Excessive iron in diets promotes kidney fibrosis via disordering the inflammation factors in Sheep

doi:10.21203/rs.3.rs-1644865/v1

Download PDF

Research Article

Excessive iron in diets promotes kidney fibrosis via disordering the inflammation factors in Sheep

https://doi.org/10.21203/rs.3.rs-1644865/v1

This work is licensed under a CC BY 4.0 License

Version 1

posted

You are reading this latest preprint version

Iron is a mineral that the body acquires from the environment in order to maintain physiological function; however, excessive iron causes disease. The aim of this work is to investigate the processes by which excessive iron in diets induces kidney fibrosis in sheep by disorders their inflammatory factors. All sheep were fed a basal diet supplemented with 50 (CON), 500 (L-iron), 1000 (M-iron), and 1500 (H-iron) mg Fe/kg as ferrous sulfate monohydrate (FeSO4·H2O), respectively. Hematoxylin-Eosin (H&E), Perls, and Masson staining were used to observe histopatholological alterations; Western blotting, ELISA, and quantitative real-time polymerase chain reaction (qRT-PCR) were used to detect changes in the amounts of key inflammatory factor genes and proteins. As iron intake rose, glomerular cell contents dropped, tubular inflammatory cells infiltrated and fibrin was secreted, collagen fiber deposition and fibrosis have noticeable symptoms. Interleukin-1β (IL-1β), tumour necrosis factor-α (TNF-α), and interferon-γ (IFN-γ) activities were decreased, while interleukin-2 (IL-2), interleukin-6 (IL-6), nuclear factor-κB (NF-κB), and transforming growth factor-β1 (TGF-β1) actvities were increased. Excessive iron disorders inflammatory factor secretion, triggers an inflammatory response, and promotes the development of renal fibrosis, according to this study.

Excessive iron

Sheep kidney

Fibrosis

Inflammation factors

Iron is a mineral that the body obtains from the environment in order to maintain its physiological activity, and the majority of it is found in the form of hemoglobin in red blood cells [1]. Iron homeostasis imbalances can cause significant disorders by disrupting mitochondrial activity, as well as DNA repair and synthesis [2]. Metabolic changes and altered skeletal muscle function can be caused by iron insufficiency [3]. Iron excess can cause oxidative stress and iron deposition in parenchymal organs [4], which can harm the organism [5]. Traditionally, inorganic iron sulphate has been added to the feed to promote normal growth in animals and to prevent clinical deficiencies caused by low iron utilization [6]. The NCR advises a basic iron intake of 30 mg/Kg of feed dry matter for sheep[7], with a maximum tolerance of 500 mg/Kg of feed dry matter[8].

The kidneys are an essential endocrine organ that play an important role in maintaining fluid balance and normal organ function [9]. Diets supplemented with various iron dosages were found to have a close linear association with iron contents in the kidneys in studies. The kidneys complete the transport and reabsorption of iron through divalent metal ion transporters and transferrin receptors [10, 11], and unused iron excretion in urine [12]. As a result, the kidney plays a crucial role in maintaining iron homeostasis and preventing excessive iron. Excessive iron intake can persist in kidney tubular cells [13], affecting the innate immune response and even leading to cell death [14]. Inflammation induces the creation of iron regulatory proteins, which govern iron homeostasis [15], and disorder of inflammatory factors may lead to dysregulation of tissue repair and fibrosis [16]. These findings imply that in vivo iron levels are linked to inflammation and fibrosis. While it is well established that excessive iron causes liver inflammation and fibrosis [17], and the certainty of this relationship is enhanced by the reduction of serum iron levels in the follow-up of inflammation-induced experimental infections [18], the association between excessive iron and kidney inflammation and fibrosis in sheep is unclear and need to investigate further. Our study provides a theoretical foundation for further research into the harmful effects of excessive iron and the rational use of iron in sheep feeding management.

Inflammation is a defense mechanism in the body that is triggered by irritation or infection [19], inflammatory mediators play a role in cellular interactions and signal transduction. Hepcidin is a key factor in iron homeostasis management, which can suppress the expression of IL-1β, IL-6, NF-κB and TNF-α [20], and it is a major product released in response to IL-6 [21]. Excessive iron stimulation resulted in increased expression and release of IL-6 in the liver, according to previous studies [22]. IL-1β stimulates hepcidin expression via the same mechanism that activates IL-6 mediated hepcidin transcription [23]. Chelation reduces intracellular iron, which inhibits NF-κB induction of TNF-α and other cytokines. NF-κB is an important regulator of the inflammatory response, and the NF-κB pathway can be induced by TNF-α [24]. Iron can phosphorylate the inhibitor protein κB (IKB) [25] and dissociate it from NF-κB, resulting in NF-κB activation and inflammatory disease [26], which can be inhibited by the use of an iron chelating ligand (deferasirox) [27]. IL-2 is a pro-inflammatory factor that impacts cell proliferation and differentiation and is essential for immune cell proliferation, activation, and dynamic homeostasis. IFN-γ and TNF-α are important regulators of macrophage iron status and immunological function, causing cytokine-mediated effects that contribute to the inflammatory response [28].

Fibrosis is a pathological process in which inflammation causes necrosis of the parenchymal cells of certain organs and abnormal tissues, but it is unclear whether inflammation play a role in the development of kidney fibrotic disease in sheep [29]. However, previous studies have demonstrated that IL-1β stimulates macrophages and neutrophils [30], promotes cellular conversion to the epithelial mesenchyme, expresses collagen, and induces fibrosis [31], and induces tubulointerstitial renal tubular disease by promoting proximal tubular damage and fibrosis [32]. TNF-α is the primary cytokine responsible for pro-inflammatory cell recruitment and cellular inflammasome activation after macrophage activation[30]. IL-1β and TNF-α induce NF-κB translocation from the nucleus to active NF-κB, which is involved in pro-inflammatory and pro-fibrotic production [33]. TNF-α, IL-1β, and IL-6 activate the NF-κB pathway, which causes fibroblast activation and kidney fibrosis [34]. TGF-β1 is activated and released by macrophages, promotes intrinsic cell activation, which results in the production of large amounts of collagen and extracellular matrix [35], it is a crucial mediator in the recruitment of peripheral cells and the development of renal fibrosis in chronic kidney disease [36], and treatment of mouse renal tubular epithelial cells causes kidney fibrosis [37]. As a result, inflammatory factor disorders are virtually usually the cause of kidney fibrosis.

In these studies, in vivo experiments were used to assess the development of the inflammatory response in the sheep kidney to verify the extent of inflammatory factor disruption. The inflammatory response was triggered by increasing the amount of iron in the diet, which resulted in increased secretion of IL-2, IL-6, TGF-β1, and NF-κB and decreased secretion of IL-1β, IFN-γ, and TNF-α. Excessive iron leads to disturbance of the balance of inflammatory factors, causing tissue fibrosis to worsen.

Animals and Treatments

Sixteen healthy 8-month-old German Merino sheep (Institute of Animal Husbandry, Heilongjiang Academy of Agricultural Sciences, China) weighing around 40 kg were chosen for this experiment. The 16 sheep were randomly divided into four groups (n = 4) and 50 (CON), 500 (L-iron), 1000 (M-iron), and 1500 (H-iron) mg FeSO₄·H₂O/kg were added to the basal diet. All of the sheep in the study were euthanized after 75 days of storage, and kidney samples were collected. For the collected sheep kidney samples, A portion of the sheep kidney samples was fixed in neutral formalin and examined with H&E to see lesions, Perls staining to assess iron accumulation, and Masson staining to see tissue fibrosis. The rest is kept frozen at -80°C for future gene and protein assays. All animal experiments were carried out in accordance with the NEH Animal Care Agency and Institutional Committee rules for the protection and use of laboratory animals (SRM-11).

Pathological Examination

The fixed kidney was cut to 0.5×0.5×0.5 cm in size and embedded with embedding agent. sections were prepared using the paraffin sectioning method, and serial sections were taken for staining.

Hematoxylin-Eosin Staining

The following were the basic H&E staining procedures: xylene (2×5 min), 100% ethanol (2×1 min), 95% ethanol (1 min), 90% ethanol (1 min), 80% ethanol (1 min), 70% ethanol (1 min), distilled water (3 min), Hematoxylin (15 min), differentiation (to pink), anti-blue (wash with running water to blue-gray), 70% ethanol (10 s), 80% ethanol (20 s), 95% ethanol (2×30 s), 100% ethanol (2×1 min), xyleneⅠ (2×5 min), neutral gum sealing (overnight drying at 37 ℃), microscopic examination.

Perls Staining

Before staining, the perls dye solution was produced according to the instructions, the basic Perls staining methods were as follows: distilled water (2×10 min), Perls stain (20 min), distilled water (5 min), nuclear solid red (8 min), distilled water (5 s), 70% ethanol (5 s), 80% ethanol (20 s), 95% ethanol (2×40 s), 100% ethanol (2×3 minutes), xylene (2×4 minutes), neutral gum sealing (overnight drying at 37 ℃), microscopic examination.

Masson Staining

For the Masson Trichrome Stain Kit (Solid Green Method), the following steps were completed: Weigert iron hematoxylin (5 min), acid ethanol differentiation solution (3 s), masson bluing solution (3 s), distilled water (1 s), ponceau-magenta (5 min), weak acid working solution (1 min), phosphomolybdic acid (1 min), weak acid working solution (1 min), solid green dyeing solution (2 min), weak acid working solution (1 min), 95% ethanol (3×7 s), xylene (3×1 min), microscopic examination.

Protein content detection

Determination of NF-κB and TGF-β1 Protein Levels by Western Blotting

In order to obtain the supernatant, 0.05 g of sheep kidney tissue was collected, lysed in 500 µL of Radio-immunoprecipitation Assay (RIPA) buffer with protease inhibitor cocktail, pulverized for 60 seconds in a tissue homogenizer, and centrifuged at 12,000 rpm for 10 minutes at 4°C. Whole-tissue protein extracts were separated on sodium dodecyl sulfate (SDS)-10% polyacrylamide gels after being quantified using the bicinchoninic acid (BCA) assay, and the proteins were transferred to the nitrocellulose filter (NC) membrane. The membrane was blocked with 5% bovine serum albumin (BSA)/Tris Buffered Saline Tween (TBST) buffer for one hour at room temperature, hybridized with primary antibody overnight at 4°C, incubated with the corresponding horseradish peroxidase (HRP)-conjugated secondary antibody, and then exposed with ECL efficient chemiluminescent reagent and placed in the exposure instrument for exposure. Each western blot depicted is representative of three independent experiments.

Determination of IL-1β, IL-2, IL-6, TNF-α and IFN-γ Protein Levels by ELISA

The samples were extracted with diluent (PBS PH = 7.4) at a weight-to-volume ratio (1 g: 9 ml) of 0.050 g. Using low-temperature grinding and centrifugation, the supernatant was removed. Sheep kidney tissues were collected for ELISA assay using IL-1β, IL-2, IL-6, TNF-α, and IFN-γ ELISA kits, as directed by the manufacturer (R&D Systems, Minneapolis, MN, USA). A spectrophotometer was used to access the specific binding optical density at 450 nm right away.

Expression of Inflammatory Factors mRNA by qRT-PCR

Total RNA from sheep kidneys was extracted using trizol, and cDNA was generated from 1 µg of RNA using the iscript cDNA synthesis kit (Bio-Rad, USA), with absorbance at 260/280 nm for mRNA purity at a ratio greater than 1.8 achieved for all samples used. The samples were amplified in 96-well plates, and qRT-PCR was done with a 20 µL reaction system on a Roche LightCycler 480 II System (Roche, Switzerland). The following were the primer sequences :

Table 1

Sequences of the primers used for qRT-PCR.
Genes	GenBank number	Primer Sequences(5’-3’)	Product length (bp)
β-actin	U39357.2	F:AGATGTGGATCAGCAAGCAG	135
β-actin	U39357.2	R:CCAATCTCATCTCGTTTTCTG	135
IL-1β	NM_001009808.1	F:GGAGAATGTGGTGATGGTGACAGC	103
IL-1β	NM_001009808.1	R:ATTGGCAATGGCTTCCAGGTCATC	103
IL-2	NM_001009806.1	F:GCACTAACTCTTGCACTCGTTGC	148
IL-2	NM_001009806.1	R:GCATCCTGGAGAGCTTGAGGTTC	148
IL-6	NM_001009392.1	F:ACACTGACATGCTGGAGAAGATGC	132
IL-6	NM_001009392.1	R:GCCGCAGCTACTTCATCCGAATAG	132
TNF-α	DQ153000.1	F:CTGGTGCCTCAGCCTCTTCT	104
TNF-α	DQ153000.1	R:GGGACTGCTCTTCCCTCTGG	104
IFN-γ	NM_001009803.1	F:AAGTTCTTGAACGGCAGCTCTGAG	130
IFN-γ	NM_001009803.1	R:TTGGCGACAGGTCATTCATCACC	130
NF-κB	XM_015100238.2	F:TCGAGGTTCGGTTCTACGAGGATG	145
NF-κB	XM_015100238.2	R:AACACGGTTACAGGACGCTCAATC	145
TGF-β1	NM_001009400.2	F:ACTACTACGCCAAGGAGGTCACC	140
TGF-β1	NM_001009400.2	R:CACAGGTTCAGGCACTGCTTCC	140
95°C for 2 minutes, 46 cycles of 95°C for 10 seconds, annealing at 58.7°C for 30 seconds, and extension 72°C for 15 seconds were used in the qRT-PCR amplification method. During the annealing extension, fluorescent signals were detected. As an internal reference control, β-actin was used. The relative levels of mRNA expression for each gene were normalized by glyceraldehyde-3-phosphate determined by Ct values and assessed using the relative quantification-cation (2^−ΔΔCT method). All of the experiments were carried out in triplicate.

Statistical Analysis

The mean ± standard deviation (SD) of at least three independent experiments were used to calculated the results. GraphPad Prism 6 Demo was used to examine the statistical significance of the differences with the Student's Two-way ANOVA. P < 0.05 was considered statistically significant (* or P < 0.05 indicates a significant difference; ** or P < 0.01 indicates an extremely significant difference; P > 0.05 indicates no difference).

Histological Observation of Kidney Pathology after Excessive Iron in Sheep

Under a 100× magnification microscope. The tubular interstitial space was widened and more loosely arranged in the excessive iron group after H&E staining; under high magnification, localized tubular lesions of M-iron and H-iron were found, and tubular epithelial cells were excreted and necrotic, and the tubular interstitial space was accompanied by fibrin exudation and a small amount of inflammatory cell infiltration (Fig. 1). After Perls staining, no dispersion of iron-containing hemoglobin was found. The structural integrity of the glomeruli and tubules was observed in the control group following Masson staining, without significant collagen fibril hyperplasia. Glomerular pyknosis was observed in the excessive iron group, along with an iron dose-dependent increase in collagen fibril area. The glomerular basal membrane wrinkled, tubular collagen fibers exuded, and the lumen narrowed. Fibrous necrosis of the small artery walls of the entrance glomerulus (Fig. 2).

Changes of Protein Expression in Kidney of Excessive Iron-Fed Sheep

As shown in Table 2, the protein content of kidney IL-1β, TNF-α, and IFN-γ decreased with increased iron addition in excessive iron sheep, and IL-1β was extreme significantly lower in the M-iron and H-iron groups than in the control group (p < 0.01), TNF-α and IFN-γ were significantly lower than in the control group (p < 0.05) (Fig. 3).

With increasing iron addition, the protein contents of IL-2, IL-6, NF-κB, and TGF-β1 in sheep’s kidneys increased (Table 2, Table 3). IL-2, IL-6, NF-κB, and TGF-β1 were significantly or extreme significantly higher in the M-iron and H-iron groups than in the control group (p < 0.05 or p < 0.01); IL-6 and NF-κB were significantly or extreme significantly higher in the L-iron group than in the control group (p < 0.05 or p < 0.01); IL-2 and TGF-β1 were not significantly different in the L-iron group compared to the control group (p > 0.05) (Fig. 3, Fig. 4).

Table 2

Effect of excessive iron on the kidney IL-1β, TNF-α, IFN-γ, IL-2 and IL-6 protein contents in sheep(µmol/L).
Item	CON	L-iron	M-iron	H-iron
IL-1β	241.13 ± 31.325	222.62 ± 7.943	162.59 ± 4.956**	79.70 ± 8.980**
TNF-α	361.51 ± 12.424	331.76 ± 19.224	310.19 ± 11.895*	292.94 ± 30.677*
IFN-γ	460.04 ± 13.647	456.16 ± 0.172	392.45 ± 7.799*	366.97 ± 28.799*
IL-2	209.52 ± 4.099	231.95 ± 17.050	271.81 ± 4.016*	277.05 ± 20.418**
IL-6	1087.53 ± 11.601	1244.64 ± 98.899*	1271.78 ± 83.336*	1321.60 ± 73.163*

Compared with the control group, the values with asterisk significantly difference (* or p < 0.05), extreme significantly difference (** or p < 0.01), and no significantly (p > 0.05). Data is expressed as mean ± SD. Same as blow.

Table 3

Effect of excessive iron on the kidney NF-κB and TGF-β1 protein contents in sheep (Gray value ratio)
Item	CON	L-iron	M-iron	H-iron
NF-κB	0.86 ± 0.032	1.19 ± 0.027**	1.42 ± 0.021**	1.56 ± 0.045**
TGF-β1	0.94 ± 0.015	0.96 ± 0.006	1.02 ± 0.006*	1.10 ± 0.036**

Changes of Inflammatory Factor mRNA Expression in Kidney of Excessive Iron-Fed Sheep

As shown in Table 4, the expression of IL-1β, TNF-α, and IFN-γ mRNAs, which are related inflammatory factors, decreased in sheep kidneys as iron addition increased. The expression of IL-1β and IFN-γ was significantly lower in each excessive iron group than in the control group (p < 0.01), TNF-α was significantly lower in the M-iron and H-iron groups (p < 0.01), IL-1β, TNF-α, and IFN-γ were significantly or extreme significantly lower in the H-iron group than in the L-iron and M-iron groups (p < 0.05 or p < 0.01)(Fig. 5).

With the addition of iron, the expression of IL-2, IL-6, NF-κB, and TGF-β1 mRNA increased. IL-2, IL-6, NF-κB, and TGF-β1 were significantly or extreme significantly higher in each excess iron group than in the control group (p < 0.05 or p < 0.01). Except for the IL-2 M-iron and H-iron groups, which were not significantly different, the H-iron group was significantly or extreme significantly higher than the L-iron and M-iron groups (p < 0.05 or p < 0.01) (Fig. 5).

Table 4

Effect of excessive iron on the kidney IL-1β, TNF-α, IFN-γ, IL-2, IL-6, NF-κB, and TGF-β1 mRNA expression in sheep
Item	CON	L-iron	M-iron	H-iron
IL-1β	1.00 ± 0.000	0.84 ± 0.017**	0.82 ± 0.017**	0.40 ± 0.004**
TNF-α	1.00 ± 0.000	0.96 ± 0.018	0.54 ± 0.031**	0.15 ± 0.027**
IFN-γ	1.00 ± 0.000	0.48 ± 0.006**	0.39 ± 0.028**	0.28 ± 0.020**
IL-2	1.00 ± 0.000	4.36 ± 0.434*	9.78 ± 0.279**	12.86 ± 0.575**
IL-6	1.00 ± 0.000	3.238 ± 0.464*	3.784 ± 0.225*	5.50 ± 0.166**
NF-κB	1.00 ± 0.000	3.85 ± 0.336*	4.10 ± 0.479**	7.05 ± 0.154**
TGF-β1	1.00 ± 0.000	5.01 ± 0.585**	8.63 ± 0.143**	13.78 ± 0.598**

The body cannot produce iron spontaneously and has to come from external sources to maintain iron homeostasis [38]. The kidney is an important target organ for excess iron, and high amounts of iron in the renal tubules can cause acute kidney injury [38, 39]. As a foundation for illness prevention and control, it is critical to investigate the detrimental effects of too much iron in the body. In this study, in vivo trials were carried out on sheep's kidney. H&E staining and Perls staining were used to observe histopathological alterations with iron-containing haematoxylin distribution, as well as masson staining for the observation of fibrosis. WB and ELISA were used to determine inflammatory factors protein expression levels, and qRT-PCR was used to confirm the results at the genetic level.

H&E pathology revealed that increased iron intake caused pathological changes in sheep kidneys such as glomerular envelope atrophy, inflammatory cell infiltration, and cytoplasmic vacuolisation. The glomeruli basal membranes were thickened in the L-iron group, and there was a small amount of inflammatory interstitial infiltration of the cells. The glomeruli in the M-iron group were solid as well as sclerotic and shrunken. The tubules in the H-iron group were vacuolated, granular, and degenerated, with interstitial fibrosis visible. This shows that excessive iron in the body creates pathological alterations in the kidney, affecting its physiological function. It also shows tubular epithelial cell lesions, glomerular and interstitial vascular congestion, turbid degeneration of the distal tubules and collector ducts, luminal constriction, and inflammatory cell infiltration [40], which are all symptoms of fibrosis. In previous studies, an iron chelator was utilized to reduce cellular damage induced by high iron in renal proximal tubular epithelial culture cells [41]. Furthermore, kidney iron levels have increased dramatically in an established model of kidney injury due to excess protein [42]. It is hypothesized that ferrous iron affects the kidney, and that limiting iron intake reduces ferrous iron accumulation in the kidney and reduces renal tubular interstitial damage, which is mostly caused by iron-related protein metabolism abnormalities. As a result, the damage to the kidney caused by excess iron in this experiment could be attributable to disruptions in the metabolism of iron-associated proteins rather than being directly caused by iron, as further confirmed by the lack of significant iron-containing hemoglobin deposits visible on Perls-stained kidneys. Excessive iron also resulted in considerable collagen deposition and severe fibrosis symptoms in the kidney, which matched the findings of previous studies in the liver by Shendge AK’s team [43]. The glomerular was wrinkled, tubular collagen fibers were exuded, and the lumen was narrowed, the fibrous necrosis of the walls of the small arteries of the entrance glomerulus in our experiment, confirming that excessive iron is a direct factor in tissue fibrosis.

Besides histopathological observation of excessive iron induced kidney fibrosis, we also verified the presence of reaction to inflammatory factors through the expression of inflammatory factors and changes in protein content in this study. Previous studies have shown that inflammatory factors such as interleukins (ILs) [44], IFN, and TNF [45] can mutually induce and enhance their effects, and that this mutual regulation mechanism is closely related to immunity and inflammation. TNF-α and IL-1β can activate the NF-κB pathway during inflammation [46], and activated NF-κB can up-regulate IL-6 expression [47]. TGF-β1 is a significant pro-fibrotic cytokine [48], therefore it could be a target for anti-fibrotic treatment. In these studies, in vivo experiments were used to assess the development of the inflammatory response in the sheep kidney to verify the extent of inflammatory factor disruption, the amounts of IL-1β, TNF-α, IFN-γ, IL-2, and IL-6 proteins were assessed using the WB method in separate groups, and ELISA was used to determine changes in TGF-1 and NF-κB protein levels. The inflammatory response was initiated by increasing the amount of iron in the diet, which resulted in a boost in IL-2, IL-6, TGF-β1, and NF-κB protein secretion as well as a decrease in IL-1β, IFN-γ and TNF-α. Inflammatory factors are disturbed as a result of this process, worsening the inflammatory response and fibrosis symptoms. Changes in gene levels were evaluated using qRT-PCR to further validate this conclusion, and the results were consistent with the trend in protein levels.

In conclusion, excessive iron promotes an inflammatory response in a sheep’s kidney, resulting in kidney fibrosis. The molecular network involved in this study reveals a novel picture of kidney inflammation in sheep that may be caused by excessive iron, revealing new information about the mechanisms and treatment of kidney fibrosis.

Author Contribution Xue-li Gao and Fengjiao Sun conceived and designed the experiments. Fengjiao Sun wrote the main manuscript test. Yuzhi An and Liangyu Zhang finished all the figures. Chaonan Liu and Xiaoping Lv did all the tables of the result. Xue-li Gao responsed for the whole manuscript checking. All authors reviewed the manuscript.

Funding This project was supported by the Natural Science Foundation of China (Grant No. 31372355).

Data Availability The data of this study will be made available on reasonable request.

Code Availability Not applicable.

Ethics Approval and Consent to Participate All the animal experiments involved in this paper have been approved by the Animal Research Ethics Committee of Northeast Agricultural University.

Conflict of Interest The authors declare no competing interests.

Acknowledgments We thank the members of the Pathophysiology Laboratory at the College of Veterinary Medicine, Northeast Agricultural University, and we also appreciate Dr. Haixia Sun from the Northeast Institute of Geography and Agricultural Ecology, Chinese Academy of Sciences.

Camaschella C, Nai A, Silvestri L (2020) Iron metabolism and iron disorders revisited in the hepcidin era. Haematologica 105(2):260–272. https://doi.org/10.3324/haematol.2019.232124
Dev S, Babitt JL (2017) Overview of iron metabolism in health and disease. Hemodialysis International 21:S6-S20. https://doi.org/10.1111/hdi.12542
Dziegala M, Josiak K, Kasztura M, Kobak K, von Haehling S, Banasiak W, Anker SD, Ponikowski P, Jankowska E (2018) Iron deficiency as energetic insult to skeletal muscle in chronic diseases. Journal of cachexia, sarcopenia and muscle 9(5):802–815. https://doi.org/10.1002/jcsm.12314
Brissot P, Troadec M-B, Loréal O, Brissot E (2019) Pathophysiology and classification of iron overload diseases; update 2018. Transfusion Clinique et Biologique 26(1):80–88. https://doi.org/10.1016/j.tracli.2018.08.006
Nakamura T, Naguro I, Ichijo H (2019) Iron homeostasis and iron-regulated ROS in cell death, senescence and human diseases. Biochimica et Biophysica Acta (BBA)-General Subjects 1863(9):1398–1409. https://doi.org/10.1016/j.bbagen.2019.06.010
Zhang LY, Lu L, Zhang LY, Luo XG (2016) The chemical characteristics of organic iron sources and their relative bioavailabilities for broilers fed a conventional corn-soybean meal diet. J Anim Sci 94(6):2378–2396. https://doi.org/10.2527/jas.2016-0297
Council NR. (1985) Nutrient requirements of sheep. Nutrient Requirements of Domestic Animals: National Academies Press. 201–225.
Council NR. (2006) Mineral tolerance of animals: 2005. National Research Council: National Academies Press. 155–168.
Acharya V, Olivero J (2018) The kidney as an endocrine organ. Methodist DeBakey Cardiovascular Journal 14(4):305. https://doi.org/10.14797/mdcj-14-4-305
Thévenod F, Wolff NA (2016) Iron transport in the kidney: implications for physiology and cadmium nephrotoxicity. Metallomics 8(1):17–42. https://doi.org/10.1039/c5mt00215j
Smith CP, Thévenod F (2009) Iron transport and the kidney. Biochimica et Biophysica Acta (BBA)-General Subjects 1790(7):724–730. https://doi.org/10.1016/j.bbagen.2008.10.010
Jiang B, Liu G, Zheng J, Chen M, Maimaitiming Z, Chen M, Liu S, Jiang R, Fuqua BK, Dunaief JL (2016) Hephaestin and ceruloplasmin facilitate iron metabolism in the mouse kidney. Scientific Reports 6(1):1–11. https://doi.org/10.1038/srep39470
van Swelm RP, Beurskens S, Dijkman H, Wiegerinck ET, Roelofs R, Thévenod F, van der Vlag J, Wetzels JF, Swinkels DW, Smeets B (2022) Kidney tubule iron loading in experimental focal segmental glomerulosclerosis. Scientific Reports 12(1):1–12. https://doi.org/10.1038/s41598-022-05261-4
Sousa L, Oliveira MM, Pessôa MTC, Barbosa LA (2020) Iron overload: Effects on cellular biochemistry. Clinica Chimica Acta 504:180–189. https://doi.org/10.1016/j.cca.2019.11.029
Xiao X, Yeoh BS, Vijay-Kumar M (2017) Lipocalin 2: an emerging player in iron homeostasis and inflammation. Annual review of nutrition 37:103–130. https://doi.org/10.1146/annurev-nutr-071816-064559
Nguyen-Lefebvre AT, Ajith A, Portik-Dobos V, Horuzsko DD, Arbab AS, Dzutsev A, Sadek R, Trinchieri G, Horuzsko A (2018) The innate immune receptor TREM-1 promotes liver injury and fibrosis. The Journal of clinical investigation 128(11):4870–4883. https://doi.org/10.1172/JCI98156
Mehta KJ, Farnaud SJ, Sharp PA (2019) Iron and liver fibrosis: Mechanistic and clinical aspects. World journal of gastroenterology 25(5):521. https://doi.org/10.3748/wjg.v25.i5.521
Girelli D, Marchi G, Busti F, Vianello A (2021) Iron metabolism in infections: Focus on COVID-19. Seminars in hematology 58(3):182–187. https://doi.org/10.1053/j.seminhematol.2021.07.001
Mack M (2018) Inflammation and fibrosis. Matrix Biology 68:106–121. https://doi.org/10.1016/j.matbio.2017.11.010
Liu W, Wang L, Lai Y (2019) Hepcidin protects pulmonary artery hypertension in rats by activating NF-κB/TNF-α pathway. Eur Rev Med Pharmacol Sci 23(17):7573–7581. https://doi.org/10.26355/eurrev_201909_18878
Dzikaite V, Holmström P, Stål P, Eckes K, Hagen K, Eggertsen G, Gåfvels M, Melefors Ö, Hultcrantz R (2006) Regulatory effects of tumor necrosis factor-alpha and interleukin-6 on HAMP expression in iron loaded rat hepatocytes. Journal of hepatology 44(3):544–551. https://doi.org/10.1016/j.jhep.2005.07.028
Yuan Q, Zhang Z, Hu X, Liao J, Kuang J (2019) miR-374a/Myc axis modulates iron overload-induced production of ROS and the activation of hepatic stellate cells via TGF-β1 and IL-6. Biochemical and biophysical research communications 515(3):499–504. https://doi.org/10.1016/j.bbrc.2019.05.152
Kanamori Y, Murakami M, Sugiyama M, Hashimoto O, Matsui T, Funaba M (2019) Hepcidin and IL-1β. Vitamins and hormones 110:143–156. https://doi.org/10.1016/bs.vh.2019.01.007
Ding Z, Dai C, Shan W, Liu R, Lu W, Gao W, Zhang H, Huang W, Guan J, Yin Z (2021) TNF-α up-regulates Nanog by activating NF-κB pathway to induce primary rat spinal cord astrocytes dedifferentiation. Life Sciences 287:120126. https://doi.org/10.1016/j.lfs.2021.120126
Alvarado-Díaz CP, Núñez MT, Devoto L, González-Ramos R (2015) Iron overload–modulated nuclear factor kappa-B activation in human endometrial stromal cells as a mechanism postulated in endometriosis pathogenesis. Fertility and sterility 103(2):439–447. https://doi.org/10.1016/j.fertnstert.2014.10.046
Lee S-B, Lee WS, Shin J-S, Jang DS, Lee KT (2017) Xanthotoxin suppresses LPS-induced expression of iNOS, COX-2, TNF-α, and IL-6 via AP-1, NF-κB, and JAK-STAT inactivation in RAW 264.7 macrophages. International immunopharmacology 49:21–29. https://doi.org/10.1016/j.intimp.2017.05.021
Banerjee A, Mifsud NA, Bird R, Forsyth C, Szer J, Tam C, Kellner S, Grigg A, Motum P, Bentley M (2015) The oral iron chelator deferasirox inhibits NF-κB mediated gene expression without impacting on proximal activation: implications for myelodysplasia and aplastic anaemia. British Journal of Haematology 168(4):576–582. https://doi.org/10.1111/bjh.13151
Zhang F, Mears JR, Shakib L, Beynor JI, Shanaj S, Korsunsky I, Nathan A, Donlin LT, Raychaudhuri S (2021) IFN-γ and TNF-α drive a CXCL10 + CCL2 + macrophage phenotype expanded in severe COVID-19 lungs and inflammatory diseases with tissue inflammation. Genome medicine 13(1):1–17. https://doi.org/10.1101/2020.08.05.238360
Nathan C, Ding A (2010) Nonresolving inflammation. Cell 140(6):871–882. https://doi.org/10.1016/j.cell.2010.02.029
Amir M, Czaja MJ (2018) INFLAMMASOME-MEDIATED INFLAMMATION AND FIBROSIS–IT IS MORE THAN JUST THE IL-1β. Hepatology (Baltimore, Md) 67(2):479. https://doi.org/10.1002/hep.29491
Zhang L-L, Huang S, Ma X-X, Zhang W-Y, Wang D, Jin S-Y, Zhang Y-P, Li Y, Li X (2016) Angiotensin (1–7) attenuated Angiotensin II-induced hepatocyte EMT by inhibiting NOX-derived H2O2-activated NLRP3 inflammasome/IL-1β/Smad circuit. Free Radical Biology and Medicine 97:531–543. https://doi.org/10.1016/j.freeradbiomed.2016.07.014
Otto G (2018) IL-1β switches on kidney fibrosis. Nature Reviews Nephrology 14(8):475–475. https://doi.org/10.1038/s41581-018-0026-2
Li R, Guo Y, Zhang Y, Zhang X, Zhu L, Yan T (2019) Salidroside ameliorates renal interstitial fibrosis by inhibiting the TLR4/NF-κB and MAPK signaling pathways. International journal of molecular sciences 20(5):1103. https://doi.org/10.3390/ijms20051103
Li Q, Liu BC, Lv LL, Ma KL, Zhang XL, Phillips AO (2011) Monocytes induce proximal tubular epithelial–mesenchymal transition through NF-kappa B dependent upregulation of ICAM‐1. Journal of cellular biochemistry 112(6):1585–1592. https://doi.org/10.1002/jcb.23074
Pellicoro A, Ramachandran P, Iredale JP, Fallowfield JA (2014) Liver fibrosis and repair: immune regulation of wound healing in a solid organ. Nature Reviews Immunology 14(3):181–194. https://doi.org/10.1038/nri3623
Tang PC-T, Chan AS-W, Zhang C-B, García Córdoba CA, Zhang Y-Y, To K-F, Leung K-T, Lan H-Y, Tang PM-K (2021) TGF-β1 signaling: immune dynamics of chronic kidney diseases. Frontiers in Medicine:106. https://doi.org/10.3389/fmed.2021.628519
Wang W, Wang X, Chun J, Vilaysane A, Clark S, French G, Bracey NA, Trpkov K, Bonni S, Duff HJ (2013) Inflammasome-independent NLRP3 augments TGF-β signaling in kidney epithelium. The Journal of Immunology 190(3):1239–1249. https://doi.org/10.4049/jimmunol.1201959
Scindia Y, Leeds J, Swaminathan S (2019) Iron homeostasis in healthy kidney and its role in acute kidney injury. Seminars in Nephrology 39(1):76–84. https://doi.org/10.1016/j.semnephrol.2018.10.006
Martines A, Masereeuw R, Tjalsma H, Hoenderop J, Wetzels J, Swinkels D (2013) Iron metabolism in the pathogenesis of iron-induced kidney injury. Nature Reviews Nephrology 9(7):385–398. https://doi.org/10.1038/nrneph.2013.98
Wedeen RP, Qian L (1991) Chromium-induced kidney disease. Environmental health perspectives 92:71–74. https://doi.org/10.1289/ehp.92-1519395
Sharma S, Leaf DE (2019) Iron chelation as a potential therapeutic strategy for AKI prevention. Journal of the American Society of Nephrology 30(11):2060–2071. https://doi.org/10.1681/ASN.2019060595
Ikeda Y, Horinouchi Y, Hamano H, Hirayama T, Kishi S, Izawa-Ishizawa Y, Imanishi M, Zamami Y, Takechi K, Miyamoto L (2017) Dietary iron restriction alleviates renal tubulointerstitial injury induced by protein overload in mice. Scientific reports 7(1):1–10. https://doi.org/10.1038/s41598-017-11089-0
Shendge AK, Panja S, Basu T, Ghate NB, Mandal N (2021) Ameliorating effects of white mulberry on iron-overload-induced oxidative stress and liver fibrosis in Swiss albino mice. Food and Chemical Toxicology 156:112520. https://doi.org/10.1016/j.fct.2021.112520
(!!! INVALID CITATION !!! {Saleem, 2021 #97}).
Woznicki JA, Saini N, Flood P, Rajaram S, Lee CM, Stamou P, Skowyra A, Bustamante-Garrido M, Regazzoni K, Crawford N (2021) TNF-α synergises with IFN-γ to induce caspase-8-JAK1/2-STAT1-dependent death of intestinal epithelial cells. Cell death & disease 12(10):1–15. https://doi.org/10.1038/s41419-021-04151-3
Chen L, Deng H, Cui H, Fang J, Zuo Z, Deng J, Li Y, Wang X, Zhao L (2018) Inflammatory responses and inflammation-associated diseases in organs. Oncotarget 9(6):7204. https://doi.org/10.18632/oncotarget.23208
Lee J, Nakagiri T, Oto T, Harada M, Morii E, Shintani Y, Inoue M, Iwakura Y, Miyoshi S, Okumura M (2012) IL-6 amplifier, NF-κB–triggered positive feedback for IL-6 signaling, in grafts is involved in allogeneic rejection responses. The Journal of Immunology 189(4):1928–1936. https://doi.org/10.4049/jimmunol.1103613
Lv W, Booz GW, Wang Y, Fan F, Roman RJ (2018) Inflammation and renal fibrosis: recent developments on key signaling molecules as potential therapeutic targets. European journal of pharmacology 820:65–76. https://doi.org/10.1016/j.ejphar.2017.12.016

No competing interests reported.

Download PDF

Version 1

posted

You are reading this latest preprint version

Excessive iron in diets promotes kidney fibrosis via disordering the inflammation factors in Sheep

Status:

Version 1

Abstract

Figures

Introduction

Material And Methods

Animals and Treatments

Pathological Examination

Hematoxylin-Eosin Staining

Perls Staining

Masson Staining

Protein content detection

Determination of NF-κB and TGF-β1 Protein Levels by Western Blotting

Determination of IL-1β, IL-2, IL-6, TNF-α and IFN-γ Protein Levels by ELISA

Expression of Inflammatory Factors mRNA by qRT-PCR

Statistical Analysis

Results

Histological Observation of Kidney Pathology after Excessive Iron in Sheep

Changes of Protein Expression in Kidney of Excessive Iron-Fed Sheep

Changes of Inflammatory Factor mRNA Expression in Kidney of Excessive Iron-Fed Sheep

Discussion

Declarations

References

Additional Declarations

Status:

Version 1