DOI: https://doi.org/10.21203/rs.3.rs-1655233/v1
Background: Behçet's Disease (BD) is a chronic autoimmune disease with unknown etiology. Adipokines due to their roles in the regulation of immune responses might be important in the induction and progression of BD.
Subjects and methods: This case-control study included 340 patients with BD and 310 healthy controls. Single nucleotide polymorphisms (SNPs) in adiponectin (rs266729 and rs1501299) and leptin (rs7799039 and rs2167270) genes were determined using polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP) and serum levels of adipokines were measured using enzyme-linked immunosorbent assay (ELISA).
Results: A higher frequency of leptin rs7799039 GG, AG, and AG+GG genotypes and G allele was revealed in patients. Besides, patients had more leptin rs2167270 AG and AG+AA genotypes and A allele. Furthermore, rs2167270 AA genotype and A allele were more frequently seen in total and female patients who had genital aphthous. Patients had significantly more serum levels of adiponectin while those with genital aphthous had significantly more leptin levels. No significant association was observed between adiponectin SNPs and the frequency of BD.
Conclusion: Our findings indicated that leptin gene polymorphisms might predispose individuals to BD. Besides, elevated serum levels of adiponectin might promote the pathogenesis of BD.
Behçet's Disease (BD) is a rare, chronic, autoimmune, inflammatory disease characterized by mucocutaneous lesions (e.g., skin lesions, oral aphthae, genital ulcers) and several organ involvements [1, 2]. The etiopathogenesis of BD remains elusive but genetic and environmental factors play substantial roles [2, 3]. Human leukocyte antigens (HLA)-B5 and HLA-B51 are the main genetic susceptibility factors for developing BD and account for < 20% of the genetic risk [4]. Besides, adipose tissue-derived cytokines or adipokines due to their effects on immune cells might facilitate the initiation and progression of autoimmune diseases like BD [5, 6]. Several studies strongly suggested the critical role of adipokines in modulating inflammation and immune responses [7–9]. The most abundant adipokines secreted by adipose tissue are adiponectin and leptin that play essential roles in physiological processes and the balance of the immune system [5, 10]. Adiponectin is a 30-kDa protein with both anti- and pro-inflammatory characteristics [11]. Recent studies have shown the pro-inflammatory roles of adiponectin in patients with autoimmune diseases, including rheumatoid arthritis [12] and inflammatory bowel disease [12, 13]. Nevertheless, leptin promotes the activation of both innate and adaptive immune system and polarize them toward a pro-inflammatory phenotype [14, 15]. The genes coding for adiponectin and leptin are located on chromosomes 3 (3q27) and 7 (7q32), respectively. Adiponectin gene polymorphisms rs266729 or − 11377C > G and rs1501299 or + 276G > T are located in promoter and Intron 2, respectively while leptin gene variants rs7799039 or − 2548 G > A and rs2167270 or 19 G > A are located in promoter and 5´‑untranslated region (UTR), respectively. Several studies have clearly shown the roles of adiponectin and leptin gene variants in the pathogenesis of autoimmune diseases [16, 17]. In this study, the possible roles of adiponectin and leptin gene polymorphisms and their serum levels were evaluated in Iranian BD patients and healthy subjects.
This case-control study was performed in keeping with the Declaration of Helsinki (https://www.wma.net/policies-post/wma-declaration-of-helsinki-ethical-principles-for-medical-research-involving-human-subjects/) and the ethics committee of the Shiraz University of Medical Sciences approved it. Informed consent was obtained from all subjects.
A total of 340 BD patients consisted of 98 (28.8%) men and 242 (71.1%) women with a mean age of 33.75 ± 0.548 years from Hafez Rheumatology Outpatient Clinic, Shiraz, Iran were included. BD diagnosis was done following the International Criteria for Behçet's Disease [18]. Three hundred ten age- and sex-matched healthy subjects comprised of 82 (26.4%) men and 228 (75.6%) women with a mean age of 36.48 ± 0.541 years who had no history of autoimmune or inflammatory diseases were used as the control group. Clinical, laboratory and demographic parameters of all participants are shown in Table 1.
| Variables | BD | Healthy controls |
|---|---|---|
| Age (years, Mean ± SD) | 33.75 ± 0.548 | 36.48 ± 0.541 |
| Gender: Male/female | 98/242 | 82/228 |
| Age of onset (years) | 29.37 ± 0.54 | - |
| Family history of BD | 79 (23.2%) | - |
| Family history of other autoimmune diseases | 70 (20.5%) | - |
| Smoking | 66 (19.4%) | - |
| Positive pathergy test | 187 (55.0%) | - |
| Oral aphthous | 320 (94.1%) | - |
| Genital aphthous | 238 (69.9%) | - |
| Skin manifestations | 200 (58.8%) | - |
| Eye manifestations | 141 (41.4%) | - |
| Joint manifestations | 222 (65.2%) | - |
| Neural manifestations | 140 (41.1%) | - |
| Vascular manifestations | 36 (10.5%) | - |
| Cardiac involvement | 16 (4.70%) | - |
| Lung involvement | 25 (7.35%) | - |
| Renal involvement | 37 (10.8%) | - |
| Gastrointestinal involvement | 26 (7.64%) | - |
| WBC (Cells/mm3, Mean ± SD) | 7418.05 ± 349.7 | - |
| CRP positive (> 6 mg/L) | 48 (17.2%) | - |
| ESR (mm, Mean ± SD) | 15.3 ± 0.90 | - |
| BD: Behçet's Disease, WBC: White Blood Cells, CRP: C-Reactive Proteins, ESR: Erythrocyte Sedimentation Rate. Data represented as number (percentage). | ||
To determine the genotype of SNPs, five milliliters (ml) of whole blood in EDTA were obtained from all participants, and DNA was extracted using the "salting out" method as described previously [19]. Polymerase chain reaction (PCR) was used to amplify the intended SNP containing adiponectin and leptin genes. The PCR was done in 10 µl reaction volume containing 5 µl of DNA, 0.7 µM of each primer (Pioneer, South-Korea, Table 2), 0.1 µl of 5 units/µl Taq DNA polymerase (CinnaGen, Iran), 0.3 µl of 10 mM dNTPs (CinnaGen, Iran), 1 µl of 10X buffer, and 2.2 µl distilled water. To detect DNA contamination, no template control (NTC) was included and the PCR condition was done in the following manner: Initial denaturation at 95° C for 5 min followed by 30 cycles of (denaturation at 95° C for 30 sec, annealing at 62° C for 30 sec, extension at 72° C for 30 sec), and a final extension at 72° C for 5 min. The PCR products were then incubated at 37° C for 24 h with restriction enzymes (Thermo Fisher Scientific, USA,) and DNA fragments were detected by running on 3% agarose gel stained with safe stain dye (CinnaGen, Iran) and visualized in UV transilluminator (Upland, CA).
| Gene | SNP | Primer Sequence (5′ to 3′) | Product size (bp) | Restriction enzyme | Fragment length (bp) |
|---|---|---|---|---|---|
| Adiponectin | rs1501299 | F: 5′-CCAGAAACATTCTTACCTGGATCT-3′ | 356 bp | AvaI | GG: 189, 166 GT: 356, 189, 166 TT: 356 |
| R: 5′-AGAAAGCAGCTCCTAGAAGT-3′ | |||||
| rs266729 | F: 5′-GCAGCTCCTAGAAGTAGACTCTGCTG-3′ | 372 bp | Hin6I | CC:372 CG: 372, 180, 176 GG: 180, 176 | |
| R: 5′-GCAGGTCTGTGATGAAAGAGGCC-3′ | |||||
| Leptin | rs7799039 | F: 5′- TTTCCTGTAATTTTCCCGTGAG − 3′ | 242 bp | Hin6I | GG: 205, 36 GA: 242,205,36 AA:242 |
| R: 5′- AAAAGCAAAGACAGGCATAAA − 3′ | |||||
| rs2167270 | F: 5′-GCACGTCGCTACCCTGAG-3′ | 314 bp | AciI | GG: 120,103 GA:158, 120,103 AA: 158,103 | |
| R: 5′-CTATCTGGCTAGAACTCGGTACAAA-3′ |
Blood samples were obtained from 40 BD patients and 40 healthy controls. Serum levels of adiponectin and leptin in serum samples were quantified using enzyme-linked immunosorbent assay (ELISA) kits according to the manufacturer’s protocol (R&D Systems, USA). Briefly, 96-well microtiter plates (Maxisorbe, Nunc, Denmark) were coated with 100 µl of capture antibodies against adiponectin and leptin and incubated overnight at 4°C. After washing, blocking diluent was added and incubated for 1 hour at room temperature. Then, samples and standards were loaded and incubated for 2 hours at room temperature after which HRP-labeled detection antibodies were added. Finally, a substrate solution (3,3′,5,5′-Tetramethyl benzidine, BD, USA) was added and color development was determined using an ELISA plate reader at 450 nm within 30 minutes. Assays were done in triplicate and the concentration of leptin and adiponectin was calculated using the standard curve.
The Statistical Package for Social Sciences (SPSS Inc., Chicago, IL) version 26, GraphPad Prism (La Jolla, CA, USA) version 8.0.2, and Epi Info version 7.2.2.6 software packages were used for data analysis. The consistency of the genotype distribution and haplotype analysis were assessed using the Hardy–Weinberg equilibrium and Arlequin software (CDC, Atlanta, GA) version 3.1 respectively. Nominal data were presented as number (n) and percentage (%). The two-tailed Pearson’s chi-square (χ2) test was used to compare the genotype and allele frequencies between studied groups. Normal distribution of data was assessed using Kolmogorov-Smirnov (K-S) test. Serum levels of leptin and adiponectin between BD patients and healthy controls were analyzed using the Mann-Whitney U test. P values less than 0.05 were considered statistically significant.
Genotype and allele frequencies of adiponectin and leptin gene SNPs are shown in Table 3. All the studied SNPs followed the Hardy-Weinberg Equilibrium (p > 0.05). Our results demonstrated that the frequencies of genotypes, alleles, and genotype combination of adiponectin gene polymorphisms rs1501299 and rs266729 were not significantly different between BD and healthy controls. However, regarding leptin gene variants, our data showed that BD patients have significantly more rs7799039 AG and GG genotypes compared to the healthy subjects (p = 0.0038 and p = 0.006, respectively). After gender stratification, these differences remained significant for rs7799039 AG and GG in both female and male BD patients, respectively (p = 0.034 and p = 0.0008, respectively). Evaluation of the allelic frequencies revealed that total and male BD patients have significantly more rs7799039G allele compared to the healthy individuals (p = 0.003 and 0.0005, respectively). Besides, our data indicated that BD patients have significantly more rs7799039AG + GG genotype compared to the healthy individuals (p = 0.001). Again, after gender stratification, these results remained significant for male patients (p = 0.006). In the case of rs2167270, a significantly higher frequency of AG genotype and A allele was shown in BD patients compared with the healthy subjects (p = 0.03 for each comparison). BD patients had significantly more AG + AA genotype compared to the healthy controls (p = 0.02).
| SNP | BD | Healthy controls | OR (95% CI) | p-value | |||||||||
| T | M | F | T | M | F | T | M | F | T | M | F | ||
| rs1501299 Genotypes | GG | 7 (2.64) | 2 (2.06) | 5 (2.97) | 11 (3.9) | 3 (2.9) | 9 (5.1) | 1.00 (reference) | 1.00 (reference) | 1.00 (reference) | - | - | - |
| GT | 58 (21.8) | 20 (20.6) | 38 (22.6) | 74 (26.8) | 32 (31.3) | 42 (24.0) | 0.8 (0.2–2.22) | 1.06 (0.16–6.9) | 0.61 (0.18–1.9) | 0.87 | 1.0 | 0.59 | |
| TT | 200 (75.4) | 75 (77.3) | 125 (74.4) | 191 (69.2) | 67 (65.6) | 124 (70.8) | 0.6 (0.2–1.6) | 0.59 (0.09–3.6) | 0.55 (0.17–1.6) | 0.43 | 0.91 | 0.43 | |
| rs1501299 Alleles | G | 72 (13.5) | 24 (12.3) | 48 (14.2) | 96 (17.3) | 38 (18.6) | 60(17.1) | 1.00 (reference) | 1.00 (reference) | 1.00 (reference) | - | - | - |
| T | 458 (86.4) | 170 (87.6) | 288 (85.7) | 456 (82.6) | 166 (81.3) | 290 (82.8) | 0.7 (0.5–1.04) | 0.6 (0.3–1.07) | 0.8 (0.5–1.2) | 0.1 | 0.11 | 0.35 | |
| rs1501299 Genotype combinations | GG | 7 (2.6) | 2 (2.06) | 5 (2.97) | 11 (3.98) | 3 (2.94) | 9 (5.14) | 1.00 (reference) | 1.00 (reference) | 1.00 (reference) | - | - | - |
| TT + TG | 258 (97.3) | 95 (97.9) | 163 (97.0) | 265 (96.0) | 99 (97.0) | 166 (94.8) | 0.6 (0.2–1.7) | 0.6 (0.1–4.2) | 0.5 (0.1–1.7) | 0.52 | 1.0 | 0.45 | |
| TT | 200 (75.4) | 75 (77.3) | 125 (74.4) | 191 (69.2) | 67 (65.6) | 124 (70.8) | 1.00 (reference) | 1.00 (reference) | 1.00 (reference) | - | - | - | |
| 65 (24.5) | 22 (22.6) | 43 (25.5) | 85 (30.7) | 35 (34.3) | 51 (29.2) | 1.3 (0.9-2.0) | 1.7 (0.9–3.3) | 1.1 (0.7–1.9) | 0.12 | 0.9 | 0.53 | ||
| rs266729 Genotypes | CC | 175(61.8) | 61 (57.0) | 114 (64.7) | 148 (58.9) | 39 (54.1) | 109 (60.8) | 1.00 (reference) | 1.00 (reference) | 1.00 (reference) | - | - | - |
| CG | 89 (31.4) | 42 (39.2) | 47 (26.7) | 84 (33.4) | 27 (37.5) | 57 (31.8) | 1.1 (0.7–1.61) | 1.0 (0.5–1.88) | 1.2 (0.7-2.0) | 0.62 | 1.0 | 0.37 | |
| GG | 19 (6.71) | 4 (3.7) | 15 (8.52) | 19 (7.56) | 6 (8.33) | 13 (7.26) | 1.1 (0.6–2.31) | 2.3 (0.6–8.84) | 0.9 (0.4–1.9) | 0.75 | 0.34 | 0.96 | |
| rs266729 Alleles | C | 439 (77.5) | 164 (76.6) | 275 (84.6) | 380 (75.6) | 105 (72.9) | 275 (76.8) | 1.00 (reference) | 1.00 (reference) | 1.00 (reference) | - | - | - |
| G | 127 (22.4) | 50 (23.3) | 77 (23.6) | 122 (24.3) | 39 (27.0) | 83 (23.1) | 1.1 (0.8–1.4) | 1.2 (0.7–1.9) | 1.07 (0.7–1.5) | 0.51 | 0.50 | 0.74 | |
| rs266729 Genotype combinations | CC | 175 (61.8) | 61 (57.0) | 114 (64.7) | 148 (58.9) | 39 (54.1) | 109 (60.8) | 1.00 (reference) | 1.00 (reference) | 1.00 (reference) | - | - | - |
| CG + GG | 108 (38.2) | 46 (42.9) | 62 (35.2) | 103 (41.0) | 33 (45.8) | 70 (39.1) | 1.1 (0.7–1.5) | 1.1 (0.6–2.04) | 1.1 (0.7–1.8) | 0.55 | 0.82 | 0.51 | |
| GG | 19 (6.71) | 4 (3.73) | 15 (8.52) | 19 (7.56) | 6 (8.33) | 13 (7.26) | 1.00 (reference) | 1.00 (reference) | 1.00 (reference) | - | - | - | |
| 264 (93.2) | 103 (96.2) | 161 (34.6) | 232 (92.4) | 66 (91.6) | 166 (92.7) | 0.8 (0.4–1.7) | 0.4 (0.1–1.5) | 1.1 (0.5–2.5) | 0.82 | 0.32 | 0.80 | ||
| rs7799039 Genotypes | AA | 76 (22.9) | 30 (23.6) | 46 (22.5) | 100 (35.0) | 39 (41.9) | 61 (31.7) | 1.00 (reference) | 1.00 (reference) | 1.00 (reference) | - | - | - |
| AG | 172 (51.9) | 63 (49.6) | 109 (53.4) | 128 (44.9) | 44 (47.3) | 84 (43.7) | 056 (0.39–0.82) | 0.54 (0.29–0.99) | 0.58 (0.36–0.94) | 0.0038 | 0.06 | 0.034 | |
| GG | 83 (25.0) | 34 (26.7) | 49 (24.0) | 57 (20.0) | 10 (10.7) | 47 (24.4) | 0.52 (0.33–0.82) | 0.23 (0.096–0.53) | 0.72 (0.41–1025) | 0.006 | 0.0008 | 0.31 | |
| rs7799039 Alleles | A | 324 (49.0) | 123 (48.4) | 201 (49.2) | 328 (57.5) | 122 (65.5) | 206 (53.6) | 1.00 (reference) | 1.00 (reference) | 1.00 (reference) | - | - | - |
| G | 338 (51.0) | 131 (51.5) | 207 (50.7) | 242 (42.4) | 64 (34.4) | 178 (46.3) | 0.7 (0.56–0.88) | 0.49 (0.33–0.72) | 0.84 (0.63–1.1) | 0.003 | 0.0005 | 0.24 | |
| rs7799039 Genotype combinations | AA | 76 (23) | 30 (23.6) | 46 (22.5) | 100 (35.0) | 39 (41.9) | 61 (31.7) | 1.00 (reference) | 1.00 (reference) | 1.00 (reference) | - | - | - |
| AG + GG | 255 (77.0) | 97 (76.3) | 158 (77.4) | 185 (65.0) | 54 (58.1) | 131 (68.2) | 0.55 (0.39–0.78) | 0.43 (0.24–0.76) | 0.62 (0.4–0.98) | 0.001 | 0.006 | 0.05 | |
| GG | 83 (25.0) | 34 (26.8) | 49 (24.0) | 57 (20.0) | 10 (10.8) | 47 (24.5) | 1.00 (reference) | 1.00 (reference) | 1.00 (reference) | - | - | - | |
| AA + AG | 248 (75) | 93 (73.2) | 155 (76) | 228 (80) | 83 (89.2) | 145 (75.5) | 1.3 (0.91–1.96) | 3 (1.4–6.5) | 0.97 (0.3–0.9) | 0.16 | 0.006 | 1 | |
| rs2167270 Genotypes | GG | 86 (43.0) | 33 (48.5) | 53 (40.1) | 152 (52.7) | 68 (59.6) | 84 (49.7) | 1.00 (reference) | 1.00 (reference) | 1.00 (reference) | - | - | - |
| AG | 88 (44.0) | 28 (41.1) | 60 (45.4) | 101 (36.0) | 39 (34.2) | 62 (36.6) | 0.7 (0.4–1.1) | 0.6 (0.3–1.2) | 0.7 (0.4–1.1) | 0.03 | 0.29 | 0.23 | |
| AA | 26 (13.0) | 7 (10.2) | 19 (14.3) | 30 (10.4) | 7 (6.14) | 23 (13.6) | 0.6 (0.3–1.1) | 0.4 (0.1–1.49) | 0.7 (0.3–1.5) | 0.20 | 0.32 | 0.56 | |
| rs2167270 Alleles | G | 260 (65.0) | 94 (69.1) | 166 (62.8) | 405 (71.5) | 175 (76.7) | 235 (68.5) | 1.00 (reference) | 1.00 (reference) | 1.00 (reference) | - | - | - |
| A | 140 (35.0) | 42 (30.8) | 98 (37.1) | 161 (28.4) | 53 (23.2) | 108 (31.4) | 0.7 (0.5–0.9) | 0.6 (0.4–1.09) | 0.7 (0.5–1.09) | 0.03 | 0.13 | 0.17 | |
| rs2167270 Genotype combinations | GG | 86 (43.0) | 33 (48.5) | 53 (40.1) | 152 (53.7) | 68 (59.6) | 84 (48.2) | 1.00 (reference) | 1.00 (reference) | 1.00 (reference) | - | - | - |
| AG + AA | 114 (57.0) | 35 (51.4) | 79 (59.8) | 131 (46.2) | 46 (40.3) | 90 (51.7) | 0.6 (0.4–0.9) | 0.6 (0.3–1.1) | 0.7 (0.4–1.1) | 0.02 | 0.19 | 0.19 | |
| AA | 26 (13.0) | 7 (10.2) | 19 (14.3) | 30 (10.4) | 7 (6.14) | 23 (13.2) | 1.00 (reference) | 1.00 (reference) | 1.00 (reference) | - | - | - | |
| GG + AG | 174 (87.0) | 61 (89.7) | 113 (85.6) | 253 (89.3) | 107 (93.8) | 151 (86.7) | 1.2 (0.7–2.2) | 1.7 (0.5–5.2) | 1.1 (0.5–2.1) | 0.46 | 0.46 | 0.89 | |
| T, total; F, females; M, males; SNP, Single nucleotide polymorphism; OR, Odds ratio; CI, confidence interval. Data are presented as numbers (%). | |||||||||||||
Evaluation of the clinical manifestations of BD among patients with different genotypes and alleles of leptin and adiponectin gene variants revealed only significant statistical associations between Leptin SNPs and genital aphthous (Table 4). As it is shown in Table 4, genital aphthous was rarely seen in male patients carrying rs7799039AG (p = 0.02). Of interest, genital aphthous was more frequently seen in patients carrying rs2167270AA genotype (p = 0.03). After gender stratification, the results remained significant for female patients (p = 0.04). Consistent with the genotypic data, we found that the A allele was more frequent in total and female patients with genital aphthous (p = 0.02 and p = 0.007, respectively).
| SNP | Genital aphthous | OR (95% CI) | p-value | ||||||||||
| Yes | No | ||||||||||||
| T | M | F | T | M | F | T | M | F | T | M | F | ||
| rs7799039 Genotypes | AA | 45 (23.3) | 20 (28.9) | 25 (20.1) | 17 (20.2) | 5 (13.5) | 12 (27.2) | 1.00 (reference) | 1.00 (reference) | 1.00 (reference) | - | - | - |
| AG | 94 (48.7) | 30 (43.4) | 64 (51.6) | 52 (61.9) | 29 (70.2) | 23 (52.2) | 1.4 (0.76–2.8) | 3.8 (1.28–11.7) | 0.75 (0.32–1.73) | 0.32 | 0.02 | 0.64 | |
| GG | 54 (27.9) | 19 (27.5) | 35 (28.2) | 15 (17.8) | 6 (16.2) | 9 (20.4) | 0.73 (0.33–1.63) | 1.2 (0.33–4.8) | 0.53 (0.2–1.46) | 0.58 | 1.0 | 0.33 | |
| rs7799039 Alleles | A | 184 (47.6) | 70 (50.7) | 114 (53.2) | 86 (51.2) | 36 (48.6) | 47 (53.4) | 1.00 (reference) | 1.00 (reference) | 1.00 (reference) | - | - | - |
| G | 202 (52.3) | 68 (49.2) | 99 (46.4) | 82 (48.8) | 41 (51.3) | 41 (46.5) | 1.1 (0.8–1.6) | 0.8 (04-1.4) | 0.99 (0.6–1.6) | 0.50 | 0.67 | 1.0 | |
| rs2167270 Genotypes | GG | 51 (37.5) | 19 (47.5) | 32 (33.3) | 23 (53.4) | 9 (47.3) | 14 (58.3) | 1.00 (reference) | 1.00 (reference) | 1.00 (reference) | |||
| AG | 61 (44.8) | 17 (42.5) | 44 (45.8) | 18 (41.8) | 9 (47.3) | 9 (37.5) | 0.6 (0.31–1.3) | 1.11 (0.36–3.4) | 0.46 (0.18–1.2) | 0.32 | 1.0 | 0.17 | |
| AA | 24 (17.6) | 4 (10.0) | 20 (20.8) | 2 (4.65) | 1 (5.26) | 1 (4.16) | 0.1 (0.04–0.8) | 0.52 (0.0.05–5.4) | 0.1 (0.01–0.9) | 0.03 | 0.98 | 0.04 | |
| rs2167270 Alleles | G | 163 (59.9) | 55 (62.5) | 108 (56.2) | 64 (74.4) | 27 (72.9) | 37 (78.7) | 1.00 (reference) | 1.00 (reference) | 1.00 (reference) | |||
| A | 109 (40.1) | 25 (28.4) | 84 (43.7) | 22 (25.5) | 10 (27.0) | 10 (21.2) | 0.54 (0.2–0.8) | 0.8 (0.3–1.9) | 0.37 (0.1–0.7) | 0.02 | 0.8 | 0.007 | |
| T, total; M, male; F, female; Data represented as number (%). P values less than 0.05 are significant. | |||||||||||||
Results of haplotype analysis for leptin and adiponectin gene variants revealed no significant differences between BD patients and healthy controls (data not shown).
Our results revealed significantly higher levels of adiponectin in BD patients compared to the healthy controls (6818 ± 512 and 5107 ± 456 pg/ml, respectively; p = 0.01), but no significant differences were seen for leptin (15263 ± 3076 and 13927 ± 2277 pg/ml, respectively; p = 0.85) (Fig. 1). Interestingly, our results showed that patients with genital aphthous have significantly elevated levels of leptin compared to those without such manifestation (7411 ± 616 and 5039 ± 662 pg/ml, respectively, p = 0.04). No significant association was identified between the adiponectin and leptin gene variants and their serum levels in this study.
The exact etiology of BD remains elusive, but genetic factors play essential roles [20]. Genome-wide association studies have suggested that special genetic variants might predispose individuals to autoimmune diseases like BD [21–24]. The possible roles of leptin and adiponectin gene polymorphisms in the pathogenesis of multiple sclerosis, coronary artery disease, diabetes mellitus, and atopic dermatitis have been well-indicated [16, 25–27]. Here, the possible associations between adiponectin and leptin gene variants, as well as their serum levels and BD were evaluated among Iranians. Our results proved several associations between leptin gene variants rs7799039 and rs2167270 and BD susceptibility and its clinical manifestation but no significant associations were found between adiponectin SNPs rs1501299 and rs266729 and BD.
We indicated that the frequencies of leptin rs7799039AG and GG genotypes and rs7799039G allele, as well as G allele carriers (AG + GG), were significantly more in BD patients compared to healthy individuals. After gender stratification, all the results remained significant in males except for the AG genotype that remained significant in females. Of interest, genital aphthous had a significantly lower frequency in male patients carrying AG genotype. These results probably indicate the protective role of the A allele in male individuals. Furthermore, carriers of the G allele had a greater risk of BD among men and may suggest the G allele as a risk allele for BD development in males.
We found that patients had significantly more rs2167270AG, AG + AA genotypes, and rs2167270A allele compared to healthy subjects. Of note, genital aphthous was more frequently seen in patients carrying rs2167270AA genotype and rs2167270A allele. After gender stratification, these results remained significant in female patients. It can be suggested that the A allele carriers were associated with increased risk of BD and may point to a role for this genotype in BD development. Few studies have focused to assess the correlation between leptin polymorphisms and BD risk. In contrast to our study, Aydin et al. found no significant relationship between leptin gene polymorphism and the incidence and clinical manifestation of BD [28]. A study by Okudan et al. has also shown no significant correlation between the oligopolymorphic codon 25 (CAA/CAG) of leptin, serum level of leptin, and BD [29]. Such discrepancies between our findings and others might be due to the differences in ethnicity, environmental factors which probably affect gene expression, clinical heterogeneity, and small sample size.
For the first time, we examined the possible associations between rs1501299 and rs266729 of adiponectin gene and BD susceptibility. However, no significant association was found between these SNPs and BD that confers these genetic variants might not be involved in BD susceptibility. Our data also revealed significantly elevated serum levels of adiponectin in BD patients but leptin levels were not statistically different between patients and healthy subjects. Several studies have indicated increased serum levels of adiponectin in the case of autoimmune diseases [30, 31]. In such situations, adiponectin might aggravate or attenuate the inflammation [11, 32, 33] hence, more investigations are needed to address the precise role of adiponectin in BD patients. Additionally, we indicated that those patients with genital aphthous had significantly elevated levels of leptin but previous reports have shown such a situation in BD patients compared to healthy subjects [29, 34]. Elevated levels of leptin have also been shown in the active form of BD and patients with longer disease duration [34]. Our results need to be confirmed by functional studies and further studies using larger sample sizes are needed to verify our results.
In summary, our data suggest that leptin gene variants rs7799039 and rs2167270 might predispose the Iranian population to BD. Moreover, the elevated serum level of adiponectin in patients might confer a role for this adipokine in the pathogenesis of BD.
Compliance with Ethical Standards
All procedures performed in studies involving human participants were in accordance with the ethical standards of the institutional and/or national research committee and with the 1964 Helsinki declaration and its later amendments or comparable ethical standards. Informed consent was obtained from all individual participants included in the study.
Consent for publication
Not applicable
Availability of data and materials
The datasets generated and/or analyzed during the current study are not publicly available but are available from the corresponding author on reasonable request.
Competing interests
The authors report there are no competing interests to declare.
Funding
Not applicable.
Authors' contributions
All authors have read and approved the final manuscript. N.G. and G.D. conceived and designed the study, analyzed the data, interpreted the data, and wrote the manuscript. F.R.K., helped in data analysis and drafting the manuscript. Z.A helped in writing the manuscript.