Molecular characterization, expression and localization analysis of a pedal like peptide in cuttlefish Sepiella japonica

doi:10.21203/rs.3.rs-1640075/v1

Download PDF

Research Article

Molecular characterization, expression and localization analysis of a pedal like peptide in cuttlefish Sepiella japonica

https://doi.org/10.21203/rs.3.rs-1640075/v1

This work is licensed under a CC BY 4.0 License

Version 1

posted

You are reading this latest preprint version

Background

Neuropeptide pedal peptide (PP) and orcokinin (OK) are related active peptides that have been widely discovered in invertebrates. They have complex structures, and play key roles in various physiological process. Till now, there were no any reports in cephalopods with highly differentiated multi-lobular brain.

Methods

The partial cDNA sequence of neuropeptide PP in Sepiella japonica (termed as Sj-PP) was identified from a transcriptome, the full-length cDNA was obtained by rapid amplification cDNA ends (RACE) method. The bioinformatic analysis was performed through associated softwares. The tissue distribution profile and spatio-temporal expression were detected out by semi-quantitative RT-PCR and quantative Real-time PCR (qRT-PCR) assay, respectively. The tissue location was carried out with in situ hybridization (ISH).

Results

The putative precursor of Sj-PP encodes 22 mature peptides, of which, only tridecapeptides could be post-translationally amidated at C-terminus. Each tridecapeptide owns the most conserved and frequent N-terminus DSI. The sequence analysis showed PPs shared low identity, and Sj-PP might be a PP3 member. The quantitative data showed Sj-PP widely distributed in various tissues, and the content in brain, optic lobe, liver and nidamental gland continuously increased till gonad maturation during the whole growth and development stages. In situ hybridization (ISH) detected Sj-PP positive signals in almost all regions of optic lobe except plexiform zone, all functional lobes in brain, epithelial cells and outer membrane layer of accessary nidamental gland, which hinted it is likely to be involved in the regulation of reproduction, such as vitellogenin synthesis, restoration, and ova encapsulation.

Conclusions

The results declared Sj-PP was involved in the neuroendocrine regulation in cephalapod, and provided a basic theoretical data for further studying regulatory role in the reproduction.

Sepiella japonica

pedal peptide

expression and localization

reproduction

Neuropeptides are ancient neuronal signal molecules which regulate multiple physiological activities in animals. They are characterized by low content, high activity, extensive and complex functions [1]. Pedal peptides (PPs) and orcokinins (OKs) are structurally related active peptides discovered predominantly in invertebrates. Molecular analysis indicated their precursors have complex structures, which constitue PP/OK-type neuropeptide family. PP and OK have highly homologous structures and thus might have been drived from the same evolutionary ancestors. Genome /transcriptome sequencing has revealed PP/OK-type neuropeptide could be traced back to the common ancestor of protostomes and deuterostomes [2]. Previous studies clearly showed that PP/OK-type neuuropeptides have numerous physiological roles in protostomes, including muscle regulation and ciliary activity that associated with locomotor activity in mollusks [3] and regulation of both the frequency and amplitude of hind-gut contraction in arthropods [4].

Neuropeptide PP was firstly detected in pedal ganglia of Aplysia californica (termed as Ac-PP) [5]. Ac-PP was found widely distributed in the central nervous system (CNS) and periphery, and concentrated mainly in the foot and pedal ganglia of Aplysia [6]. Four types of PPs were identified in its genome, one of which acted as neurotransmitter in interneuronal signaling, and other three neuropeptides signaled as neuropeptides [7]. The expresion primary in pedal ganglia was consistent with its regulation in contractions of foot muscle, and it can increase the amplitude and relaxation rate of nerve-evoked contractions [3].

Multiple PP-type neuropeptides genes and precursors have also been identified, three PP genes from Lottia gigantean [8] and Platynereis dumerili [9], two precursors from sea urchin Strongylocentrotus purpuratus [2]. One PP precursor from Apostichopus japonicus could be cleaved into six PP-like mature peptides [10]. The pharmacological investigation indicated PP could increase the ciliary beat frequency of pedal epithelium cells [11]. PP-expressing neurons also innervate other organs implying PP might be involved in other functions apart from foot activity [3]. PP located in the neurons Pd5 and Pd6 of Tritonia Diomedea pedal ganglia (TdPP). TdPP was likely to be involved in orienting to changes in earth-strength magnetic fields [12] or changes in water flow [13] since it was active during locomotion. Previous investigation reported that TdPP could accelerate the beating rate of the epithelium of salivary duct [14]. In addition, immunocytochemical localization of TdPP showed it aboundantly lies on the brain dorsal surface, among which the largest positive neurons were in the pedal ganglia and root, indicating it may play a role in the central pattern generator for swimming. Another TdPP staining pattern processes in the brain terminated at the paired statocysts which is a ciliated organs to sense gravity, these ciliated structures receive TdPP innervation, and may also regulate beat in the statocyst as well, thereby TdPP may be acting as a neurotransmitter transducing the sensory signal of the statocyst to the CNS [15]. Moreover, PP in Clione limacine could accelerate heart contraction. [16].

PP-type neuropeptides belong to related neuropeptides family that occur in other phyla, including Orcokinin (OK) [17]. OK was firstly discovered in spiny-cheek crayfish Orconectes limosus in 1992, and its mature peptide was NFDEIDRSGFGFN [4]. Later, other four members with 13 amino acids were identified [18]. OK gene encodes three different types of neuropeptides, orcokinin A, orcokinin B and orcomyotropins [19–21]. In insects, OK genes either express two types of transcripts encoding OKA and OKB, respectively [22], or encode both OKA and OKB in the same precursor [23]. Strigamia maritima has one OK gene that generates three different transcripts [24]. Procambarus clarkii expresses two different types of prepro-orcokinin [25].

Sepiella japonica, an important economic and ecological cephalopod, was used to be one of the four major seafoods in the East China Sea. Although totally artificial breeding has been a great help to recover its resources, the artificially cultured individuals presented precocious puberty that restricted its healthy and sustainable development. Previous studies showed neuropeptides, neurohormones and neuromodulators play key roles in reproductive processes. The present study described the identification, expression and localization of a PP/OK-type neuropeptide in S. japonica (termed as Sj-PP). The data will lay the groundwork for further learning its regulatory function in the cephalopod.

2.1 Animals

Healthy S. japonica at five gonadal development stages were bought from a local cuttlefish breeding base(Xixuan Island, Zhoushan, Zhejiang Province). The gonad development stages were categorized according to oocytes size, follicular folds and yolk bodies formation through naked eyes observation and histological method [25]. After anesthetized on ice, all dissected tissues were placed into RNAstore or 4% paraformaldehyde (PFA) immediately at 4 ℃ overnight for RNA extraction or tissues section.

2.2 RNA extraction and cDNA synthesis

The total RNA isolation from all dissected tissues was carried out using Trizol Plus (TransGene, Beijing). 1.0 µg total RNA was used to synthesize cDNA by using PrimerScript™ RT reagent kit with gDNA Eraser (TaKaRa, Japan) with according to the manufacture’s protocol. The products were stored in -20 ℃ for future use.

2.3 Sj-PP transcript identification and characterization

An annotated unigene corresponding to PP/OK-type neuropeptide precursor cDNA was identified from previous RNA sequencing data [26]. Based on the sequence, the specific primers (Table 1) were designed to obtain cDNA fragments for Sj-PP open reading frame (ORF) by RACE (rapid amplification of cDNA ends) -PCR as described in previous study [27]. The first-strand cDNA was synthesized using SMARTer™ RACE Amplification Kit (TaKaRa, Japan) according to the manufacturer’s protocol.

2.4 Sequence analysis

The ORF and amino acid sequence were inferred using DNAstar 7.0 software, the protein motifs feature was predicted by online Simple Modular Architecture Research Tool (http://smart.embl-heidelberg.de/). The homolog was analyzed by the BLASTP program at the National Center for Biotechnology Information (http://www.ncbi.nlm.nih. gov/blast). Multiple alignments were carried out with DNAman 8.0 software. The statistical analysis was performed with ANOVA method by IBM SPSS Statistics 21.

2.5 RT-PCR tissue profiling

2.5.1 Semi RT-PCR

Specific primers (Table 1) were designed based on the ORF sequence of Sj-PP to perform semi RT-PCR, and β-actin (Lv et al., 2016) was chosen as the internal control. The amplification was carried out in a 25 µl volume including 12.5 µl 2×Easy Taq Mix (TransGene, Beijing), each primer 1.0 µl, cDNA 0.5 µg, ddH₂O 9.5 µl. The PCR program was 95 ℃ 10 min; 95 ℃ 45 s, 55℃ 45 s, 72 ℃ 45 s, 35 cycles; 72 ℃ 10 min. All PCR products were detected with a 2.0% agarose gel electrophoresis.

2.5.2 Quantitative real-time PCR (qRT-PCR)

In this experiment, all cDNAs from tissues at different gonad development stages were used as amplification template. GAPDH selected from our transcriptome and β-actin were used as double internal controls. The amplification was performed with TB Green™ Premix Ex Taq™ II (Tli RNaseH Plus) kit (TaKaRa, Japan) on a Bio-Rad CFX connect machine. The dissociation curve analysis of amplification products after thermocycling was used to confirm the primers specificity. The expression level of Sj-PP was calculated with formula 2^−ΔΔCt [28]. All data are given in terms of relative mRNA expression as mean ± S.D.. Differences were analyzed with ANOVA. P < 0.05 and P < 0.01 were considered to be significant and highly significant, respectively.

2.6 Tissues localization with ISH

2.6.1 Tissues section

After overnight fixation, the tissue paraffin was sectioned as previously described [29]. Briefly, the tissues were dehydrated in gradient methanol, followed by cleared in xylene, immersed and embedded in paraffin wax. Tissues were cut to be 5.0 µm thick, dried and stored at -20 ℃.

2.6.2 RNA probes preparation

The gel purified PCR products with specific primers (Table 1) were ligated into pGEM-T easy vectors (Invitrogen, USA), and subcloned into Escherichia coli DH5α. Forward and reverse inserted fragments were confirmed by sequencing using T7 primers (Table 1).

The fragments were amplified with isolated plasmids by T7 primer and ISH primer. In vitro transcription were performed in a 20 µl volume including 5 × Transcription Buffer 2.0 µl, 10 × Dig RNA labeling Mix 2.0 µl, PCR products 1.0 µg, RNase Inhibitor (40 U/µl) 1.0 µl, DEPC H₂O up to 20 µl. The transcription was kept at 37°C for 2.5 h, 2.0 µl DNase I was added to stop the reaction for 30min. Continuously, RNA probes were purified. The concentration and integrity of RNA probes were checked by spectrophotometer (A260/A280) and 1.2% agarose gel electrophoresis, respectively. They were stored at -80°C for use.

2.6.3 Probes hybridization, antibody incubation and colorimetry

The detailed procedures were employed in the previous study [29]. Briefly:

On the first day, the tissue sections were rinsed in series alcohol (100% -95% − 80% − 70% − 50% − 30%) for rehydration. Next, they were digested in proteinase K at 37°C for less than 10min, bathed in Tris-Glycine buffer to stop the digestion reaction, followed by the second time fixation in 4% PFA. After that, the slides were rinsed in 4×sodium citrate buffer (SSC) and ready for pre-hybridization. Pre-hybridization solution containing salmon sperm ssDNA was dropped onto tissues to keep 2 h at 42°C to block the non-specific signals. Later on, hybridization solution containing denatured RNA probes (3 ng/µl) was dropped and the tissues were kept another 16 h at 55°C.

On the second day, all slides were firstly rinsed in gradient SSC at 37°C, followed by BSA and goat serum blockage for 2–3 h at room temperature. Slides were incubated with anti-Dig AP-conjugate antibody (Roche, USA) overnight at 4°C.

On the third day, all slides were washed with TBST and NTMT buffer for several times. NBT/BCIP (Roche, USA) diluted 50-fold in NTMT buffer was dropped to cover tissue sections under dark condition, the color development should be observed at any time. The chromogenic solution should be renewed every half an hour if needed. At last, the slides were sealed with glycerin.

Table 1

Primers used in the study
Primers		Sequences(5’-3’)	Efficiency
Unigene amplification
F		AGAAACGCACTCCGACAGAT	/
R SP-GCP-F SP-GCP-R		TAAGGTTTGAGTTCAGGGATT 5'-GGAAACTGGCAGATAAGGAAA-3'	/
RACE
3'-Sj-PP-F SpFaGPCR-ORF-F SpFaGPCR -ORF-R For RT-PCR and Qrt-PCR		ATTCGCCCAATGTTGATATGGATAAG ACGGGTCAGGTTCAGCATCAGGG-3’ 5’- TCTGTCATCTTCCCATGG-3’ 5’- GGTTTATTGATAACGTGA − 3’	/
3’-Sj-PP-R-N	AATCCCTGAACTCAAACCTTAC		/
RT-PCR
Sj-β-actin-F	GCCAGTTGCTCGTTACAG		102.1%
Sj-β-actin-R		GCCAACAATAGATGGGAAT	102.1%
Sj-GADPH-F		TGGTTCCTTGGCTTTTGCT	99.0%
Sj-GADPH-R		GGTGGTGGTGCGGGTAGT	99.0%
qSj-PP-F		GCTATTGGTTTTGTGCCTGTT	101.5%
qSj-PP-R		AGTTGCTTCATTCTCGCTGTG	101.5%
ISH
ISj-PP-F		ACCCGATTTCAGATAGCAGTTT	/
ISj-PP-R		TGAGTTCAGGGATTTATTACGC	/

3.1 Characterization of Sj-PP precursor cDNA sequence

In the paper, the ORF was obtained by homology cloning and RACE technology, As shown in Fig. 1, the ORF was 1140bp encoding a precursor peptide with 380 amino acid residues. The predicted molecular weight (MW) is 40.45KDa and the theoretical isoelectric point (pI) is 9.77. The predicted precursor contains a putative signal peptide with 21 amino acid residues in the N-terminus, and could be endoproteolytically cleaved at 23 processing sites giving rise to 22 mature peptides. All mature peptides are different, including 19-amino acids peptide AFDRIASGSGLNGFPESAI, 14-amino acids peptide VFDSIADGTFGGMN, dodecapeptide KLQNYSPNVDMD, octapeptide QTFDAFIG, two hexapeptides PFHALY and QLSDLL, tetrapeptide NDNI, dipeptide RV, and fifteen tridecapeptides. These tridecapeptides consist of three SFDSIASSGFGGMamide, two SFDSIDGSAFGGMamide, SFDSIDGGMFRSM- amide, SFDPIEGSSFGGMamide, PFDSISDSAFGGMamide, PFDSIDGSAFGGM- amide, PFDSIESSSFGGLamide, QFDSISHSSFRQM amide, TFDSIDGSAFGGM- amide, TFDPIDSSSFGGMamide, TLDPISDSSFGGMamide and AFDPIDSSAFGSM -amide. Only tridecapeptides were post-translationally amidated at C-terminus with a glycine immediately behind the FGGM/L, FG/RSM, FRQM motifs. Lys-Arg, Lys-Lys, Arg-Arg, Arg or Lys residue are served as internal proteolytic cleavage sites for post-translational process. Each amidated mature peptide shows that the N-terminus FDSI and C-terminus FGGM are the most general and conserved sequence.

3.2 Homology analysis

The deduced amino acids were performed homology searching in the NCBI database, it shared relatively low identity with PP/OK-type members. Sj-PP precursor shared 49.81% identity with OKA of Araneus ventricosus (GBL79579) and 47.45% with Stegodyphus mimosarum OKB (KFM82953). Meanwhile, it shared 41.96% similarity to PP3 of A. californica (XP_005098921), 41.86% to Elysia marginata PP (GFR82759), 41.28% Helix lucorum (AAB51694).

Multiple alignments of Sj-PP precursor peptide with other representative species were carried out (Fig. 2). Low sequence conservation was observed among them except the internal proteolytic cleavage sites (KR) at some positions, and partial sequences in mature peptides, such as DSI.

3.3 Phylogenetic analysis

A phylogenetic tree of PPs and OKs (Fig. 3) from several representative species was constructed by maximum likelihood method. From the results, the tree was divided into PP clade and OK clade. Unexpectedly, two OKB sequences of cephalopods annotated from RNA sequence fell on PP clade, in addition, all submitted sequences in the NCBI database are no-curated. Its reasonable to believe that the two sequences were likely to be wrongly annotated due to higly repetitive structures in both PP and OK precursors, they were actually PPs. Sj-PP firstly clustered with two “PPs” from cephalopods, then clustered together with PP3 of A. californica, indicating that Sj-PP obtained in the study might be a PP3 member, it is consistant with homology analysis. This evolutionary result furtherly suggested that Sj-PP is indeed a member of PP family.

3.4 Tissue expression profile of Sj-PP

The tissue expression profile of Sj-PP in adult individuals was showed in Fig. 4. Clearly, Sj-PP was highly expressed in all tested tissues,but the hemocytes and nidamental gland showed relative lower expression.

3.5 Spatio-temporal expression of Sj-PP throughout the gonad development

As shown in Fig. 5, the expression level of Sj-PP in different tissue at five gonad developmental stage was calculated and normalized by that of stomach. At stage I-II (Fig. 5-A), the highest expression level of Sj-PP appeared in optic lobe with 344.4-fold (P < 0.01), while other tissues all showed relatively low expression. The Sj-PP content jumped to 1647.5-fold (P < 0.01) in the brain, it continued to increase to 975.4-fold (P < 0.01) in optic lobe, and emerged significant expression in liver (104.7-fold) and gill (208.6-fold) at stage III (Fig. 5-B). Sj-PP in brain continued to boost the expression level to 5538.5-fold and sustained a considerable amount of content in optic lobe, the content in liver kept increasing to 594.9-fold (P < 0.01), and in the nidamental gland appeared a significant upregulation to 327.4-fold at stage IV. However, at stage V, the expression level of Sj-PP in brain and liver began to decrease to 333.0-fold (P < 0.01) and 343.5-fold, respectively; it went on increasing to 2046.7-fold (P < 0.01) in the optic lobe; apparently, the content in the gonad-related tissues also emerged significant upregulation. At stage VI, the content of Sj-PP in the optic lobe and liver registered a drop to 765.7-fold (P < 0.01) and 203.7-fold (P < 0.01), respectively; while it still increased in the nidamental gland. Collecting together, during the whole development stages, the expression level of Sj-PP increased rapidly until stage IV in the brain, liver and nidamental gland, then decreased gradually; it increased continuously in the optic lobe.

3.6 Tissue localization of Sj-PP

The tissues localization of Sj-PP from individuals at stage V was detected by ISH As Fig. 6 showed, compared to the control grous (Fig. 6-A), samples incubated with anti-sense probes appeared apparent positive signals (Fig. 6-B-D):

In the optic lobe (Fig. 6-B), the positive signals were detected in almost all regions except plexiform zone. The increasing staining intensity of the signals were observed from deep retina toward central medulla. The inner and outer granule cells layers constituting the deep retina have relatively weak signals.

As shown in Fig. 6-C, the brain locates between two optic lobes. The brain of 30- day-old cuttlefish does not differentiate to be many functional leaves. Esophagus goes through the brain, and the brain is divided into supraoesophagueal mass and suboesophagueal mass. Clearly, there were plenty of Sj-PP positive signals in the brain, mainly distributed in the outer edge of these two masses, especially in the supraoesophagueal mass. Moreover, the joining regions between the brain and the optic lobe had a deal of dense positive signals. Besides, a circle arc of intense signals was detected in the joining region in the optic lobe also existed.

In the accessary nidamental gland (Fig. 6- D), all tubule wall existed strong positive signals. The Sj-PP was expressed in the epithelial cells that located in the tubular glands. In addition, positive signals were also observed in the outer membrane layer of accessary nidamental gland.

Due to the highly repetitive sequences and structures in arthropodan OKs and molluscan PPs, false positive hits always occurred when performing BLAST. The evolutionary common origin between OKs and PPs remain controversal, and the mature peptides analysis did not show a clear sequence conservation betweenthem. However, a higher similarity of Sj-PP to PP members was supported by a more careful analysis of sequence characterizations of proteolytic cleavage sites and mature peptides. In contrast, Sj-PP was apparently different from OKA, OKB of Rhodnius prolixus [30] and Blattella germanica [31]. Given this, Sj-PP is more likely to be PP neuropeptide. It was the first description of cephalopod PP neuropeptide, which constitutes a novel neuropeptide family. A common characteristic of neuropeptides is that the internal proteolytic cleavage sites were conserved [32], which is partially supported by the alignment analysis of some representative PP/OK-type neuropeptides in our study. Another typical feature in all neuropeptides is that the mature peptides are variable. Compared to OKB from insects Rhodnius prolixus with only one amidated mature peptide [22], Sj-PP owns 15 amidated mature peptides. Mature peptides of four AcPPs have distinct amidation state, for example, only one mature peptide PLDSVYGTHGMSGFA with 18 copies in AcPP1, 21 copies of PVDSIGSSFI and 2 copies of GVDSIDSSFI in AcPP2 were all unamidated; all 6 mature peptides in AcPP3 were amidated [7, 33].

The tissue distribution suggests that Sj-PP is likely to be more widely distributed than crustacean OKs existing in nervous system [4, 34] and hemolymph [35]. Different transcripts of neuropeptides have tissue-specific pattern, OKA of R. prolixus (RhOKA) is restricted in central nervous system (CNS), whereas OKB is expressed in CNS and anterior midgut [22]. The internal duplication, alternative splicing and differential expression of neuropeptides are supported to be a key mechanism for hormonal control on different metabolic processes by structurally related molecules [22]. The tissue distribution pattern and ISH results were consistent with qPCR data from Patiria pectinifera [36]. Immunohistochemical analysis using antibodies against PP-like neuropeptide of Asterias rubens (ArPPLNP1) revealed extensive networks of immunostained process in the radial nerve cords, circumoral nerve ring, digestive system, tube feet, coelomic lining, apical muscle and body wall [37]. The spatio-temporal expression data by qRT-PCR showed Sj-PP level was upregulated in nerve and reproductive system during the whole gonad development stage till to spawn, suggesting that Sj-PP may be involved in the regulation of development and reproduction process. The individuals at stage IV are in a rapid oocytes maturation period to prepare for ovulation, the similar upregulation trend in the liver and nidamental gland during the developmental process hinted Sj-PP might participate in vitellogenin synthesisand reserve in oocytes. In cephalopod, optic lobe and retina constitute the visual system, the photoreceptor cells connect with efferent nerve fiber in optic lobe which are linked with outer granule cells layer [38]. More and more studies showed some certain neuropeptides could be directly involved in the nerve control of optic lobe gland [39–40]. Cristo et al. thought cephalopods received signals from retina, FMRFamide and GnRH in optic lobe mediated signal transmiting to CNS to regulate reproduction by stimulating secretary activity of optic gland [41]. Sj-PP distributed throughout the optic lobe except plexiform zone from juvenile to adult, and the level in juvenile was higher than adult. The localization in joining regions of brain indicated that Sj-PP might be a molecule or a factor mediating signal transmit in the CNS to directly or indirectly regulate reproduction. In addition, tubules of accessary nidamental gland could form perforations through the connective tissue between accessary nidamental gland and nidamental gland, thus allowing the contents of the accessary nidamental gland tubules to be transported into the nidamental gland participating in the encapsulation of the ova [42]. The abundant Sj-PP signals in accessary nidamental gland suggested that it might miediate the secretion of ova envelope and encapsulation at the level of hormone or transmitter through the related muscle relaxation. Aplysia PP also presented in the oviduct [43], which might be related reproduction process. Simarily, in vitro pharmacological tests revealed ArPPLNP1 could cause apical muscle, tube foot and cardiac stomach relaxation [37].

As we all known, the brain structure of cephalopod is rather complex with neurons clustering, and the nerve cell bodies concentrated in the periphery to form the nerve lobes. Each nerve lobe has different regulatory role and they transports neural information among each other. Notable, unlike neurohormones and neurotransmitters, such as GnRH [44], have been reported in detail, Sj-PP was firstly reported to be detected in cephalapod CNS from our in situ hybridization data. Cephalapods have developed highly differentiated multi-lobular brain and closed vascular system which may endow them a higher neuroendocrine regulatory mechanism [45]. Similar to other neuroactive substances, Sj-PP might be involved in reproductive regulation, but further studies were still needed to be carried out and focused.

Competing Interest

No potential conflict of interest was reported by the author(s).

Ethical Approval

All experiments were conducted according to the protocols and guidelines approved by the ethics committee of Zhejiang Ocean University and the Academy of Experimental Animal Center of Zhejiang Ocean University.

Funding

This study was supported by the National Natural Science Foundation of China (NSFC; No. 31872547), Natural Science Foundation of Zhejiang Province, China (LY20C190007) and National Training Program of Innovation and Entrepreneurship (No. 202110340043).

[1] Gui SH, Jiang HB, Smagghe G, Wang JJ (2017) The neuropeptides and protein hormones of the agriculture pest fruit fly Bactrocera dorsalis: What do we learn from the genome sequencing and tissue-specific transcriptomes? Peptide. 98:29-34. doi: 10.1016/j.peptides.2017.10.009.

[2] Rowe ML, Elphick MR (2012) The neuropeptide transcriptome of a model echinoderm, the sea urchin Strongylocentrotus purpuratus. Gen Comp Endocr, 179(3), 331–344. https://doi. org/10.1016/j.ygcen.2012.09.009

[3] Hall JD, Lloyd PE (1990) Involvement of pedal peptide in locomotion in Aplysia: Modulation of foot muscle contractions. J Neurobiol. 21(6):858–868. doi:10.1002/neu.480210604.

[4] Stangier J, Hilbich C, Burdzik S, Keller R (1992) Orcokinin: a novel myotropic peptide from the nervous system of the crayfish, Orconectes limosus. Peptides 13: 859-864. doi: 10.1016/0196-9781(92)90041-Z.

[5] Lloyd PE, and Connolly CM (1989) Sequence of pedal peptide: A novel neuropeptide from the central nervous system of Aplysia. J. Neurosci. 9:312- 317. doi: 10.1523/JNEUROSCI.09-01-00312.1989

[6] Pearson WL, Lloyd PE (1989) Immunocytological localization of pedal peptide in the central nervous system and periphery of Aplysia. J Neurosci. 9(1):318-325. doi: 10.1523/JNEUROSCI.09-01-00318.1989.

[7] Moroz LL, Edwards JR, Puthanveettil SV, Kohn AB, Ha T, Heyland A, Knudsen B, Sahni A, Yu F, Liu L (2006) Neuronal transcriptome of Aplysia: neuroal compartments and circuitry [J]. Cell. 127(7): 1453-1467. doi:10.1016/j.cell.2006.09.052

[8] Veenstra JA (2010) Neurohormones and neuropeptides encoded by the genome of Lottia gigantea, with reference to other mollusks and insects. Gen Comp Endocrinol. 167(1): 86-103. doi: org/10.1016/j.ygcen.2010.02.010 PMID: 20171220.

[9] Conzelmann M, Williams EA, Krug K, Franz-Wachtel M, Jékely G (2013) The neuropeptide complement of the marine annelid Platynereis dumerilii. BMC genomics. 14: 906. doi: 10.1186/1471-2164-14-906.

[10] Rowe ML, Achhala S, Elphick MR (2014) Neuropeptides and polypeptide hormones in echinoderms: New insights from analysis of the transcriptome of the sea cucumber Apostichopus japonicus. Gen Comp Endocr. 197:43-55. doi: 10. 1016/j.ygcen.2013.12.002.

[11] Willows AO, Pavlova GA, Phillips NE (1997) Modulation of ciliary beat frequency by neuropeptides from identified molluscan neurons. J Exp Biol. 200(10):1433–1439. doi: 10.1002/humu.1380040208

[12] Popescu IR, Willows AOD (1999) Sources of magnetic sensory input to identified neurons active during crawling in the marine mollusc Tritonia diomedea. J Exp Biol. 202:3029–3036. doi: 10.1242/jeb.202.21.3029

[13] Murray JA, Hewes RS, Willows AO (1992) Water-flow sensitive pedal neurons in Tritonia: role in rheotaxis. J Comp Physiol A. 171:373–385.

[14] Gaston MR (1998) Neuropeptide TPep action on salivary duct ciliary beating rate in the nudibranch mollusc Tritonia diomedea. Invert Neurosci. 3:327–333. doi: 10.1007/BF02577692

[15] Beck JC, Cooper MS, and Willows dennis (2000) Immunocytochemical Localization of Pedal Peptide in the Central Nervous System of the Gastropod Mollusc Tritonia Diomedea. J Comp Neurol. 425: 1-9. doi: 10.1002/1096-9861(20000911)425:1<1::AID-CNE1>3.0.CO;2-Y

[16] Malyshev AY, NorekianTP, Willows AOD (1999) Differential effects of serotonin and peptidergic cardioexcitatory neurons on the heart activity in the pteropod mollusc, Clione limacine. J Comp Phys A. 185: 551-560. doi:10.1049/el:20050319.

[17] Jekely G. Global view of the evolution and diversity of metazoan neuropeptide signaling (2013) PNAS. 110(21): 8702-8707. doi:10.1073/pnas.1221833110.

[18] Skiebe P, Dregen M, Meseke M, Evers JF, Hucho F (2002) Identification of orcokinins in single neurons in the stomatogastric nervous system of the crayfish, Cherax destructor. J Comp Neurol. 444:245-259. doi:10.1002/cne.10145.

[19] Dircksen H, Burdzik S, Sauter A, Keller R (2000) Two orcokinins and the novel octapeptide orcomyotropin in the hindgut of the crayfish Orconectes limosus: identified myostimulatory neuropeptides originating together in neurones of the terminal abdominal ganglion. J Exp Biol. 203:2807-2818. doi:10.1023/A:1008924025488.

[20] Jiang H, Kim HG, Park Y (2015) Alternatively spliced orcokinin isoforms and their functions in Tribolium castaneum. Insect Biochem Mol Biol. 30 (65):1-9. doi: 10.1016/j.ibmb.2015.07.009.

[21] Veenstra JA (2014) The contribution of the genomes of a termite and a locust to our understanding of insect neuropeptides and neurohormones. Front Physiol. 5:454. doi: 10.3389/fphys.2014.00454.

[22] Sterkel M, Oliveira PL, Urlaub H,Hernandez-Martinez S, Rivera-Pomar R, Sheila O (2012) OKB, a novel family of brain-gut neuropeptides from insects. Insect Biochem Mol Bio. 42:466-473. doi: 10.1016/j.ibmb.2012.03.003.

[23] Veenstra JA (2016) Neuropeptide evolution: chelicerate neurohormone and neuropeptide genes may reflect one or more whole genome duplications. Gen Comp Endocrinol. 229:41-55. doi:10.1016/j.ygcen.2015.11.019.

[24] Chipman, AD, Ferrier DE, Brena C, Qu J, Richards S (2014) The first Myriapod genome sequence reveals conservative Arthropod gene content and genome organisation in the centipede Strigamia maritima. Plos Biol. 12(11): e1002005. doi: 10.1371/journal.pbio.1002005.

[25] Jiang XM, Fang-Yao FU, Zheng LI, Feng XD (2007) Study on the oogenesis and ovarial development of Sepiella maindroni. J Fish China. doi: 31:607-617. 10.3321/j.issn:1000-0615.2007.05.007.

[26] Lv ZM, Liu W, Liu LQ, Shi HL, Ping HL, Wang TM, Chi CF, Wu CW, Chen CH, Shen KN, Hsiao CD (2016) De novo assembly and comparison of the ovarian transcriptomes of the common Chinese cuttlefish (Sepiella japonica) with different gonadal development. Genomics Data., 6: 155-158. doi:10.1016/j.gdata.2015.12.011.

[27] Zheng LB, Liu ZH, Wu B, Dong YH, Zhou LQ, Tian JT, Sun XJ, Yang AG (2016) Ferritin plays an important role in immune process of Scapharca broughtonii. Dev Comp Immunol. 59:15-24. doi: 10.1016/j.dci.2015.12.010.

[28] Livak KJ, Schmittgen T (2001) Analysis of relative gene expression data using real-time quantitative PCR and the 2⁻^ΔΔCT method. Methods. 25(4): 402-408. doi: 10.1006/meth.2001.1262.

[29] Zheng LB, Qiu JY, Chen J, Zheng WQ, Pan Y (2020) Histopathological changes and piscidin 5-like location in infected Larimichthys crocea with parasite Cryptocaryon irritans. Fish Shellfish Immunol. 99:52-58. doi: 10.1016/j.fsi.2020.01.017.

[30] Wulff, JP, Sierra I, Sterkel M, Holtof M, Wielendaele PV, Francini F, Broeck JV, Ons S (2017) Orcokinin neuropeptides regulate ecdysis in the hemimetabolous insect Rhodnius prolixus. Insect Biochem Mol Biol. 81: 91–102. doi: 10.1016/j.ibmb.2017.01.003

[31] Ons S1, Bellés X, Maestro JL (2015) Orcokinins contribute to the regulation of vitellogenin transcription in the cockroach Blattella germanica [J]. J Insect Physiol. 82: 129–133. doi: 10.1016/j.jinsphys.2015.10.002

[32] Veenstra JA (2000) Mono- and dibasic proteolytic cleavage sites in insect neuroendocrine peptide precursors. Arch Insect Biochem Physiol. 43: 49-63. doi: 10.1002/(SICI)1520-6327(200002)43:2<49::AID-ARCH1>3.0.CO;2-M.

[33] Wang PY, Cui QY, Zhang YL, Wang X, Wei W (2021) A review of Pedal peptide/Orcokinin-type neuropeptides. Cur Protein and Pept Sci. 22: 41-49. doi: 10.2174/1389203721666201109112758.

[34] Li LJ, Pulver SR, Kelley WP, Thirumalai V, Sweedler JV, Marder V (2002) Orcokinin peptides in developing and adult crustacean stomatogastric nervous systems and pericardial organs. J Comp Neurol. 444:227-244. doi: 10.1002/cne.10139.

[35] Bungart D, Dircksen H, Keller R (1994) Quantitative determination and distribution of the myotropic neuropeptide orcokinin in the nervous system of astacidean crustaceans. Peptides 15:393-400. doi: 10.1016/0196-9781(94)90194-5.

[36] Kim CH, Kim EJ, Go HJ, Oh HY, Lin M, Elphick MR, Park NG (2016) Identification of a novel starfish neuropeptide that acts as a muscle relaxant. J Neurochem, 137(1), 33–45. https://doi.org/10.1111/jnc.13543

[37] Lin M, Egertová M, Zampronio CG, Jones AM, Elphick MR (2017) Pedal peptide/orcokinin-type neuropeptide signaling in a deuterostome: The anatomy and pharmacology of starfish myorelaxant peptide in Asterias rubens. J Comp Neurol. 525: 3890-3917. doi: 10.1002/cne.24309.

[38] Newth DR (1971) The anatomy of the nervous system of Octopus vulgaris. Oxford University Press: London. 690.

[39] Cosmo AD, Cristo CD (1998) Neuropeptidergic control of the optic gland of Octopus vulgaris: FMRFamide and GnRH immunoreactivity. J Comp Neurol. 398(1):1-12. doi: 10.1002/(SICI)1096-9861(19980817)398:1<1::AID-CNE1>3.0.CO;2-5.

[40] Gall SL, Féral C, Minenn JV (1988) Evidence for peptidergic innervation of the endocrine optic gland in Sepia by neurons showing FMRFamide-like immunoreactivity. Brain Res. 462(1): 80-88. doi: 10.1016/0006-8993(88)90588-4.

[41] Cristo CD, Bovip D, Cosmo AD (2003) Role of FMRFamide in the reproduction of Octopus vulgaris: molecular analysis and effect on visual input. Peptides. 24(10):1530-1532. doi: 10.1016/j.peptides.2003.07.018.

[42] Huang JD, Lee SY, Chiang TY, Lu CC, Lee MF (2018) Morphology of reproductive accessory glands in female Sepia pharaonis (Cephalopoda: Sepiidae) sheds light on egg Encapsulation. J Morphol. 279(8):1120-1131. Doi: 10.1002/jmor.20835.

[43] Pearson WL, Lloyd PE (1990) Distribution and characterization of pedal peptide immunoreactivity in Aplysia. J Neurobiol. 21: 883–892. doi: 10.1002/neu.480210606

[44] Song CP, Sun LL, Zheng LB, Chi CF (2021) Gonadotropin-releasing hormone-like gene in the cephalopod, Sepia pharaonis: characterization, expression analysis, and localization in the brain. Invertebr Reprod Dev. doi: 10.1080/07924259.2021.1935335.

[45] Albertin CB, Simakov O, Mitros T,Wang ZY, Pungor JR, Edsinger-Gonzales E, Brenner S, Ragsdale CW, Rokhsar DS (2015) The octopus genome and the evolution of cephalopod neural and morphological novelties. Nature. 524: 220-224. doi: 10.1038/nature14668.

Download PDF

Version 1

posted

You are reading this latest preprint version

Molecular characterization, expression and localization analysis of a pedal like peptide in cuttlefish Sepiella japonica

Status:

Version 1

Abstract

Figures

1. Introduction

2. Materials And Methods

2.1 Animals

2.2 RNA extraction and cDNA synthesis

2.3 Sj-PP transcript identification and characterization

2.4 Sequence analysis

2.5 RT-PCR tissue profiling

2.5.1 Semi RT-PCR

2.5.2 Quantitative real-time PCR (qRT-PCR)

2.6 Tissues localization with ISH

2.6.1 Tissues section

2.6.2 RNA probes preparation

2.6.3 Probes hybridization, antibody incubation and colorimetry

3. Results

3.1 Characterization of Sj-PP precursor cDNA sequence

3.2 Homology analysis

3.3 Phylogenetic analysis

3.4 Tissue expression profile of Sj-PP

3.5 Spatio-temporal expression of Sj-PP throughout the gonad development

3.6 Tissue localization of Sj-PP

4. Discussion

Declarations

Funding

References

Status:

Version 1