebrafish. Thus, further trial was carried out to effects of 2,4-DNT on the expression of hypoxia inducible factor 1-a (hif1-a), transferrin-a (tfa) and heme oxygenase (ho1) which was involved in respiration. As shown in Fig. 3, acetone had no influence on the expression levels of hif1a, tfa and ho1. But, after 5 days of exposure, the mRNA levels of ho1 were significantly up-regulated upon exposure to 2,4-DNT at all concentrations in comparison with those in the control levels (Fig.3C, p<0.05), and the levels of tfa mRNA were significantly enhanced after 4 and 8 mg/L 2,4-DNT exposure (Fig. 3B, p<0.01), which was similar wo the effect of 8 mg/L 2,4-DNT on hif1a mRNA (Fig. 3A, p<0.05).

2,4-DNT, a representative aromatic compound, is ubiquitous distributed in aquatic environment (Xu and Nan 2012). According to the existing literatures, 2,4-DNT is harmful to aquatic organisms, humans and other animals (Baares-Espaa et al. 2006). For instance, exposure to 2,4-DNT caused decreased body weight, liver lesions, and death in common carps (Cyprinus carpio) (Xu and Nan 2012)and guppy (Poexilia reticulata) (Lei and Jingbo 2004). However, the lipotoxicity induced by 2,4-DNT was not well documented in fish species. In this study, our results confirmed that 2,4-DNTinduced liver damage and lipid accumulation in fish and revealed the underlying mechanism of lipotoxicity induced by 2,4-DNT.

Liver is the main site of substance metabolism and biotransformation of xenobiotics, and is easy to be disrupted by contaminants, resulting in morphological and structural malformation (Gernhöfer et al. 2001; Pei-Zhen et al. 1997). Previous study indicated that organophosphorus, deltamethrin, and phenanthrene caused hepatocyte enlargement, nuclear chromatin pyknosis, nuclear degradation, vacuolization and necrosis in fish species (Cengiz and Unlu 2006; Fanta et al. 2003; Wu et al. 2007). The similar phenomenon was also observed in this study. Xu and Nan (2012) demonstrated that 2,4-DNT significantly down-regulated the activities of hepatic glucokinase (GK) and Na⁺/K⁺-ATPase, and significantly inhibited the activity of glutathione S-transferase (GST), which may directly lead to an imbalance of redox levels in hepatocytes, which in turn leads to oxidative stress. This indicates that 2,4-DNT may affect the normal biotransformation of hepatocytes and eventually lead to liver damage.

Data reported that lipid metabolism disorder could be used as a common toxicity characteristic of different nitrotoluene compounds to rat (Deng et al. 2011). 2,4 -DNT, as a highly toxic substance in nitrotoluene compounds, had been proved to affect energy metabolism in organisms by interfering with the PPARα signaling pathway, leading to glycolysis or gluconeogenesis and lipid metabolism disorder (Wilbanks et al. 2014). In the present study, the mRNA expression level of lipid transport genes, such as apoa2, fabp and mtp, and the mRNA expression level of lipid metabolism genes, such as ppar-α and acox, were significantly upregulated and significantly downregulated, respectively, in the liver of zebrafish after 2,4-DNT exposed for 5 d. The similar toxicity was also found in fathead minnow (Pimephales promelas) (Wintz et al. 2006). These results indicated that 2,4-DNT perturbed liver lipid metabolism in zebrafish by causing lipid transport disorder. Gao et al. (2015) found that the deficiency or inhibited expression of ppar-α can cause a series of protein and enzyme gene transcription levels related to liver lipid metabolism decreased. Thus, the depression of ppar-α mRNA may be responsible for the disordered lipid transport and metabolism observed in the liver of 2,4-DNT-treated zebrafish.

In addition, exposed to 2,4-DNT in organisms also could cause lipid peroxidation on the surface of erythrocyte membranes and lead to hemolysis (Wu 2000), which would impede oxygen transport and then, cause functional hypoxia. Similar to the study of Brocarded carp (Shen et al. 2010), floating head in zebrafish was also observed in this study. Floating head in fish species could be induced by oxygen deficit which was regulated by several genes (hif1-α, tfa and ho1) related to hypoxia regulation (Lee et al. 1997; Rolfs et al. 1997). Notably, the following three genes hif 1-α, tfa, and ho1 have been reported to be associated with oxygen transport. A previous study suggested that hif 1-α was a kind of ubiquitous transcription factor, which regulated the transcription of a large number of hypoxia-responsive genes and triggered physiological response to hypoxia in tissues (Wenger 2002). hif 1-α gene was significantly upregulated when exposed to 2,4-DNT, which indicated that 2,4-DNT may result in hypoxia in zebrafish. TFa, a major iron-containing protein in plasma, was also reported to be induced by hypoxia in mammals (Oppenheimer 2001; Wang et al. 2010). In accordance with the expression of hif 1-α mRNA, tfa was also significantly upregulated in our study, which showed that 2,4-DNT was a hypoxia-inducible factor and leaded to hypoxia. Meanwhile, a significant increase in the expression level of ho1 mRNA was observed in the liver of zebrafish exposed to 2,4-DNT. ho1, a key enzyme in the degradation of heme, played an important role in protecting tissues or cells from oxidative stress (Wang et al. 2008; Yan-Li et al. 2017). 2,4-DNT was reported to cause oxidative damage in tissues or cells, and severely impaired the oxygen-carrying capabilities of hemoglobin (Beauchamp et al. 1982). Therefore, exposed to 2,4-DNT in zebrafish caused functional hypoxia, which was induced by reduction of the ability of blood to transport oxygen. And upregulation of hif1-α, tfa and ho1 mRNA also resulted in functional hypoxia.

The present results showed that the 96 h LC₅₀ of 2,4-DNT to adult zebrafish was 9.36 mg/L. Meanwhile, exposed to 2,4-DNT for 5 d resulted in the morphological and structural malformation of liver in zebrafish with the following characteristic: organophosphorus, deltamethrin, and phenanthrene caused hepatocyte enlargement, nuclear chromatin pyknosis, nuclear degradation, vacuolization and necrosis. Additional results found that 2,4-DNT interfered with the expression of lipid transport and metabolism-related genes, and significantly upregulated the expression of some oxygen respiration regulation gene in the liver of zebrafish. These results suggest that 2,4-DNT may cause toxicity in fish by affecting lipid metabolism and oxygen supply.

Author contribution Data analysis, wrinting, reviewing and editing were performed by Liangxia Su; methodology, data collect and reviewing were performed by Hang Sha; reviewing and supervision were performed by Jun Liu and Rui Wang; methodology and data collect were performed by Le Yu and Huanhuan Li.

Funding This work was supported by the National Natural Science Foundation of China (Grant No. 31201983) and Fujian Key Laboratory of Special Aquatic Formula Feed (No. TMKJZ2102).

Ethical approval This research project has been approved by the Animal Care and Use Committee of Wuhan polytechnic university (Approval protocol No. WPU-F20150701) and were in accordance with the National Guiding Principles for the Care and Use of Laboratory Animals.

Consent to participate Written informed consent for publication was obtained from all the authors.

Consent for publication The author confirms that the article described has not been published before; not considering publishing elsewhere.

Conflicts of Interest Authors declare no conflict of interest.

Baares-Espaa E, García-Villada L, López-Rodas V, Costas E, Flores-Moya A (2006) Effect of 2,4,6-trinitrotoluene and 2,4-dinitrotoluene on the growth rate and photosynthetic capacity of the Cyanobacterium Microcystis aeruginosa (Kützing) Lemmermann. Bull Environ Contam Toxicol 76(4):601
Beauchamp OR, Irons RD, Rickert DE, Couch DB, Hamm TE (1982) A critical review of the literature on nitrobenzene toxicity. Crit Rev Toxicol 11(1):33–84
Capriello T, Grimaldi MC, Cofone R, Aniello SD, Ferrandino I (2019) Effects of aluminium and cadmium on hatching and swimming ability in developing zebrafish. Chemosphere 222(1):243–249
Cengiz EI, Unlu E (2006) Sublethal effects of commercial deltamethrin on the structure of the gill, liver and gut tissues of mosquitofish, Gambusia affinis: A microscopic study. Environ Toxicol Pharmacol 21(3):246–253
Changrong YU, Ying HE, Liang D (1995) Study of Pollutants in the Muscle of Fishes in Songhua River. Res Environmentalences 8(3):25–31
Deng Y, Meyer SA, Xin G, Escalon BL, Ai J, Wilbanks MS, Welti R, Garcia-Reyero N, Perkins EJ (2011) Analysis of Common and Specific Mechanisms of Liver Function Affected by Nitrotoluene Compounds. PLoS ONE 6(2):14662
Fanta E, Rios FS, Romo S, Vianna A, Freiberger S (2003) Histopathology of the fish Corydoras paleatus contaminated with sublethal levels of organophosphorus in water and food. Ecotoxicol Environ Saf 54(2):119–130
Gao Q, Jia YZ, Tao FU, Zheng YS, Zhang XH, Yang GS (2015) Activation of PPARα pathway is resistant to obesity and fatty liver induced by high fat diet and leptin deficiency. Chin J Biochem Mol Biology 31(8):815–826
Gernhöfer M, Pawert M, Schramm M, Müller E, Triebskorn R (2001) Ultrastructural biomarkers as tools to characterize the health status of fish in contaminated streams. J Aquat Ecosyst Stress Recovery 8(3):241–260
Lang PZ, Wang Y, Chen DB, Wang N, Zhao XM, Ding YZ (1997) Bioconcentration, elimination and metabolism of 2,4-dinitrotoluene in carps (Cyprinus Carpio L.). Chemosphere 35(8):1810–1815
Lee PJ, Jiang BH, Chin BY, Iyer NV, Alam J, Semenza GL, Choi A (1997) Hypoxia-inducible factor-1 mediates transcriptional activation of the heme oxygenase-1 gene in response to hypoxia. J Biol Chem 272(9):5375
Lei Z, Jingbo X (2004) The toxicity of nitrotoluenes to guppy. Ecol Environ 13(1):31–33
Ni H, Peng L, Gao X, Ji H, Ma J, Li Y, Jiang S (2019) Effects of maduramicin on adult zebrafish (Danio rerio): Acute toxicity, tissue damage and oxidative stress. Ecotoxicol Environ Saf 168:249–259
Nivedita S, Vatsana G, Singh RA, Kumar GV, Sarita S, Kumar R (2018) 2, 4-dinitrotoluene (DNT) and 2, 4, 6-trinitrotoluene (TNT) removal kinetics and degradation mechanism using zero valent iron-silica nanocomposite. J Environ Chem Eng 6(4):5196–5203
Oppenheimer SJ (2001) Iron and its relation to immunity and infectious disease. J Nutr 131:616–633
Pang Z, Feng L, Zhou JL, Liu ZT (2011) Ecological risk assessment of substituted aromatic hydrocarbons in water of Yangtze river estuary. Environ Chem 30(2):430–434
Rolfs A, Kvietikova I, Gassmann M, Wenger RH (1997) Oxygen-regulated Transferrin Expression Is Mediated by Hypoxia-inducible Factor-1. J Biol Chem 272(32):20055–20062
Shen HY, Yang L, Zhang GX, Yang JL (2010) Study on antioxidant enzyme of brocarded carp as biomarkers of 2,4-DNT pollution in water. Adv Mater Res 113–116:2171–2176
Walia SK, Ali-Sadat S, Brar R, Chaudhry GR (2002) Identification and mutagenicity of dinitrotoluene metabolites produced by strain Pseudomonas putida OU83. Pesticide Biochem Physiol 73(3):131–139
Wang D, Zhong XP, Qiao ZX, Gui JF (2008) Inductive transcription and protective role of fish heme oxygenase-1 under hypoxic stress. J Exp Biol 211(16):2700–2706
Wang N, Chen Q, Hu CY (2010) Cloning and tissue-specific expression of transferriong gene in grass carp. Acta Hydrobiol Sin 34(1):51–56
Wenger RH (2002) Cellular adaptation to hypoxia: O₂-sensing protein hydroxylases, hypoxia-inducible transcription factors, and O₂-regulated gene expression. FASEB J 16:1151–1162
Wilbanks MS, Gust KA, Sahar A, Imran S, David J, Yaw AC, Meyer SA, Perkins EJ (2014) Validation of a Genomics-Based Hypothetical Adverse Outcome Pathway: 2,4-Dinitrotoluene Perturbs PPAR Signaling Thus Impairing Energy Metabolism and Exercise Endurance. Toxicol Sci 141(1):44–58
Wintz H, Yoo LJ, Loguinov A, Wu YY, Steevens JA, Holland RD, Beger RD, Perkins EJ, Hughes O, Vulpe CD (2006) Gene expression profiles in fathead minnow exposed to 2,4-DNT: Correlation With Toxicity in Mammals. Toxicol Sci 94(1):71–82
Wu H (2000) Effects of dinitrotoluene (DNT) on the immune function of red cell in rats. Industrial health and occupational diseases 26(2):88–89
Wu LL, Chen L, Zhang YL, Li JH, Zhao JF (2007) Effects of phenanthrene toxicity on histopathology of Brachydanio rerio gill and liver. Chin J Ecol 26(5):688–692
Xiong J, Sha H, Zhou H, Peng L, Wu L, Qiu Y, Wang R, Hu X (2019) 2,4-dinitrotoluene (DNT) perturbs yolk absorption, liver development and lipid metabolism/oxygen transport gene expression in zebrafish embryos and larvae. Int J Mol Sci 20(15):3632
Xu J, Nan J (2012) Effects of 2,4-dinitrotoluene exposure on enzyme activity, energy reserves and condition factors in common carp (Cyprinus carpio). J Hazard Mater 203:299–307
Li YL, Xu GY, Xiao JW, Li Z, Zhao HB, Zhou QC, Gui JF, Zhong XP (2017) Studies on the protective role of zebrafish ho1 in response to hypoxia. Acta Hydrobiol Sin 41(1):43–49

Download PDF

Journal Publication

published 26 May, 2023

Read the published version in Environmental Science and Pollution Research →

Reviewers agreed at journal
03 Jul, 2022
Reviewers invited by journal
28 Jun, 2022
Editor invited by journal
03 Jun, 2022
Editor assigned by journal
01 Jun, 2022
First submitted to journal
27 May, 2022

You are reading this latest preprint version

2,4-dinitroyoluene (2,4-DNT) exposure induced liver developmental damage and perturbs lipid metabolism and oxygen transport gene expression in zebrafish (Danio rerio)

Status:

Journal Publication

Version 1

Abstract

Figures

Introduction

Materials And Methods

Results

Discussion

Conclusions

Declarations

References

Status:

Journal Publication

Version 1