Effects of cold stress on hormone contents, immune responses and HSL and UCP1 expression in the fat tissue of Altay and Hu lambs

doi:10.21203/rs.3.rs-1653012/v1

Download PDF

Research Article

Effects of cold stress on hormone contents, immune responses and HSL and UCP1 expression in the fat tissue of Altay and Hu lambs

https://doi.org/10.21203/rs.3.rs-1653012/v1

This work is licensed under a CC BY 4.0 License

Version 1

posted

You are reading this latest preprint version

The aim of the present study was to explore the effects of cold stress at different levels on hormone contents, immune function, and heat-producing genes expression in Altay and Hu lambs. The lambs were randomly divided into three experimental groups maintained under different temperature conditions (G2: -20±3℃ and G3: -30±3℃) for acute cold stress (6 h, 24 h) and chronic cold stress (4 d, 12 d, 24 d) and one thermoneutral group was maintained at the control temperature (G1:15±2℃). The levels of leptin in the serum of two breeds was lower in the cold stress group than in G1 (P<0.01), and the norepinephrine levels was higher in the cold stress groups than in the thermoneutral group (P<0.01). The levels of epinephrine in the serum of Altay and Hu lambs dynamically fluctuated in the G2 and G3. The glucagon levels of the Hu lambs were significantly higher in G2 and G3 than in G1 (P<0.01). The glucagon levels of Altay lambs were significantly decreased in G2 compared with G1 (P<0.01). The insulin levels in the serum of the Altay lambs were significantly lower in the stress group than in G1 (P<0.01). The insulin levels in the serum of Hu lambs tended to irregularly fluctuation in the experimental groups compared with the G1. Histopathological examination showed that the intestinal tissues of the cold stress group were seriously injured. The mRNA expression levels of IL-2, IL-4, IL-10, IL-12 and IFN-β in the spleen varied at different time periods after cold stress, but were overall higher in the cold stress group than in G1 (P<0.01). After cold stimulation, the expression of uncoupling protein 1 and hormone-sensitive lipase in fat tissues showed dynamic changes, but were increased significantly compared with control group (P<0.01). These results suggested that cold stress induced the endocrine system and influenced the immune function of the spleen. The increased expression of HSL and UCP1 may play a role in energy metabolism in the response of animals to cold stress. This work add an important data for the studding the ability of animal to adapt with the colder regions.

Cold stress

hormone contents

immunity

energy metabolism

lamb

Animals face various climatic stresses (cold, heat, and wind), overcrowding, nutritional deprivation, and infectious diseases every day, and cold stress, as a type of stress, commonly exists in the cold region. Changes to the metabolism of several organ system, deposition of fat, disruption of energy balance, and immune system is crucial for the survival of animals in stressful environments, such as the attack of pathogens and low ambient temperature (Demas and Nelson 1996; Nelson 2004). Therefore, it is important to learn how stressors affect the immune system and the adaptive response capacity food animals.

Activation of hypothalamic-pituitary-adrenal axis is important for maintenance of homeostasis during stress. Many researchers have investigated stress hormones such as increased corticosterone, which often have a suppressive effect on immunity (Bligh-Tynan et al.1993; Sapolsky et al. 2000; Demas and Nelson 1998; Webster and Glaser 2008). Catecholamines mainly contain epinephrine (E) and norepinephrine (NE), which play an important role in controlling energy metabolism and transportation of animals (Lafontan and Berlan 1993). Leptin (LEP) is a cytokine-like hormone and is mainly produced by white adipose tissues, which can regulate immune responses and energy balance by endocrine pathways (Kelesidis et al. 2010; Lee and Song 2017). Moreover, it is important to elucidate the changes of immune responses in small mammals during cold stress. Cytokines are secreted by activated immune cells, stromal cells and some tumor cells and play an important role in bidirectional communication between the neuroendocrine and immune systems (Feltan et al. 1998). Several studies have reported that cold stress has important effects on immunoglobulin and cytokine levels in the small intestine or trachea of broilers (Zhao et al. 2014; Su et al. 2018).

Cold exposure induces a substantial increase in energy expenditure by shivering and nonshivering thermogenesis in rodents (Jansky 1973; Fernandez et al. 1994), which occurs through lipolysis stimulation in both brown and white fat through the activation of the sympathetic system (Landsberg and Young 1984; Garofalo et al. 1996). Hormone-sensitive lipase (HSL) catalyzes the hydrolysis of triglycerides (TGs) stored in adipose tissue. HSL is a major regulator of plasma free fatty acid (FFA) concentrations. Uncoupling protein 1 (UCP-1) is a key mitochondrial proton carrier, which could dissipate the transmembrane proton gradient to generate heat (Rousset et al. 2004). It was reported that UCP-1 ablation in mice failed to result in an obesogenic phenotype under normal temperature, but animals became obese at thermoneutral temperatures (Feldmann et al. 2009).

In Northern of china, winter lasts for approximately 4 months from December to March. In recent years, winter temperature in Xinjiang of china has been getting colder. The impact of the duration of cold stress on immune function and energy metabolism in sheep is still unknown, which limits the research on protecting sheep from low-temperature injury, even when cultivating a cold-tolerant sheep breed. The native Altay sheep (Ovis aries) was originated by natural selection and is able to survive under adverse environmental conditions. Altay sheep is well known for its disease resistance, hardiness and survival under cold-stress conditions, and they have fleshly muscle and a large fat deposit in the tail. As a new introduced breed, Hu sheep is widely distributed in southern of China, and the cold resistance is relatively weak. Therefore, the present study explored the effect of cold stress on hormone levels and the intestinal histopathological changes in both Altay and Hu breeds. We also investigated the effects of acute and chronic cold exposure at two temperatures on the immune responses and heat-producing gene expression (HSL and UCP1) in the fat tissues of Altay and Hu breeds. This work add an important data for the studding the ability of animal to adapt with the colder regions, and how we can select the animals during the breeding in cold areas on the world.

All procedures used in the present experiment were approved by the Institutional Animal Care and Use Committee of Shihezi University (Shihezi, China). Ethical approval for the study has been obtained from the Animal Experimental Ethical Inspection of First Affiliated Hospital, Shihezi University School of Medicine (Approval Number A 2018-077-01)

2.1. Animals and management

Fifty-five healthy lambs from both breeds (Altay and Hu lambs, average body weight 600-800g, aged 6 or 7 months), obtained from a local commercial farm (HuaXing Sheep Co., Xinjiang, People’s Republic of China), were randomly distributed into 3 treatment groups. The sheep were housed at a constant temperature of 15 ± 3℃ (relative humidity = 50%, wind speed = 1.5m/s) with an artificial temperature control system for the thermoneutral group (G1) (n = 5/group). The experimental I groups (G2) were maintained under cold stress at -20 ± 3℃ (RH = 40%, WS = 1.5m/s) with artificial temperature control system for 6 h, 1 d, 4 d, 12 d, or 24 d (n = 5/group), and the experimental II groups (G3) were maintained under cold stress at -30 ± 3℃ (RH = 40%, WS = 1.5m/s) for 6 h, 1 d, 4 d, 12 d, or 24 d (n = 5/group). The temperature and humidity inside the isolation room were monitored daily and recording by a digital thermo-hygrometer (Xiamen Yudian Automation Technology Co., Fujian, China). The diet was a mixture of silage and alfalfa hay, and the animals were fed twice per day and drank water freely. The behavior of the animals was observed during the whole experimental period.

2.2. Sample collection and procedures

After stress termination 10 lambs in each time of the experiment period were anesthetized by intravenous infusion of 2.5% sodium pentobarbital (30mg/kg). The injection rate was 90mg/min. The lamb was unconscious, and was sacrificed by severing the carotid artery. The blood samples were collected from their hearts. To avoid circadian rhythm influences, blood was taken from the lambs between 08:00 am and 10:00 am on both treatment groups and control group. The white fat tissues from each sheep were collected, immediately frozen in liquid nitrogen and then stored at -80°C for RNA isolation and protein extraction. The intestine samples were collected immediately and placed in 10% neutral buffered formalin for fixation overnight.

2.2.1. Immunoassays

Blood samples were cooled with ice and centrifuged at 1,830g for 15 min. The serum levels of LEP, INS, GC, E and NE were measured by radioimmunoassay (RIA) with LEP, INS, GC, E and NE assay kits, respectively (Nanjing Jian Cheng Bioengineering Institute, Nanjing, China). Serum values were determined in a single RIA. The lower and upper limits of the LEP assay kit were 0.1 and 40 ng/ml, respectively. The lower and upper limits of the INS assay kit were 1 and 300 mIU/L, respectively. The lower and upper limits of the GC assay kit were 5 and 1500 ng/L, respectively. The lower and upper limits of the E assay kit were 20 and 6000 ng/L, respectively. The lower and upper limits of the NE assay kit were 0.05 and 10 ng/mL, respectively. All procedures were carried out according to the manufacturers’ instructions.

2.2.2 Histopathological examination

The intestine samples were embedded in paraffin wax. Then, 5 µm sections were cut. The sections were stained with hematoxylin and eosin and examined using an Olympus BX53 microscope. Prepared slides were soaked in modified toluidine blue (TB) dye solution (0.8% TB, 0.6% potassium permanganate and distilled water prepared by boiling) for 30 s. Slides were assessed using an Olympus microscope.

2.2.3 Total RNA isolation and reverse transcription

Total RNA was isolated from each of the organs (spleen, intramuscular fat of the longissimus muscle and chest fat) of each sheep using Trizol reagent according to the manufacturer’s instructions (Invitrogen). The reverse transcription reaction (40 µl) consisted of the following: 10 µg of total RNA, 1 µl of Moloney murine leukemia virus reverse transcriptase, 1 µl of RNase inhibitor, 4 µl of deoxynucleoside triphosphate, 2 µl of Oligo dT, 4 µl of dithiothreitol, and 8 µl of 5× reverse transcriptase buffer. The reverse transcription procedure was performed according to the manufacturer’s instructions (Invitrogen).

2.2.4 Real-time quantitative reverse transcription PCR

Real-time quantitative reverse transcription PCR was used to detect the expression of HSL and UCP1 in fat tissues, and the levels of IL-2, IL-4, IL-10, IL-12 and IFN-βin the spleen were analyzed using SYBR Premix Ex Taq (Takara, Shiga, Japan). Real-time PCR was performed on each sample from the organs. The primer information for all the genes is listed in Table 1. All of the gene primers were designed by using the sheep sequences from GenBank, and the primers were synthesized by Beijing Ruibo Xingke Gene Co., Ltd. qPCR was performed on a LightCycler® 96 Real-Time PCR System (Roche, Switzerland). Reactions were performed in a 20 µl reaction mixture containing 10 µl of 2×SYBR Green PCR Master Mix (Roche, Switzerland), 1 µl of diluted cDNA, 0.4 µl of each primer (10 µM), and 7.2 µl of PCR-grade water. The reaction sequence comprised initial denaturation at 95°C for 10 s, followed by 40 cycles of 95°C for 30 s, 58°C for 30 s and 72°C for 10 s. The melting curve analysis showed only one peak for each PCR product. Next, 1% agarose electrophoresis was performed with the PCR products to verify primer specificity and product purity. The amplification efficiency of each gene was determined by using the Light Cycler® 96 Real-Time PCR System. The relative abundance of messenger RNA (mRNA) was calculated according to the method of Pfaffl MW (Pfaffl MW 2001), accounting for gene-specific efficiencies, and was normalized to the mean expression of GAPDH. Each sample was measured in triplicate, and the average values were obtained.

Table 1

Sequences for real-time PCR primers
Gene	Primer sequence(5′-3′)	Product length(bp)	Annealing temperature(℃)	Accession nos
GAPDH	Forward: TCCGTTGTGGATCTGACCTG Reverse: CCCTGTTGCTGTAGCCGAAT	250	53	NM_001190390.1
HSL	Forward:AGCACTACAAACGCAACGA Reverse: CTGAATGATCCGCTCAAACT	116	54	DQ647325.1
UCP1	Forward:TCCGCTGTTGTTGCTGGATTCTG Reverse:CACTTGTGTACTGTCCTGGTGAAGAG	100	60	NM_001280694.1
IFN-β	Forward:GGAGATGAAGCAAGCACAGC Reverse: CGGTCGTGTCTCCCATAGTG	187	56	JX458084.1
IL2	Forward:GCACTAACTCTTGCACTCGTTGC Reverse:GCATCCTGGAGAGCTTGAGGTTC	148	57	NM_001009806
IL4	Forward:TGTACCAGCCACTTCGTCCA Reverse: AGATTCCTGTCAAGTCCGCC	202	56	NM_001009313.2
IL10	Forward:GGTGATGCCACAGGCTGAGAAC Reverse: GCTCCACCGCCTTGCTCTTG	143	58	NM_001009327.1
IL12	Forward:TCTCGGCAGGTGGAAGTCAGC Reverse: TTGGCATCCTTGTGGCATGTGAC	164	57	NM_001009438.1

2.2.5 Western blotting analysis

The intramuscular fat and chest fat protein were extracted using high-efficiency RIPA tissue lysate (Solarbio, China). Protein extracts were subjected to SDS-polyacrylamide gel electrophoresis under reducing conditions on 10% or 12% gels. Separated proteins were then transferred to polyvinylidene fluoride (PVDF) membranes (Bio-Rad, Veenendaal, The Netherlands) using a tank transfer for a specific time (HSL, 95 min; UCP1, 60 min) at 100 mA in Tris-glycine buffer containing 10% methanol. The membranes were blocked with 5% skim milk for 2 h at room temperature with gentle shaking and then incubated overnight with diluted primary rabbit antibody against HSL (1:1000, Cell Signaling Technology, USA) and UCP1 (1:1000, Abcam, USA) and polyclonal β-actin antibody (1:2000, Ambart, USA). Following extensive washing in phosphate buffered saline, the membranes were incubated with the (H + L) (DyLight™ 680 Conjugate) secondary anti-rabbit IgG (1:15000, Cell Signaling Technology, USA). The indicator was detected by Odyssey two-color infrared fluorescence imaging system (LI-COR, USA). The optical density of each band was digitally analyzed using Image studio version 4.0.

2.3. Statistical analyses

Statistical analysis of all data was performed by using SPSS for Windows (version 20.0, SPSS Inc., Chicago, IL). When a significant value (P < 0.05) was obtained by one-way ANOVA, further analysis was carried out. All data showed a normal distribution and passed equal variance testing. Data are expressed as the mean ± SD. Images was produced by GraphPad Prism 5 software.

3.1. Changes of the serum hormone activities

As shown in Table 2, the levels of E in the serum of Altay and Hu lambs under acute cold stress were significantly different from that of lambs under normal temperature. The E levels of Altay lambs at 24 h and Hu lambs at 6 h were significantly (P < 0.01) decreased in G2 compared with the corresponding G1. The levels of E at other time periods were significantly increased (P < 0.01). Under chronic cold stress, the E level of Altay lambs in G3 was higher than those in G1 (P < 0.01) and was decreased slightly at 24 d in G3 (P < 0.05). The E levels of Hu lambs in G2 were no significant differences at 6 h and 24 h (P > 0.05), then significantly increased at 12 d and 24 d (P < 0.01). However, the E level of Hu lambs in G3 was significantly increased (P < 0.01) and then decreased than those in G1 (P < 0.05).

As shown in Table 3, the NE levels of Altay lambs were significantly higher in G2 and G3 than in G1 (P < 0.01). The NE levels of Hu lambs remained similar in G2 compared with G1 at 6 h and 24 h (P > 0.05), and the NE levels in the other time periods were significantly increased (P < 0.01). The NE level in Hu lambs was significantly higher in G3 than that in G1 (P < 0.01) and was linearly decreased through 24 d (P < 0.05).

Data on GC levels were shown in Table 4. The GC levels of the Hu lambs were significantly higher in G2 and G3 than in G1 (P < 0.01). In the acute cold stress groups, the GC activities of serum in Altay lambs were significantly decreased (P < 0.01) and then increased (P < 0.05). Under chronic cold stress, the GC levels of Altay lambs were significantly decreased in G2 compared with G1, and was extremely significantly decreased at 12 d (P < 0.01). Some fluctuations in vitality appeared at different time periods.

The concentrations of INS in the serum of Altay lambs and Hu lambs were shown in Table 5. The INS levels in the serum of the Altay lambs were significantly lower in the stress group than in G1 (P < 0.01), and the INS level was only increased without significant differences at 24 h in G3 (P > 0.05). The INS levels in the serum of Hu lambs tended to irregularly fluctuation in the experimental groups compared with the normal group. Compared with the control condition, increasing cold stress time slightly decreased and then increased the serum INS level of Hu lambs (P < 0.01).

As shown in Table 6, under the acute and chronic cold stress LEP levels in Altay lambs were decreased in G2 and G3 compared with that of G1 (P < 0.05). The serum LEP levels of Altay lambs were inversely proportional to the cold stress temperature. The LEP levels of the Hu lambs were significantly reduced in G2 compared with that of G1 (P < 0.01), except that the LEP level of G2 was higher than that of G1 at 4 d (P < 0.05). The LEP levels of Hu lambs in G3 remained unaffected and then decreased (P < 0.01).

Table 2

Changes of Epinephrine levels in the serum of Altay lambs and Hu lambs
Cold stress time		Altay lambs (ng/mL)		Hu Lambs (ng/mL)
Cold stress time		-20 ± 3℃	-30 ± 3℃	-20 ± 3℃	-30 ± 3℃
	0h	1.76 ± 0.012		1.80 ± 0.027
acute	6h	2.16 ± 0.036^A	2.37 ± 0.00^A	1.61 ± 0.024^A	1.96 ± 0.018^A
	24h	0.96 ± 0.204^A	2.82 ± 0.112^A	1.98 ± 0.065^A	2.14 ± 0.031^A
chronic	4d	2.00 ± 0.036^a	2.04 ± 0.022^A	1.63 ± 0.018^A	1.82 ± 0.017
	12d	2.15 ± 0.006^A	1.78 ± 0.002	1.85 ± 0.016	1.76 ± 0.094
	24d	2.10 ± 0.006^A	1.53 ± 0.012^a	2.01 ± 0.028^A	1.71 ± 0.046^a
Note: The upper case indicates extremely significant (P < 0.01), the lower case indicates significant difference (0.01 < P < 0.05).

Table 3

Changes of Norepinephrine levels in the serum of Altay lambs and Hu lambs
Cold stress time		Altay lambs (ng/mL)		Hu Lambs (ng/mL)
Cold stress time		-20 ± 3℃	-30 ± 3℃	-20 ± 3℃	-30 ± 3℃
	0h	1.42 ± 0.038		1.79 ± 0.024
acute	6h	2.39 ± 0.027^A	1.91 ± 0.006^A	1.94 ± 0.022	2.01 ± 0.050^A
	24h	1.54 ± 0.003^A	1.95 ± 0.019^A	1.67 ± 0.041	2.21 ± 0.021^A
chronic	4d	1.84 ± 0.010^A	2.19 ± 0.007^A	2.05 ± 0.058^A	1.91 ± 0.024
	12d	1.83 ± 0.005^A	1.83 ± 0.010^A	2.11 ± 0.006^A	1.94 ± 0.042
	24d	1.92 ± 0.125^A	2.05 ± 0.014^A	2.08 ± 0.29^A	1.58 ± 0.048^a
Note: The upper case indicates extremely significant (P < 0.01), the lower case indicates significant difference (0.01 < P < 0.05).

Table 4

Changes of Glucagon levels in the serum of Altay lambs and Hu lambs
Cold stress time		Altay lambs (ng/L)		Hu Lambs (ng/L)
Cold stress time		-20 ± 3℃	-30 ± 3℃	-20 ± 3℃	-30 ± 3℃
	0h	527.43 ± 28.780		351.15 ± 63.121
acute	6h	364.56 ± 37.938^A	430.63 ± 39.00^A	649.75 ± 0.000^A	501.92 ± 5.233^A
	24h	554.58 ± 9.484	582.38 ± 11.00^a	607.56 ± 53.963^A	568.31 ± 40.227^A
chronic	4d	502.25 ± 5.560	531.031 ± 23.01	376.99 ± 2.616	577.80 ± 61.485^A
	12d	435.86 ± 20.931^A	351.15 ± 59.00^A	483.61 ± 44.479^A	561.77 ± 10.793^A
	24d	477.72 ± 2.616	574.53 ± 37.00	471.83 ± 41.208^A	585.32 ± 19.296^A
Note: The upper case indicates extremely significant (P < 0.01), the lower case indicates significant difference (0.01 < P < 0.05).

Table 5

Changes of Insulin levels in the serum of Altay lambs and Hu lambs
Cold stress time		Altay lambs (ng/L)		Hu Lambs (ng/L)
Cold stress time		-20 ± 3℃	-30 ± 3℃	-20 ± 3℃	-30 ± 3℃
	0h	144.68 ± 7.072		127.64 ± 4.565
acute	6h	107.39 ± 8.486^A	140.89 ± 0.450	146.99 ± 6.815^A	127.62 ± 1.929
	24h	126.74 ± 1.480^A	151.05 ± 0.451	112.54 ± 1.672^A	123.72 ± 6.815
chronic	4d	127.07 ± 5.272^A	129.57 ± 8.037^A	124.81 ± 4.307	134.33 ± 6.236^a
	12d	128.35 ± 1.672^A	125.33 ± 4.050^A	145.84 ± 5.529^A	135.36 ± 1.479^A
	24d	118.96 ± 6.943^A	137.99 ± 3.986	128.22 ± 2.700	136.58 ± 2.314^A
Note: The upper case indicates extremely significant (P < 0.01), the lower case indicates significant difference (0.01 < P < 0.05).

Table 6

Changes of Leptin levels in the serum of Altay lambs and Hu lambs
Cold stress time		Altay lambs (ng/mL)		Hu Lambs (ng/mL)
Cold stress time		-20 ± 3℃	-30 ± 3℃	-20 ± 3℃	-30 ± 3℃
	0h	12.98 ± 0.323		12.71 ± 0.305
acute	6h	12.61 ± 0.004^a	11.94 ± 0.265^A	12.15 ± 0.036^A	13.03 ± 0.045
	24h	12.61 ± 0.072^a	12.54 ± 0.058^A	12.00 ± 0.215^A	12.97 ± 0.108
chronic	4d	12.55 ± 0.341^a	11.15 ± 0.206^A	13.12 ± 0.108^a	12.79 ± 0.094
	12d	12.59 ± 0.040^a	12.03 ± 0.489^A	12.54 ± 0.081	12.18 ± 0.076^A
	24d	12.96 ± 0.103	11.77 ± 0.036^A	12.68 ± 0.027	12.35 ± 0.018^A
Note: The upper case indicates extremely significant (P < 0.01), the lower case indicates significant difference (0.01 < P < 0.05).

3.2. Histopathology

Histopathological changes were recorded in the small intestine tissues and are shown in Fig. 1. At 24 d, the intestinal morphology of G2 and G3 included lesions, such as damaged mucosal structure, intraluminal cell shedding, and serious inflammatory infiltration (Fig. 1B, C). Mucosal congestion and hemorrhage were observed and infiltrated with leukocytes in G2 and G3. There were no significant differences between Altay lambs and Hu lambs (Fig. 1D). G1 had normal intestine morphology, and the mucosal structure was intact (Fig. 1A). The distribution of intestinal mast cells stained with TB was similar in Hu lambs and Altay lambs. Mast cells were distributed in the mucous layer of each segment of the small intestine, as shown in Fig. 1E, F. The cytoplasm of mast cells was stained purplish red and appeared as purplish red granules. The cells were large in size; most cells were round or oval in shape, and some of them were irregular and even had protrusions. The number of mast cells in the small intestine of both lamb breeds was significantly increased in the cold stress group compared with G1.

3.3. mRNA expression of immune factors in the spleen of lambs

As shown in Figs. 2 and 3, in the G2 groups, the expression level of IL-2 mRNA in the spleen increased with time after cold stress (P < 0.01). The levels were extremely significantly higher under cold stress than under normal temperature at 24 h in Altay lambs and extremely significantly higher under cold stress than under normal temperature at 6 h in Hu lambs (P < 0.01). Compared with the corresponding control condition, chronic cold stress resulted in a significant increase in the mRNA levels of the IL-2 gene in Altay lamb spleen (P < 0.01). In the Hu lambs, IL-2 showed a ‘rise-decline’ expression pattern with the extension of cold stress time. In G3, cold stress significantly increased the mRNA levels of the IL-2 gene in the spleen of Altay lambs and reached the highest level (P < 0.01) at 24 d. In Hu lambs, IL-2 showed a ‘decline-rise-decline-rise’ expression pattern with increasing cold stress duration. The IL-2 mRNA expression level in Hu lambs was the highest at 4 d (P < 0.01).

As shown in Fig. 2 and Fig. 3, the mRNA levels of the IL-4 were increased in G2 (P < 0.01), and Hu lambs had higher expression levels than did Altay lambs. The expression of IL-4 mRNA in the spleen of Altay lambs showed a slow increasing trend in G2. In G3, the Altay lambs exhibited significantly increased mRNA expression of IL-4 in the spleen, and the highest level was observed at 24 h (P < 0.01). However, the expression of IL-4 mRNA in the spleen of Hu lambs showed a slow increasing trend during acute cold stress, and under chronic cold stress, the highest levels were observed at 24 d (P < 0.01).

The IL-10 content increased continuously with cold duration and showed significant differences between different treatment groups in Altay lambs and Hu lambs. On day12, the Altay lambs were challenged with cold stress (G2), which markedly increased the mRNA expression of IL-10 in the spleen compared with that in the corresponding control condition (P < 0.01). The expression of IL-10 under acute cold stress was higher than that under chronic cold stress in Hu lambs. In G3, the expression of IL-10 mRNA was the highest at 6 h (P < 0.01) and then declined with time in Altay lambs; however, at 12 d and 24 d, it increased again (P < 0.01). In G3, the expression of IL-10 mRNA showed significantly increased in the Hu lambs (P < 0.01).

The mRNA levels of the IL-12 increased significantly in G2 compared with G1 (P < 0.01), and Hu lambs also had higher expression levels than did Altay lambs. The mRNA expression of IL-12 in Altay lambs and Hu lambs was also increased in G3 than in G2.

In G2, Altay lambs and Hu lambs in the treatment groups showed slowly increasing mRNA expression of IFN-β. On day 4, chronic cold stress could increase the mRNA expression of IFN-β in the spleen of Altay lambs compared with that in G1 (P < 0.01), but in Hu lambs, there was reached highest at 24 d (P < 0.01). In G3, Altay lambs and Hu lambs in the treatment groups also showed increasing mRNA expression of IFN-β.

Note

“*” means significant difference (P < 0.05); “**” means extremely significant (P < 0.01).

3.4. Changes in energy metabolism-related mRNA and protein expression levels

In Altay and Hu lambs, the effects of cold stress (G2) on the UCP1 mRNA expression in chest and intramuscular fats are shown in Fig. 4. Compared with G1, acute cold stress significantly increased the mRNA levels of the UCP1 gene in chest and intramuscular fats of Altay lambs in G2 (P < 0.05), and chronic cold stress also resulted in a significant increase (P < 0.01). The mRNA levels of the UCP1 gene in chest and intramuscular fats of Hu lambs showed increased with chronic cold stress (P < 0.01). Moreover, as shown in Figs. 5, the mRNA expression of UCP1 in Altay lambs and Hu lambs increased in a time-dependent manner in G3 compared with G1(P < 0.01). These results indicate that the magnitude and direction of change in UCP1 gene expression differs with the type of cold stress applied and varies by different fat tissues, but their expression levels were significantly increased after cold stress. The expressions of HSL under acute cold stress were higher in G2 than in G1 in chest and intramuscular fats of both lamb breeds (P < 0.01). The expression of HSL in chest and intramuscular fats of Altay lambs and Hu lambs increased significantly after chronic cold stress compared with control condition (P < 0.01). In G3, with increasing time, the expression of HSL increased significantly in Altay lambs and Hu lambs (P < 0.01). There was no observed difference between the two lamb breeds in G2 and G3. The expression levels of both lamb breeds were significantly increased after cold stress. The effects of cold stress on the UCP1 and HSL protein expression in chest and intramuscular fats are shown in Fig. 6 and Fig. 7. The protein expression of UCP1 in Altay lambs and Hu lambs continued to increase under different degrees of cold stimulation. Particularly with prolonged chronic cold stress, the protein expression of UCP1 was increased. The protein expression of HSL in Altay lambs and Hu lambs changed dynamically after cold stimulation, but compared with the normal temperature group, it increased. The protein expression levels of HSL and UCP1 after cold stress were basically consistent with the above mRNA expression results.

Environmental stressors such as cold stress are a common occurrence in livestock production, especially impact the health and well-being of young animals. Stressors can activate the HPA-axis, leading to increased plasma concentrations of glucocorticoids (Glaser and Kiecolt-Claser 2005). NE has been shown to mediate cold-induced adaptive thermogenesis and WAT browning through β3-adreneceptor signaling. Accumulated evidence indicates that the plasma level of adrenaline is elevated in response to cold stress (Dronjak et al. 2004). Research by Staten et al. showed that the long-term isolation of rats exposed to 2 h of immobilization or cold led to a significant increase in plasma noradrenaline, adrenaline and cortisol (Staten et al. 1987). High concentrations of NE were found in cold-stressed birds on experimental day 21 (Anderlise et al. 2015). Luo and his collogues reported that acute cold stress upregulated the circulating levels of adrenaline, and treatment of macrophages with adrenaline stimulated the phosphorylation of TyrH and the activation of PKA and CaMKII (Luo et al. 2017). The results of this study had some similarities with previous studies, but there were some fluctuations. After acute cold stress, the E and NE contents in Altay lambs first increased and then decreased, while the E and NE levels in Hu lambs were both higher and showed an increasing trend under acute cold stress than in G1, indicating that cold stress activated the HPA axis and that the peripheral sympathetic nervous system was in an extremely excited state. After chronic cold stress, the levels of E and NE also increased first and then showed a slight downward trend. This finding may indicate that during the process of cold stimulation, high stimulation intensity and long duration can cause marked damage to the endocrine system of animals, and increases the hypothalamus pituitary adrenal axis activities.

Decreased plasma LEP is accompanied by hyperphagia in cold-exposed rats (Bing et al. 1998). Lower serum LEP levels in cold-acclimated animals can act as a starvation signal and enable the animals to increase energy intake (Bing et al. 1998; Korhonen and Saarela 2005; Li and Wang 2005). In our study, under the acute and chronic cold stress, LEP activity in G2 and G3 were decreased compared with G1 in Altay lambs. However, LEP activity in G3 first increased and then decreased in Hu lambs. The serum INS content of the Altay lambs in the stress groups was significantly lower than that of lambs in G1. The serum INS content of Hu lambs in the experimental groups showed an irregular fluctuation trend compared with the normal group. In all experimental groups, the GC content in the Hu lambs was significantly higher in G2 and G3 than in G1 (P < 0.01). In the acute cold stress groups, the serum GC content in Altay lambs significantly decreased and then increased. This finding may suggest that cold stress could influence energy metabolism and enhance the body’s energy mobilization.

The intestinal mucosa provides both a physiological and immunological barrier to a wide range of microorganisms and foreign substances. Zhao et al. reported that cold stress causes villus shorter in height and spread sparsely, and intestinal mucosal congestion, hemorrhage, and leukocyte infiltration in chickens (Zhao et al. 2013). Yang reported that immune stress can disrupt the homeostasis of cecal microflora and impair intestinal mucosal immune function in chickens (Yang et al. 2011). Consistence with these prior studies, our results showed that cold stress induced damage in the intestine. Excessive cold stimulation induced intestinal mucosal congestion and hemorrhage and serious inflammatory infiltration, which further reduced intestinal immune function. We suggested that long-term HPA-axis activation was strictly associated with intestinal inflammation. Compared with the control condition cold stress significantly changed the number of mast cells. With the increasing of cold stress duration, the number of mast cells increased significantly.

Many studies have proven that cold stress can influence energy metabolism and immune responses (Rybakina et al. 1997; Cichoń et al. 2002; Haman et al. 2002; Pereira-da-Silva 2003). Environmental stressors were shown to negatively affect the immune system in birds, compromising performance and the ability to overcome bacterial infections (Humphrey 2006; Dunkley et al. 2007; Burkholder et al. 2008). Most cytokines could increase immune function, including IL-2 and IFN-γ, which show the strongest effect on T cell, IL-4 and IL-10, show the strongest effect on B cell function. It was reported that cold stress enhanced mRNA levels of Th1 (IFN-γ and IL-2) and Th2 (IL-4 and IL-10) cytokine genes in chickens (Hangalapura et al. 2003;Hangalapura et al. 2006). Cold water stress (5 min/d) downregulated mRNA expression for the Th1 (IL-2 and IFN-γ) cytokine genes in mice after 10 d of exposure, but upregulated after 20 d of exposure (Monroy et al. 1999). IL-4 content was increased in the spleen and bursa of Fabricius of chicks under acute and chronic cold stress (Zhao et al. 2014). Under chronic cold stress, the IL-2 and IL-10 contents were increased in the spleen and bursa of Fabricius and decreased in the thymus. It was reported that cold stress enhanced IL-2 cytokine levels in humans (Jansky et al. 1996). In our study, compared with normal temperature, the cold temperature stimulation of G2 and G3 increased the expression levels of IL-2 and IL-4 in the spleen of both Altay lambs and Hu lambs, and the levels of IL-4 in G3 were significantly higher than those in G2 and G1. However, the level of IL-2 was significantly higher in G2 than in G3 and G1 in Hu lambs. This study is the first to study the effect of cold stimulation on the expression levels of cytokines in the spleen. The results indicated that the expression levels of IL-2, IL-4, IL-10, IL-12, and IFN-β were increased under acute and chronic cold stress. Moreover, there was no significant difference between G2 and G3 groups. This showed that stressors can regulate the secretion of cytokines, and the expression of cytokines can adjust the immune function of lambs during cold stress process. The expression patterns of various cytokines in this experiment showed that the cold tolerance and immune function were enhanced after acute stimulation in G2 and G3. Longer periods of cold stimulation did not obviously promote an immune response in the spleen.

Fat metabolism is an important surrogate of energy metabolism. It is crucial to determine the underlying mechanisms of fatty deposition and energy metabolism in stressful environments. After 24 h of cold stress, genes related to the adipocytokine signaling pathway were significantly activated for thermal production (Chen et al. 2014). Lipid metabolism to maintain a constant temperature is considered to be the first event induced by cold stress. Zhou reported that UCP1 expression in bats was significantly upregulated in the 5℃ group but downregulated in the 32.5℃ group compared with the 21℃ group. UCP3 expression in skeletal muscle was also significantly upregulated in hamsters acclimated to 5℃ (Zhou et al. 2015). As a key enzyme involved in lipolysis, increases in HSL could depress the accumulation of TG in adipose cells (Sztalryd et al. 1995; Mary et al. 1993), which hydrolyzes stored TG to free fatty acids. HSL gene knockout mice which have reduced circulating levels of fatty acids and altered TG storage in adipose tissues, have been reported (Fortier et al. 2004; Osuga et al. 2000; Voshol et al. 2003). The mRNA and protein expression of UCP1 and HSL in chest and intramuscular fats was significantly higher after cold stress than under normal temperature and showed an increasing trend with increasing cold stress duration. Moreover, the UCP1 and HSL levels were higher in G3 than in G2. UCP1 allows proton flux across the mitochondrial inner membrane uncoupled from ATP production to generate heat, so the lambs displayed more adaptive changes in thermal physiology and energy metabolism. At the same time, the fat decomposition ability of sheep was also enhanced under cold stress. This may be because cold temperature conditions below − 20 ± 3°C was intense for sheep, so the sheep in G2 and G3 mobilized energy metabolism in response to low-temperature conditions. However, the Altay lambs generated more heat than Hu lambs in G3. Hu lambs mobilized more TG in adipose tissue to hydrolyze into fatty acids under cold stress. It can be concluded that Altay lambs are more resistant to cold stress than Hu lambs.

Disclosure statement

No potential conflict of interest was reported by the authors.

Anderlise B, Quinteiro-Filho WM, Calefi AS, Ferreira AJP, Astolfi-Ferreira CS, Florio JC, Palermo-Neto J (2015) Effects of cold stress and Salmonella Heidelberg infection on bacterial load and immunity of chickens. Avian Pathology 44(6): 490–497. https://doi:10.1080/03079457.2015.1086976
Bing C, Frankish HM, Pickavance L, Wang Q, Hopkins DF, Stock MJ, Williams G (1998) Hyperphagia in cold-exposed rats is accompanied by decreased plasma leptin but unchanged hypothalamic NPY. American Journal of Physiology- Regulatory, Integrative and Comparative Physiology 274(1): 62–68. https://doi:1 0.1152/ajpregu
Bligh-Tynan ME, Bhagwat SA, Castonguay TW (1993) The effects of chronic cold
exposure on diurnal corticosterone and aldosterone rhythms in Sprague-Dawley
rats. Physiology Behavior 54(2):363–367. https://doi:10.1016/0031-9384(93) 90124-x
Burkholder KM, Thompson KL, Einstein ME, Applegate TJ, Patterson JA (2008) Influence of stressors on normal intestinal microbiota, intestinal morphology, and susceptibility to Salmonella Enteritidis colonization in broilers. Poultry Science 87(9):1734–1741. https://doi.org/10.3382/ps.2008-00107
Chen XY, Li R, Wang M, Geng ZY (2014) Identification of differentially expressed genes in hypothalamus of chicken during cold stress. Molecular Biology Reports 41(4):2243–2248. https://doi:10.1007/s11033-014-3075-z
Cichoń M, Chadzińska M, Ksiazek A, Konarzewski M (2002) Delayed effects of cold stress on immune response in laboratory mice. Proceedings of Royal Society of London B 269(1499):1493–1497. https://doi:10.1098/rspb.2002.2054
Demas GE, Nelson RJ (1996) Photoperiod and temperature interact to affect immune parameters in adult male deer mice (Peromyscus maniculatus). Journal of Biological Rhythms 11(2): 94–102. https://doi.org/10.1177/07487304960110020 2
Demas GE, Nelson RJ (1998) Photoperiod, ambient temperature, and food availability interact to affect reproductive and immune function in adult male deer mice (Peromyscus maniculatus). Journal of Biological Rhythms 13(3): 253–262. https://doi:10.1177/074873098129000093
Dronjak S, Gavrilović L, Filipović D, Radojčić MB (2004) Immobilization and cold stress affect sympatho-adrenomedullary system and pituitary-adrenocortical axis of rats exposed to long-term isolation and crowding. Physiology Behavior 81(3): 409–415. https://doi.org/10.1016/j.physbeh.2004.01.011
Dunkley CS, McReynolds JL, Dunkley KD, Njongmeta LN, Berghman LR, Kubena LF, Nisbet DJ, Ricke SC (2007) Molting in Salmonella Enteritidis-challenged laying hens fed alfalfa crumbles. IV. Immune and stress protein response. Poultry Science 86: 2502–2508. https://doi:10.3382/ps.2006-00401
Feldmann HM, Golozoubova V, Cannon B, Nedergaard J (2009) UCP1 ablation induces obesity and abolishes diet-induced thermogenesis in mice exempt from thermal stress by living at thermoneutrality. Cell Metabolism 9(2): 203–209. https://doi:10.1016/j.cmet.2008.12.014
Felten SY, Madden KS, Bellinger DL, Kruszewska B, Moynihan JA, Felten DL (1998) The role of the sympathetic nervous system in the modulation of immune responses. Advances in Pharmacology 42:583–587. https://doi:10.1016/s1054-35 89(08)60818-2
Fernandez A, Abelenda M, Nava MP, Puerta M (1994) Oxygen-consumption of estradiol-treated rats. Pflügers Archiv- European Journal of Physiology 426(3–4): 351–353. https://xs.scihub.ltd/https://doi.org/10.1007/BF00374793
Fortier M, Wang SP, Mauriege P, Semache M, Mfuma L, Li H, Levy E, Richard D, Mitchell GA (2004) Hormone-sensitive lipase-independent adipocyte lipolysis during beta-adrenergic stimulation, fasting, and dietary fat loading. American Journal of Physiology Endocrinology Metabolism 287(2):282–288. https://doi:10. 1152/ajpendo.00203.2003
Garofalo MAR, Kettelhut IC, Roselino JES, Migliorini RH (1996) Effect of acute cold exposure on norpinephrine turnover rates in rat white adipose tissue. Journal of the Autonomic Nervous System 60(3): 206–208. https://doi:10.1016/0165-183 8(96)00037 – 9
Glaser R, Kiecolt-Claser JK (2005) Stress-induced immune dysfunction: implications for health. Nat Rev Immunol 5:243–251. doi:10.1038/nri1571
Haman F, Péronnet F, Kenny GP, Massicotte D, Lavoie C, Scott C, Weber JM (2002) Effect of cold exposure on fuel utilization in humans: Plasma glucose, muscle glycogen, and lipids. Journal of Applied Physiology 93(1):77–84. https://doi:10. 1152/japplphysiol.00773.2001
Hangalapura BN, Kaiser MG, van der Poel JJ, Parmentier HK, Lamont SJ (2006) Cold stress equally enhances in vivo pro-inflammatory cytokine gene expression in chicken lines divergently selected for antibody responses. Developmental Comparative Immunology 30(5):503–511. https://doi:10.1016/j.dci.2005.07.001
Hangalapura BN, Nieuwland MG, de Vries Reilingh G, Heetkamp MJ, van den Brand H, Kemp B, Parmentier HK (2003) Effects of cold stress on immune responses and body weight of chicken lines divergently selected for antibody responses to sheep red blood cells. Poultry Science 82(11):1692–1700. https://doi:10.1093/p s/82.11.1692
Humphrey T (2006) Are happy chickens safer chickens? Poultry welfare and disease susceptibility. British Poultry Science 47(4):379–391. https://doi:10.1080/0007 1660600829084
Jansky L (1973) Non-shivering thermogenesis ans its thermoregulatory significance. Biological Reviews 48(1): 85–132. https://doi:10.1111/j.1469-185x.1973.tb0111 5.x
Jansky L, Pospisilova D, Honzova S, Ulicny B, Sramek P, Zeman V, Kaminkova J (1996) Immune system of cold-exposed and cold adapted humans. European Journal of Applied Physiology and Occupational Physiology 72(5–6):445–450. https://doi:10.1007/bf00242274
Kelesidis T, Kelesidis I, Chou S, Mantzoros CS (2010) Narrative review: the role of leptin in human physiology: emerging clinical applications. Annals of Internal Medicine 152(2): 93–100. https://doi:10.7326/0003-4819-152-2-201001190-000 08
Korhonen T, Saarela S (2005) Role of adiposity hormones in the mouse during fasting and winter-acclimatization. Comparative Biochemistry and Physiology Part A 140(2): 217–223. https://doi:10.1016/j.cbpb.2005.01.006
Landsberg L, Young JB (1984) The role of the sympathoadrenal system in modulating energy expenditure. Clinics in Endocrinology and Metabolism 13(3): 475–499. https://doi:10.1016/s0300-595x(84)80034-1.
Lafontan M, Berlan M (1993) Fat cell adrenergic receptors and the control of white and brown fat cell function. Journal of Lipid Research 34:1057–1091. https://doi. org/10.1016/S0022-2275(20)37695-1
Lee YH, Song GG (2017) Meta-analysis of circulating adiponectin, leptin, and resistin levels in systemic sclerosis. Z. Rheumatol 76:789–797. https://doi:10.1007/s003 93-016-0172-5.
Li XS, Wang DH (2005) Regulation of body weight and thermogenesis in seasonally acclimatized Brandt’s voles (Microtus brandti). Hormones and Behavior 48(3): 321–328. https://doi:10.1016/j.yhbeh.2005.04.004
Luo Y, Liu BL, Yang X, Ma XX, Zhang X, Bragin DE, Yang XXO, Huang WD, Liu ML (2017) Myeloid adrenergic signaling via CaMKII forms a feedforward loop of catecholamine biosynthesis. Journal of Molecular Cell Biology 9(5):422–434. https://doi:10.1093/jmcb/mjx046
Mary PT, Sandra T, Coopera BR (1993) Increased expression of the mRNA for hormone-sensitive lipase in adipose tissue of cancer patients. Biochimica et Biophysica Acta-Molecular Basis of Disease 1180(3): 236–242. https://doi:10. 1016/0925–4439(93)90044-2
Monroy FP, Banerjee SK, Duong T, Aviles H (1999) Cold stress-induced modulation of inflammatory responses and intracerebral cytokine mRNA expression in acute murine toxoplasmosis. The Journal of Parasitology 85(5):878–886. doi: 10.2307/3285825
Nelson RJ (2004) Seasonal immune function and sickness responses. Trends in Immunology 25(4):187–192. https://doi:10.1016/j.it.2004.02.001
Osuga J, Ishibashi S, Oka T, Yagyu H, Tozawa R, Fujimoto A, Shionoiri F, Yahagi N, Kraemer FB, Tsutsumi O, Yamada N (2000) Targeted disruption of hormone-sensitive lipase results in male sterility and adipocyte hypertrophy, but not in obesity. Proceeding of the National Academy of Sciences 97(2):787–792. https://doi:10.2307/121701
Pereira-da-Silva M, Torsoni MA, Nourani HV, Augusto VD, Souza CT, Gasparetti AL, Carvalheira JB, Ventrucci G, Marcondes MC, Cruz-Neto AP, Saad MJ, Boschero AC, Carneiro EM, Velloso LA (2003) Hypothalamic melanin concentrating hormone is induced by cold exposure and participates in the control of energy expenditure in rats. Endocrinology 144(11): 4831–4840. https://doi:10.1210/en. 2003 – 0243
Pfaffl MW (2001) A new mathematical model for relative quantification in real-time RT-PCR. Nucleic Acids Research 29(9):45e-45. https://doi:10.1093/nar/29.9.e45
Rousset S, Alves-Guerra MC, Mozo J, Miroux B, Cassard-Doulcier AM, Bouillaud F, Ricquier D (2004) The biology of mitochondrial uncoupling proteins. Diabetes 53(Supplement 1):130–135. https://doi:10.2337/diabetes.53.2007.s130
Rybakina EG, Shanin SN, Kozinets IA, Fomicheva EE, Korneva EA (1997) Cellular mechanisms of cold stress related immunosuppression and the action of interleukin 1. International Journal of Tissue Reactions 19(3–4):135–140.
Sapolsky RM, Romero LM, Munck AU (2000) How do glucocorticoids influence stress responses? Integrating permissive, suppressive, stimulatory, and
preparative actions. Endocrine Reviews 21(1):55–89. https://doi:10.1210/edrv.21. 1.0389
Staten MA, Matthews DE, Cryer PE, Bier DM (1987) Physiological increments in epinephrine stimulate metabolic rate in humans. American Journal of Physiology-Endocrinology and metabolism 253(3):322–330. https://doi:10.1152 /ajpendo.1987.253.3.e322
Su YY, Wei HD, Bi YJ, Wang YN, Zhao P, Zhang RX, Li X, Li JH, Bao J (2018) Pre-cold acclimation improves the immune function of trachea and resistance to cold stress in broilers. Journal of Cellular Physiology 1–15. https://doi:10.1002/jcp.27 473
Sztalryd C, Komaromy MC, Kraemer FB (1995) Over expression of hormone- sensitive lipase prevents triglyceride accumulation in adipocytes. The Journal of Clinical Investigation 95(6):2652–2661. https://doi:org/10.1172/JCI117967
Voshol PJ, Haemmerle G, Ouwens DM, Zimmermann R, Zechner R,Teusink B, Maassen JA, Havekes LM, Romijn JA (2003) Increased hepatic insulin sensitivity together with decreased hepatic triglyceride stores in hormone- sensitive lipase-deficient mice. Endocrinology144 (8):3456–3462. https://doi:10. 1210/en/2002-0036
Webster Marketon JI, Glaser R (2008) Stress hormones and immune function. Cellular Immunology 252(1–2):16–26. https://doi:10.1016/j.cellimm.2007.09.006
Yang XJ, Li WL, Feng Y, Yao JH (2011) Effects of immune stress on growth performance, immunity, and cecal microflora in chickens. Poultry Science 90(12):2740–2746. https://doi:10.3382/ps.2011-01591
Zhao FQ, Zhang ZW, Yao HD, Wang LL, Liu T, Yu XY, Xu SW (2013) Effects of cold stress on mRNA expression of immunoglobulin and cytokine in the small intestine of broilers. Research in Veterinary Science 95(1):146–155. https://do i:10.1016/j.rvsc.2013.01.021
Zhao FQ, Zhang ZW, Qu JP, Yao HD, Li M, Li S, Xu SW (2014) Cold stress induces antioxidants and Hsps in chicken immune organs. Cell Stress and Chaperones 19(5):635–648. https://doi:10.1007/s12192-013-0489-9
Zhou SS, Cao LL, Xu WD, Cao J, Zhao ZJ (2015) Effect of temperature on oxidative stress, antioxidant levels and uncoupling protein expression in striped hamsters. Comparative Biochemistry and Physiology Part A 189: 84–90. https://doi:10.10 16/j.cbpa.2015.07.017

No competing interests reported.

Download PDF

Version 1

posted

You are reading this latest preprint version

Effects of cold stress on hormone contents, immune responses and HSL and UCP1 expression in the fat tissue of Altay and Hu lambs

Status:

Version 1

Abstract

Figures

1. Introduction

2. Materials And Methods

2.1. Animals and management

2.2. Sample collection and procedures

2.2.1. Immunoassays

2.2.2 Histopathological examination

2.2.3 Total RNA isolation and reverse transcription

2.2.4 Real-time quantitative reverse transcription PCR

2.2.5 Western blotting analysis

2.3. Statistical analyses

3. Results

3.1. Changes of the serum hormone activities

3.2. Histopathology

3.3. mRNA expression of immune factors in the spleen of lambs

3.4. Changes in energy metabolism-related mRNA and protein expression levels

4. Discussion

Declarations

References

Additional Declarations

Status:

Version 1