TMSG1/LASS2 inhibits cell proliferation, invasive ability through a novel transcriptional regulation way mediated by Homeodomain Running title: a novel transcription regulation role of TMSG1

doi:10.21203/rs.3.rs-1637536/v1

Download PDF

Research Article

TMSG1/LASS2 inhibits cell proliferation, invasive ability through a novel transcriptional regulation way mediated by Homeodomain Running title: a novel transcription regulation role of TMSG1

https://doi.org/10.21203/rs.3.rs-1637536/v1

This work is licensed under a CC BY 4.0 License

Version 1

posted

You are reading this latest preprint version

Background: TMSG1/LASS2 is emerging as an effective tumor suppressor as a transmembrane protein since it has been first cloned. We for the first time found by accident in our previous study TMSG1/LASS2 could be located in the nucleus, and it contained Homeodomain and nuclear localization signal (NLS). We aimed to investigate whether TMSG1/LASS2 possessed the function of transcription factor and identify the target genes regulated by the transcriptional regulation function of TMSG1/LASS2.

Methods: We constructed and transfected three variants containing different functional domains of TMSG1/LASS2 to human prostate cancer cell PC-3M-1E8.

Immunofluorescence was performed to detect the cellular localization of the three variants and identified its functional domain mediating it entering the nucleus. Chromatin immunoprecipitation (ChIP) associated with high-throughput sequencing was performed to select the target genes binding to TMSG1/LASS2 protein. Then we investigated the transcriptional regulation effect of TMSG1/LASS2 on one of the target genes Neural Proliferation, Differentiation and Control 1 (NPDC1) by dual-luciferase reporter system, and examined the expression of NPDC1 upon the overexpression or knockdown of TMSG1/LASS2, as well as the cell proliferation ability, apoptosis and cell cycle.

Results: Immunofluorescence result revealed the variants deleted Homeodomain or NLS could not enter the nucleus. Neural Proliferation, Differentiation and Control 1 (NPDC1) gene, whose promoter fragment was obtained from ChIP using TMSG1/LASS2 antibody for further study. Dual-Luciferase reporter system revealed TMSG1/LASS2, as well as the variant with the deletion of NLS could enhance the transcription of NPDC1 promoter rather than the variant deleted Homeodomain. RT-qPCR and Western blot results demonstrated the gene and protein levels of NPDC1 were significantly increased upon TMSG1/LASS2 overexpression other than the variants without Homeodomain or NLS. Moreover, the level of NPDC1 were markedly decreased upon TMSG/LASS2 knockdown. Furthermore, the full length TMSG1/LASS2 was more able to inhibit cell proliferation, invasive ability and promote the cell apoptosis than the variants without Homeodomain or NLS.

Conclusions: TMSG1/LASS2 could enter the nucleus to play transcription factor role mediated by its Homeodomain and NLS. TMSG1/LASS2 could promote the transcription and subsequent expression of NPDC1, one of its target genes. TMSG-1/LASS2 might inhibit cell proliferation, invasive ability, promote cell apoptosis and G0/G1 cell cycle arrest partially mediated by its Homeodomain and NLS. We for the first time propose a new transcriptional regulation function of TMSG1/LASS2 in addition to the known tumor suppressor function as a transmembrane protein.

TMSG1/LASS2

transcriptional regulation

Homeodomain

NLS

NPDC1

Tumor metastasis suppressor gene 1 (TMSG1/LASS2) is a tumor metastasis suppressor gene which was first cloned from non-metastatic and metastatic human prostate cancer cell variants using mRNA differential display [1]. TMSG1/LASS2 gene is located on chromosome 1q21.2 and encodes a transmembrane protein of 380 amino acids. Emerging evidence has documented the function of TMSG1/LASS2 in the suppression of cancer development and metastasis, such as human prostate cancer cell PC-3M, pulmonary giant cell carcinoma cell PG, breast cancer cell MDA-MB-231, and hepatocellular carcinoma [2, 3, 4]. Furthermore, expression of TMSG1/ LASS2 was found to be negatively associated with the clinical stage, depth of tumor invasion and recurrence of bladder cancer [5, 6].

TMSG1/LASS2 is emerging as an effective tumor suppressor since it has been first cloned, and original studies have invariably focused on its tumor suppressor function as a transmembrane protein through interacting with other proteins, such as vacuolar ATPase [2]. TMSG1/LASS2 protein is mainly located in the endoplasmic reticulum and has a ubiquitous tissue distribution [7]. However, we found by accident in our previous study that TMSG1/LASS2 could be located in the nucleus revealed by immunohistochemistry and immunofluorescence. With this unexpected discovery, we analyzed the protein structure of TMSG1/LASS2 and found it consisted of two conserved functional domains: Homeodomain (67-128aa) and TRAM-LAG1-CLNS (TLC) domain (131-332aa). Homeodomain is a particular DNA binding domain encoded by the homeobox gene. A majority of proteins with Homeodomain are considered to be transcription factors contributing to the cellular growth, differentiation and embryonic development [8, 9]. Notably, emerging studies have manifested the relationship between Homeodomain and tumor, such as CDX2, which was found to have significant tumor inhibitory function as a transcription factor [10]. Furthermore, we analyzed the amino acids sequence of TMSG1/LASS2 by PSORTⅡ software. Interestingly, a nuclear localization signal (NLS) was identified in the Homeodomain. It was known NLS was a series of special oligopeptides playing pivotal role in the transport of transcription factor into the nucleus. Based on our previous results and the above analysis of protein structure and amino acids sequence, we speculate that TMSG1/LASS2 might be a newly recognized transcription factor since it contains the DNA binding domain and NLS.

To investigate whether TMSG1/LASS2 possesses the function of transcription factor and identify the target genes regulated by the transcriptional function of TMSG1/LASS2, we first identified its cellular localization and examined its functional domain mediating it entering the nucleus. Chromatin immunoprecipitation (ChIP) associated with high-throughput sequencing was performed to select the target genes binding to TMSG1/LASS2 protein. Then we investigated the transcriptional regulation effect of TMSG1/LASS2 on one of the target genes Neural Proliferation, Differentiation and Control 1 (NPDC1) by dual-luciferase reporter system, and examined the expression of NPDC1 upon the overexpression or knockdown of TMSG1/LASS2, as well as the cell proliferation ability, apoptosis and cell cycle. We aimed to give a new insight into the function of TMSG1/LASS2 as a newly-recognized transcription factor which had not been reported up till now.

Cell culture

PC-3M-2B4 (low-metastatic cell variant from human prostate cancer cell PC-3M) cells line, and PC-3M-1E8 (high-metastatic cell variant from human prostate cancer cell PC-3M) [11] cells lines were maintained in Dulbecco's Modified Eagle Medium (DMEM, Thermo Fisher Scientific, Invitrogen, Carlsbad, CA, USA) supplemented with 10% fetal bovine serum (FBS, Invitrogen), 100 U/ml penicillin (Invitrogen) and 100 µg/ml streptomycin (Invitrogen,) in a humidified tissue-culturing environment at 37°C with 5% CO₂. HEK293T cell were cultured in DMEM medium supplemented with 10% fetal calf serum.

Construction Of Vectors And Gene Transfection

The full-length coding region of human TMSG1/LASS2 gene (T1, 380aa), the variant of TMSG1/LASS2 containing TLC domain without homeodomain (T2) (129–380aa of the human TMSG1/LASS2 cDNA), and the variant of TMSG1/LASS2 with the deletion of 119-128aa in Homeodomain (T3) were amplified from PC-3M-2B4 cDNA library using different specific primers, respectively (Table 1). For the construction of the variant T3, 2 pairs of primers were used to delete the 30 bases encoding the 119-128aa in Homeodomain (Table 1). The PCR products were cloned into the enzymatic site between EcoR I and Xho I of the eukaryotic expression vector pcDNA3.1 (Invitrogen, Carlsbad, UAS) with FLAG tag in the carboxyl terminus. After correct sequencing, the recombined plasmid was extracted by Pureyield^™ plasmid midprep extraction kit (Promega, Madison, USA). Transient transfection of PC-3M-1E8 cells was performed according to the manufacturer’s instruction for Lipofectamine^™ 3000 and P3000 (Invitrogen, Carlsbad, USA). Real-time RT-PCR (QPCR) and Western blot were applied to identify the expression levels of the recombined proteins after 24 hours of transfection (Primers were shown in Table 1). The primary antibody was anti-FLAG (Sigma, St. Louis, USA). The cells transfected by pcDNA3.1-flag vector served as the control.

Table 1
	Primers
Plasmid construction
T1	Sense 5’-CGCGAATTCGCCGCCACCATGCTCCAGACCTTGTATGATTA-3’ Antisense 5’ -CGCCTCGAGGTCATTCTTACGATGGTTGTTATT-3’
T2	Sense 5’-CGCGAATTCGCCGCCACCATGCTCCTCAAGAAGTTCCGAG-3’ Antisense 5’-CGCCTCGAGGTCATTCTTACGATGGTTGTTATT-3’
T3	1Sense 5’-CGCGAATTCGCCGCCACCATGCTCCAGACCTTGTATGATTA-3’ 1Antisense 5’- TCTTGAGGAGGAACCAACGCTCTACCTGGCG-3’ 2Sense 5’-AGCGTTGGTT CCTCCTCAAGAAGTTCCGAG-3’ 2Antisense 5’ -CGCCTCGAGGTCATTCTTACGATGGTTGTTATT-3’
NPDC1 promoter	Sense 5’- CGCGAATTCCTGGGAACTTTGTGGTGAGTAGG − 3’ Antisense 5’- CGCCTCGAGCACCCGCCTGTCCCTACTCA − 3’
Real-time PCR
T1	Sense 5’-CTGCTGCATATCTTCTGG-3’ Antisense 5’-TTTGTCATCATCGTCCTT-3’
T2	Sense 5’-AAGAAAGTTTGGGAGGGA-3 Antisense 5’-CCAGCAGGTAATCGGAAG-3’
T3	Sense 5’-AAGAAAGTTTGGGAGGGA-3 Antisense 5’-CCAGCAGGTAATCGGAAG-3’
NPDC1	Sense 5’- GTCTGGACACTCAACTCCGC − 3’ Antisense 5’- CACACAGAACGCCAGGATCA − 3’
GAPDH	Sense 5’-GGATTTGGTCGTAT TGGG-3’ Antisense 5’-GGAAGATGGTGATGGGATT-3’

Immunofluorescence To Detect The Cellular Localizations Of Tmsg1/lass2 And The Variants

The cellular localizations of TMSG1/LASS2 and its variants were detected by immunofluorescence under the laser scanning confocal microscope after the transfection into HEK293T cells. After 24 hours of transfection, HEK293T cells cultured on the sections were fixed by cold acetone. After rinsed by PBS, 1% BSA was used to block the sections for 30 mins. The sections were exposed to primary antibody (anti-FLAG, Sigma, St Louis, MO, USA) for 2 hours at 37◦C. After rinsed by PBS, sections were then incubated with the secondary antibody labeled by FITC for 1 h. After washed with methanol for 8 mins, the sections were counterstained with 4, 6-diamidino-2-phenylindole (DAPI) (China Medical Technologies, Beijing). Laser scanning confocal microscope was applied to detect the cellular localization of green fluorescence signals.

Chromatin Immunoprecipatation And High-throughput Sequencing To Screen Candidate Genes Interacting With Tmsg-1 Protein

The total cell lysis of PC-3M-2B4 cells was collected and treated by ultrasound according to the protocol of MILLIPORE EZ-CHIP Kit (Sigma, the United States). 1.5% Agarose gel was applied to assess the effect of ultrasound. ChIP assay was performed using anti-TMSG-1 antibody (Santa cruz, the United States), and rabbit IgG (Santa cruz, the United States) without antibody as the control according to the manufacturer’s instructions. After purified by the absorption column, the purified DNA was amplified using the specific primer combing the promoter region of GAPDH. Then 3% agar gel was used to analyze the sedimentation efficiency of CHIP. This was followed by paired-end sequencing using Illumina HiSeq 2500. Sequences were aligned to the human reference genome (UCSC hg19) through Burrows-Wheeler Aligner (BWA) software. Kyoto Encyclopedia of Genes and Genomes (KEGG) (https://www.genome.jp/kegg/) annotation and Gene Ontology (GO) (http://geneontology.org/) annotation were applied to annotate the function of the target genes.

Dual-Luciferase reporter system to examine the transcriptional regulation effect of TMSG1/LASS2 on one of the target genes NPDC1

Among the candidate genes screened by high-throughput sequencing, we focused on one tumor suppressor gene Neural Proliferation, Differentiation and Control 1 (NPDC1). We first obtained the promoter sequence of NPDC1 through https://www.ncbi.nlm.nih.gov/ and designed the primers of the promoter (Table 1). The PCR products were cloned into the enzymatic site between Nhe I and Xho I of the pGL3 Luciferase Reporter Vectors (Promega, Madison, UAS). After correct sequencing, the pGL3 Luciferase Reporter containing NPDC1 promoter, named pGL3-NPDC1 and pRL-TK vector were transfected into HEK293T cells with pCDNA3 or recombined plasmid pCDNA3-TMSG-1 (T1), T2, T3 using Lipofectamine^™ 3000 and P3000 transfection reagent (Invitrogen, USA). pRL-TK vector was used as the control containing renilla luciferase gene. pGL3 and pRL-TK vectors transfected into HEK293T cells were the basic control. Dual-Luciferase® Reporter Assay System (catalog E1910, Promega, USA) was used to measure firefly luciferase activity using Turner Designs TD-2020 Luminometer (Turner Biosyetems, USA) according to the protocol of the manufacture. After dispense of Stop & Glo® Reagent, renilla luciferase activity was measured. The ratio of firefly luciferase (FLuc) activity/renilla luciferase (RLuc) activity was the relative activity of each group.

Quantitative real-time PCR (RT-qPCR) and western blot to examine the effect of TMSG1/LASS2 overexpression on the expression of NPDC1

The expression of NPDC1 gene was analyzed with or without the overexpression of TMSG-1 and its variants through RT-qPCR using SuperScript™ IV First-Strand Synthesis System (cat. no. 18091050, Thermo Fisher, Scientific, Inc.) and Power SYBR® Green Master Mix (cat. no. 4367659, Thermo Fisher, Scientific, Inc.) after the total RNA extraction from PC-3M-2B4 cells using the Total RNA Extraction Kit (cat. no. DP439; Tiangen Biotech Co., Ltd.). The GAPDH gene was used as the control. The PCR primers for NPDC1 and GAPDH amplification were showed in Table 1. The thermal cycling protocol was: 95℃ for 5min, 1 cycle;95℃ for 1 min, 60℃ for 30s and 72℃ for 30s, 38 cycles; 72℃, 10 min, 1 cycle. PCR was performed on Applied Biosystems 7500 Real-Time PCR Systems (Thermo Fisher, Scientific, Inc.). Fold of enrichment of NPDC1 gene was calculated as 2 (-ΔΔCt).

The protein levels of NPDC1 in PC-3M-2B4 cells with or without the overexpression of TMSG-1 and its variants were detected by Western blot. Cells were harvested and protein was extracted from cells using NP40 Cell Lysis Buffer (catalog FNN0021, Thermo Fisher Scientific) supplemented with 1 mM DTT, 1× protease inhibitor cocktail (catalog p8340, Sigma-Aldrich). The protein concentration was determined using a protein assay kit (Bio-Rad), and samples were separated in 4–15% SDS polyacrylamide gels (Bio-Rad). After probing with a primary antibody in 4°C overnight, the membrane was incubated with a secondary antibody conjugated with HRP. Finally, signal intensity was determined using Pierce™ ECL Western Blotting Substrate (catalog 32109, Thermo Fisher Scientific) and Azure imaging system c600 (Azure Biosystems, Inc.). Endogenous GAPDH was used as the internal control. The following antibodies were applied: anti-NPDC1 (catalog 118918, Abcam, USA), anti-GAPDH (sc-32233, Santa Cruz).

Quantitative real-time PCR (RT-qPCR) and Western blot to examine the effect of TMSG1/LASS2 knockdown on the expression of NPDC1

We designed and purchased four different siRNA targeting TMSG1/LASS2 from Qiagen Company (Dusseldorf, Germany), and selected two siRNA with interfering efficiency of 71% and 87%, separately. The targeting sequence of the two siRNA were as follows: siRNA1: CACAAAGTAGACCCTCTCCGA; siRNA2: TGCGCGGAGCTGTGTCCAATA. Nonspecific control siRNA (AllStar Negative Control siRNA) was also purchased from Qiagen Company. Transfection of siRNA into PC-3M-2B4 cells was done using Lipofectamine RNA iMAX transfection reagent (Thermo Fisher Scientific) following the manufacturer’s protocol. Then RT-qPCR and Western blot were performed to examine the expression level of NPDC1 as described previously.

Mtt Assay To Analyze Cell Proliferation Ability

MTT assay was performed to analyze cell proliferation ability. Different recombined plasmids (T1, T2 or T3) transfected PC-3M-1E8 cells and the control cells were seeded in 96-well-plate at about 1.0×10³cells/well in triplicate. 20 µ l MTT solution (5 mg/ml, Sigma) was added into each well and 150 µ l DMSO was added after 4 h. Then the plate was measured for the absorbance at 570 nm using a microplate reader.

Invasion Assay

An 8-mm thick polycarbonate Millipore membrane was put between the upper and lower rooms of Boyden chamber. The medium of culturing NIH3T3 cells was used as the chemotactic factor in the lower room. 50 ml matrigel (1mg/L, BD) was evenly placed on the Millipore membrane. After complete polymerization of the matrigel, about 2×105 cells were seeded into the upper room of the well. Then different variants stable-transfected PC-3M-1E8 cells and the controls were cultivated at 37°C in 5% CO² for 8 h. The cells that passed through the matrigel and membrane were fixed by methanol and stained by hematoxylin and eosin, and counted under light microscope.

Flow cytometry for the analysis of cell apoptosis

Cell apoptosis was evaluated by Apoptosis Assay kit (Gene Research Center of Peking University, Beijing, China) and flow cytometry. The variants transfected PC-3M-1E8 cells and the control cells were digested by 10% trypsin and washed by cold PBS followed by the filter of 300-mesh-nylon net. Cells were resuspended in 200 µ l binding buffer, and 10 µ l Annexin-V-FITC was added and incubated at 4°C for 30 min. Then cells were stained with 5 µ l propidium iodide (PI) and subjected to flow cytometry (BD FACSCalibur, Franklin Lakes, NJ, USA).

Flow Cytometry For The Analysis Of Cell Cycle

For the analysis of cell cycle progression, PC-3M-1E8 cells were digested by 10% trypsin and washed twice by cold PBS and subsequently fixed by 75% alcohol at 48C for 24 h; 300-mesh-nylon net was applied to filter the cells and then 10 ml RNAse was added and incubated at 37°C for 30 min. Following staining with PI, samples were subjected to flow cytometry (BD FACSCalibur, Franklin Lakes, NJ, USA).

Construction of vectors and gene transfections

To determine whether TMSG1/LASS2 could act as a transcription factor and understand the importance of Homeodomain on the transcriptional function of TMSG1/LASS2, we constructed three recombined proteins including full length TMSG1/LASS2 (T1, 1143bp), the variant containing TLC domain without Homeodomain (T2, 759bp), and the variant deleted NLS sequence (119-128aa) in Homeodomain (T3, 1113bp) (Fig. 1A). T1 and the two variants T2 and T3 mainly migrated to about 45 kDa (T1), 25 kDa (T2) and 40kDa (T3) in 10% SDS-PAGE demonstrated by Western blot using anti-FLAG antibody. Two bands were detected in T1 and T3 transfected PC- 3M-1E8 cells containing a same band at about 22kDa (Fig. 1B).

TMSG1/LASS2 protein with Homeodomain could enter the nucleus rather than its variant without Homeodomain or NLS sequence

Since our previous study accidentally found TMSG1/LASS2 could be located in the nucleus, we first carried out immunofluorescence to precisely identify the cellular localization of TMSG1/LASS2 and its variants under laser scanning confocal microscope after their transfection into HEK293T cells using anti-FLAG antibody. We found TMSG1/LASS2 (T1) protein was partially distributed in the nucleus with some of them scattered in the cytoplasm (Fig. 2). The variant T2 containing TLC domain without Homeodomain was mostly distributed in the cytoplasm (Fig. 2). Notably, the variant T3 deleted the NLS sequences (119-128aa) of TMSG1/LASS2 predominantly appeared in the cytoplasm. These results suggest that TMSG1/LASS2 protein with Homeodomain could enter the nucleus rather than its variant without Homeodomain or NLS sequence (Fig. 2).

Npdc1 Was One Of The Target Genes Interacting With Tmsg-1/lass2 Protein

To detect the genes binding to and associated with TMSG1/LASS2, we performed chromatin immunoprecipatation and high-throughput sequencing. After the chromatin immunoprecipatation, 1978 gene fragments bound to TMSG-1/LASS2 protein were obtained by high-throughput sequencing, including 98 gene fragments in promoter area, 12 in 5’ UTR, 19 in CDS, 6 in 3’ UTR, 300 in intron, 95 in TTR and 1448 in intergenic area, among which 926 were fragments of the gene with known function (Fig. 4A). KEGG and GO enrichments analyzed the function of the 926 genes and concluded that a proportion of genes were involved in colorectal cancer, death of tumor cells, endocytosis, RAN degradation and neuron differentiation (Fig. 3). Among the 926 candidate genes, we chose NPDC1 gene, whose promoter fragment was obtained after CHIP and high-throughput sequencing, for further study.

TMSG1/LASS2 could play the role in promoting transcription of NPDC1 via its Homeodomain

Since the promoter fragment of NPDC1 gene was identified to be one of the candidates bound to TMSG1/LASS2, we first examined the transcriptional regulation effect of TMSG1/LASS2 on NPDC1 promoter through dual-Luciferase reporter system. We found the relative luciferase activity of pGL3-NPDC1 overexpressed HEK293T cells upon the overexpression of TMSG1/LASS2 (T1) and the variant T3 deleted the NLS sequence were significantly increased compared with the overexpression of T2 deleted the Homeodomain (Fig. 4B), demonstrating that TMSG1/LASS2 played the role in promoting transcription of NPDC1 via its Homeodomain.

Npdc1 Expression Was Increased Upon Tmsg1/lass2 Overexpression

Since TMSG1/LASS2 played the role in promoting transcription of NPDC1 showed by dual-Luciferase reporter system, we detected the effect of TMSG1/LASS2 overexpression on the expression of NPDC1 through quantitative real-time PCR (RT-qPCR) and Western blot. We found the gene and protein levels of NPDC1 in PC-3M-2B4 cells were increased upon TMSG1/LASS2 overexpression compared with that in the presence of variant T2 or T3 overexpression and the control (Fig. 4C, D), indicating the Homeodomain and NLS sequence are responsible for TMSG1/LASS2 mediating enhancement of NPDC1 expression, which further implied that TMSG1/LASS2 increased NPDC1 expression through promoting its transcription.

Npdc1 Expression Was Decreased Upon Tmsg1/lass2 Knockdown

To further identify the influence of TMSG1/LASS2 on the expression of NPDC1, we knockdown TMSG1/LASS2 through 2 effective targeting siRNA. We found the gene and protein levels of NPDC1 were markedly decreased upon TMSG/LASS2 knockdown compared with non-targeting control in PC-3M-1E8 cells, further confirming that TMSG1/LASS2 played an important role in regulating the expression of NPDC1 (Fig. 4E, F).

Cell Proliferation Ability Analysis By Mtt Assay

Cell proliferation was evaluated by MTT assay to analyze the effect of the overexpression of different variants on the cell proliferation ability. The cell growth curves revealed that PC-3M-2B4 cells upon the overexpression of TMSG1/LASS2 exhibited significantly decreased proliferation ability compared with that in the presence of T2 or T3 overexpression (P < 0.05, Fig. 5A), indicating that the full length TMSG1/LASS2 (T1) showed stronger ability to inhibit the cell proliferation than the variant deleted Homeodomain (T2) or NLS sequence (T3). Furthermore, the cell proliferation ability upon the overexpression of T2 or T3 was decreased compared with the control cells (P < 0.05, Fig. 5A), suggesting the variant of TMSG1/LASS2 deleted Homeodomain or NLS sequence still had the ability to inhibit the cell proliferation.

Tumor Invasive Ability Analysis

Matrigel invasion assay was performed to detect the cell invasive ability after the overexpression of different variants. The cell numbers passed through the matrigel and membrane in the group over-expressed T1 were less than that in the presence of T2 or T3 overexpression (P < 0.05, Fig. 5B, C), indicating that the full length TMSG1/LASS2 (T1) showed stronger ability to inhibit the cell invasion than the variant deleted Homeodomain (T2) or NLS sequence (T3). Furthermore, the cell invasive ability upon the overexpression of T2 or T3 was decreased compared with the control cells (P < 0.05, Fig. 5B, C), suggesting the variant of TMSG1/LASS2 deleted Homeodomain or NLS sequence still had the ability to inhibit the cell invasion.

Cell apoptosis analysis by flow cytometry

To identify whether Homeodomain or NLS of TMSG-1/LASS2 contributed to promoting cell apoptosis, we examined the apoptosis rate of PC-3M-1E8 cells that exogenously expressed different variants with or without Homeodomain. The apoptosis rate of tumor cells upon TMSG-1/LASS2 (T1) overexpression was significantly higher than those upon T2 or T3 variant overexpression and the control (P < 0.05, Fig. 6A, C), and the apoptosis rate of cells upon T2 or T3 variant overexpression was higher than that of the control (P < 0.05, Fig. 6A, C). These results suggested Homeodomain of TMSG-1/LASS2 played an important role in promoting cell apoptosis.

Cell cycle analysis by flow cytometry

Next, we examined the cell cycle distribution of PC-3M-1E8 cells that exogenously expressed different variants with or without Homeodomain and NLS. The number of cells distributed at stage G0-G1 upon TMSG-1/LASS2 (T1) overexpression was higher than those upon T2 or T3 variant overexpression and the control (P < 0.05, Fig. 6B, D). However, no significant difference was revealed between cells overexpressed T2, T3 variants and the control (P > 0.05, Fig. 6B, D).

TMSG1/LASS2, first cloned as a transmembrane protein, could inhibit cell proliferation and invasion, and promote apoptosis in a variety of cancer cells through different mechanisms, such as directly interact with vacuolar ATPase [2]. It is known TMSG1/LASS2 is a transmembrane protein predominately located in the membrane and cytoplasm [12]. However, we found by accident in our previous study TMSG1/LASS2 was partially located in the nucleus of PC-3M-2B4 cells, which has not been reported up till now. And subsequently, we predicated TMSG1/LASS had NLS in its Homeodomain domain, a DNA-binding domain featured by some transcription factors. Therefore, we for the first time investigate the function of TMSG-1/LASS2 in regulating gene transcription as a transcription factor in the present study.

As a pivotal structure of some transcription factors, Homeodomain could bind to DNA to mediate the interaction between transcription factor and its target genes [13, 14]. NLS is essential for the transcription factor to enter the nucleus to play the transcriptional regulation function [15]. Herein, our results of immunofluoresence revealed TMSG1/LASS2 protein was partially distributed in the nucleus with most of them scattered in the cytoplasm. However, its variants deleted Homeodomain or NLS sequences predominantly appeared in the cytoplasm, indicating that TMSG1/LASS2 with Homeodomain could enter the nucleus rather than its variant without Homeodomain or NLS. NLS in Homeodomain of TMSG1/LASS2 mediated its entrance into the nucleus.

Transcription factor could play the function of regulating the transcription of certain genes through binding to the genes after entering nucleus. Since TMSG1/LASS2 was found to be able to enter the nucleus, we performed chromatin immunoprecipatation and high-throughput sequencing to detect the genes binding to TMSG1/LASS2. We obtained 1978 gene fragments bound to TMSG-1/LASS2 protein, among which 926 were functional gene fragments. Notably, 98 gene fragments were located in promoter area, which was usually the binding site of transcription factor to modulate the transcription of the corresponding genes. GO and KEGG enrichments revealed a proportion of the candidate genes were involved in colorectal cancer, death of tumor cells, endocytosis, RAN degradation and neuron differentiation.

Among the 98 candidate genes, we chose the Neural Proliferation, Differentiation and Control 1 (NPDC1) gene, whose promoter fragment was obtained after CHIP and high-throughput sequencing for further study. NPDC1 gene is located on chromosome 9q34.3 and encodes 325 amino acids. Previous studies had shown that NPDC1 could regulate the expressions of D-cyclins and cdk2 so as to suppress the proliferation and differentiation of neuronal cells through binding to the transcriptional factor E2F-1 [16]. NPDC1 was reported to be involved in mediating nuclear respiratory factor 1-regualted growth of neuroblastoma IMR-32 cells [17]. NPDC1 had the ability to inhibit the proliferation and tumor transformation of neuronal cells or non-neuronal cells [18]. Therefore, NPDC1 was further studied to assess the transcriptional regulation function of TMSG1/LASS2.

Herein, dual-Luciferase reporter system revealed TMSG1/LASS2, as well as the variant with the deletion of NLS could enhance the transcription of NPDC1 promoter rather than the variant deleted the Homeodomain, demonstrating TMSG1/LASS2 played the role in promoting transcription of NPDC1 mainly through its Homeodomain to combine to NPDC1 promotor. In spite of the deletion of NLS, the variant T3 still retained the DNA binding ability of Homeodomain and transcription regulating function of TMSG1/LASS2. Moreover, the present RT-qPCR and Western blot results demonstrated the gene and protein levels of NPDC1 were significantly increased upon TMSG1/LASS2 overexpression, while they were not elevated upon the overexpression of the variant without Homeodomain or NLS. Moreover, we revealed the gene and protein levels of NPDC1 were markedly decreased upon TMSG/LASS2 knockdown. These results manifested Homeodomain and NLS were responsible for TMSG1/LASS2 mediating enhancement of NPDC1 expression, and further confirmed the transcription promoting function of TMSG1/LASS2 on NPDC1.

Our previous study showed that the overexpression of TMSG-1/LASS2 in PC-3M-1E8 could inhibit the proliferation and increase apoptosis of cancer cells [2, 3]. Our results manifested the full length TMSG1/LASS2 was more able to inhibit cell proliferation, invasive ability and promote the apoptosis of cancer cells than the variant without Homeodomain or NLS. Therefore, the variants of TMSG-1/LASS2, even only with the deletion of NLS, could not behave similarly to the intact TMSG-1/LASS2 as a tumor suppressor. As is known, Homeodomain is the key structure for transcription factor to combine to its target genes, and NLS is essential for transcription factor to enter the nucleus to play transcriptional regulation function, which indicated that TMSG-1/LASS2 might inhibit cell proliferation, invasive ability and promote cell apoptosis partially through the transcriptional regulation function mediated by its Homeodomain and NLS. However, the cell proliferation and invasive ability decreased and the cell apoptosis increased upon the overexpression of the variants compared with the control, especially the T3 variant. which may be interpreted that the TLC domain of TMSG-1/LASS2, a characteristic domain of LASS family involved in the synthesis of ceramide, contributed partially to suppressing cell proliferation, invasive ability and promoting cell apoptosis [6, 19, 20].

Taken together, TMSG1/LASS2 protein could enter the nucleus to play transcription factor role mediated by its Homeodomain. Tumor suppressor gene NPDC1 is one of the target genes of TMSG1/LASS2 protein as a transcription factor. TMSG1/LASS2 could promote the transcription and subsequent expression of NPDC1. TMSG-1/LASS2 might inhibit cell proliferation, invasive ability, promote cell apoptosis and G0/G1 cell cycle arrest partially through the transcriptional regulation function mediated by its Homeodomain and NLS. We for the first time propose a new transcriptional regulation function of TMSG1/LASS2 in addition to the known tumor suppressor function as a transmembrane protein. Our study not only expands knowledge of the role of TMSG1/LASS2 in the inhibition of tumor, but also provides a potential novel biomarker for guiding the therapy of aggressive cancers.

-Ethical approval and consent: Not applicable.

-Consent to publish: Not applicable.
-Availability of data and material: The gene datasets generated and/or analysed during the current study are available in the NCBI repository https://www.ncbi.nlm.nih.gov/.

-Conflict of interest: All authors declared there was no conflict of interest.

-Funding: This work was supported by Natural Science Foundation of Shandong Province (ZR2017MH009), and Clinical Medicine and X Project of the Affiliated Hospital of Qingdao University (QDFY+X2021017,QDFY+X202101064).

-Acknowledgment: Not applicable.
-Author's contribution: Xin Wang and Wenjuan Yu wrote the manuscript text and Yan Xia and Jingjing Li prepared figures 1-6. Fenggang Xiang revised the manuscript.All authors reviewed the manuscript.

-Author's information: ¹. Department of Pathology, School of Basic Medicine, Qingdao University, Qingdao 266000, China. ². Department of Pathology, The Affiliated Hospital of Qingdao University, Qingdao 266003, China. ³. Department of Pathology, Qingdao Women and Children’s Hospital, Qingdao 266011, China

MaC,LiuY,ZhengJ,etal.Identification of tumor metastasis related gene TMSG-1 by mRNA differential display.Sci China C Life Sci.2002;45(5):553–60.
YuWJ,WangLM,WangYW,etal.A Novel Tumor Metastasis Suppressor Gene LASS2/TMSG1 Interacts With Vacuolar ATPase Through Its Homeodomain.J Cell Biochem.2013;114(3):570–83.
SuJ,YuWJ,GongMZ,etal.Overexpression of a Novel Tumor Metastasis Suppressor Gene TMSG1/LASS2 Induces Apoptosis via a Caspase-dependent Mitochondrial Pathway.J Cell Biochem.2015;116(7):1310–7.
RuanHY,WangT,YangC,etal.Co-expression of LASS2 and TGF-β1 predicts poor prognosis in hepatocellular carcinoma.Sci Rep.2016;6:32421.
LiuJY,WangHF,WangY,etal.Repression of the miR-93-enhanced sensitivity of bladder carcinoma to chemotherapy involves the regulation of LASS2.Onco Targets Ther.2016;9:1813–22.
HuangLJ,LuanT,ChenYJ,etal.LASS2 regulates invasion and chemoresistance via ERK/Drp1 modulated mitochondrial dynamics in bladder cancer cells.J Cancer.2018;9(6):1017–24.
MizutaniY,KiharaA,IgarashiY.Mammalian Lass6 and its related family members regulate synthesis of specific ceramides.Biochem J.2005;390(Pt1):263–71.
BorisNovakovic,ThierryFournier,Lynda K.Harris,etal.Increased methylation and decreased expression of homeobox genes TLX1, HOXA10 and DLX5 in human placenta are associated with trophoblast differentiation.Sci Rep.2017;7(1):4523.
MansiShah,RyanCardenas,BelindaWang,etal.HOXC8 regulates self-renewal, differentiation and transformation of breast cancer stem cells.Mol Cancer.2017;16(1):38.
Moon KyungJoo,Jong-JaePark,Hoon Jai Chun. Impact of homeobox genes in gastrointestinal cancer.World J Gastroenterol.2016;22(37):8247–56.
LiuYX,ZhengJ,FangWG.Isolation and characterization of human prostate cancer cell subclones with different metastatic potential.Chin J Pathol.1999;28(5):361–4.
Pewzner-JungY,Ben-DorS,FutermanAH.When do Lasses (longevity assurance genes) become CerS (ceramide synthases)?: insights into the regulation of ceramide synthesis.J Biol Chem.2006;281(35):25001–5.
TuplerR,PeriniG,GreenMR.Expressing the human genome.Nature.2001;409(6822):832–3.
Simona DiLascio,DeboraBelperio,RobertaBenfante,etal.Alanine Expansions Associated with Congenital Central Hypoventilation Syndrome Impair PHOX2B Homeodomain-mediated Dimerization and Nuclear Import.J Biol Chem.2016;291(25):13375–93.
OkazakiK,NakayamaN,NariaiY,etal.Nuclear localization signal in a cancer-related transcriptional regulator protein NAC1.Carcinogenesis.2012;33(10):1854–62.
SpencerML,TheodosiouM,NoonanDJ.NPDC-1, a novel regulator of neuronal proliferation, is degraded by the ubiquitin/proteasome system through a PEST degradation motif.J Biol Chem.2004;279(35):37069–78.
TongCW,WangJL,JiangMS,etal.Novel genes that mediate nuclear respiratory factor 1-regualted neurite outgrowth in neuroblastoma IMR-32 cells.Gene.2013;515(1):62–70.
QuX,ZhangC,ZhaiY,etal.Characterization and tissue expression of a novel human gene npdc1.Gene.2001;264(1):37–44.
OgretmenB,HannunYA.Biologically active sphingolipids in cancer pathogenesis and treatment.Nat Rev Cancer.2004;4(8):604–16.
ZengF,HuangLL,ChengXM,etal.Overexpression of LASS2 inhibits proliferation and causes G0/G1 cell cycle arrest in papillary thyroid cancer.Cancer Cell Int.2018;18:151.

No competing interests reported.

Download PDF

Version 1

posted

You are reading this latest preprint version

TMSG1/LASS2 inhibits cell proliferation, invasive ability through a novel transcriptional regulation way mediated by Homeodomain Running title: a novel transcription regulation role of TMSG1

Status:

Version 1

Abstract

Figures

Background

Methods

Cell culture

Construction Of Vectors And Gene Transfection

Immunofluorescence To Detect The Cellular Localizations Of Tmsg1/lass2 And The Variants

Chromatin Immunoprecipatation And High-throughput Sequencing To Screen Candidate Genes Interacting With Tmsg-1 Protein

Mtt Assay To Analyze Cell Proliferation Ability

Invasion Assay

Flow cytometry for the analysis of cell apoptosis

Flow Cytometry For The Analysis Of Cell Cycle

Results

Construction of vectors and gene transfections

Npdc1 Was One Of The Target Genes Interacting With Tmsg-1/lass2 Protein

TMSG1/LASS2 could play the role in promoting transcription of NPDC1 via its Homeodomain

Npdc1 Expression Was Increased Upon Tmsg1/lass2 Overexpression

Npdc1 Expression Was Decreased Upon Tmsg1/lass2 Knockdown

Cell Proliferation Ability Analysis By Mtt Assay

Tumor Invasive Ability Analysis

Discussion

Declarations

References

Additional Declarations

Status:

Version 1