Selenium nanoparticles reduce cardiomyocyte apoptosis in Ascites Syndrome in Broiler Chickens via the ATF6-DR5 signaling pathway

doi:10.21203/rs.3.rs-1656105/v1

Download PDF

Research Article

Selenium nanoparticles reduce cardiomyocyte apoptosis in Ascites Syndrome in Broiler Chickens via the ATF6-DR5 signaling pathway

https://doi.org/10.21203/rs.3.rs-1656105/v1

This work is licensed under a CC BY 4.0 License

You are reading this latest preprint version

Broiler ascites syndrome (AS) is one of the main diseases threatening the health of broilers. It is well-documented that Myocardial hypertrophy and failure is one of the critical mechanisms in broiler ascites syndrome, and preventing cardiac hypertrophy and failure to cardioprotection may be one of the targets for lowering the incidence of broiler ascites syndrome. Nano-selenium has received a lot of attention in the biomedical field in recent years due to its unique physicochemical properties and potential applications in drug development and targeted therapy. The antioxidant capabilities of nano-selenium have been demonstrated to inhibit apoptosis. To investigate the impact of nano-selenium on broiler chicken heart injury caused by broiler ascites syndrome, we created a broiler chicken cardiomyocyte apoptosis model and a broiler chicken ascites syndrome model. Pretreatment of broiler cardiomyocytes with nano-selenium reduced oxidative stress and apoptosis caused by hydrogen peroxide, according to our findings. Furthermore, nano-selenium supplementation with broiler chickens' diets that inactivated the endoplasmic reticulum stress signaling system (ATF6-DR5). The current study sought to demonstrate that nano-selenium protects injured myocardium in a broiler ascites model, and the proposed mechanism is linked to the ATF6-DR5 signaling pathway, opening up new avenues for medication development to prevent and treat broiler ascites disease.

broiler chicken ascites syndrome

cardiomyocyte apoptosis

nano-selenium

ATF6-DR5 signaling pathway

Broiler AS is a metabolic disease characterized by the accumulation of large amounts of yellow fluid in the abdominal cavity with varying degrees of damage to the heart, lungs, kidneys, and other organs [1]. It is also known as 'pulmonary hypertension syndrome (PHS) in broilers [2]. Its etiology is complex and usually results from multiple causative factors [3]. Broiler breeders primarily reduce the incidence through integrated control, the primary means of which are optimal feeding management and pharmacological control [4]. There is no specific drug for the treatment of broiler ascites; instead, it is treated based on the disease's causative mechanism, with the appropriate drugs used to prevent and control it [4]. Myocardial hypertrophy and failure is one of the important mechanisms in the development of broiler ascites, and excessive apoptosis of cardiomyocytes can cause irreversible damage to the myocardium [5]. Studies have shown that endoplasmic reticulum stress (ERS) is involved in the development of various cardiac diseases, such as myocardial hypertrophy and heart failure, and ERS is a key process that regulates the death/survival mechanism of cardiomyocytes in response to stress stimuli, thus triggering heart failure [6]. It has also been shown that compound Zhen Wu Tang can antagonize right heart hypertrophy in broiler chickens because of its cardiotonic effect, thus reducing the incidence of AS [7]. As a result, inhibiting ERS development and myocardial apoptosis is a critical strategy for preventing myocardial injury, which can lead to the development of AS.

Because of its size, shape, and unique physicochemical properties, nano-selenium has become a trending research topic in recent years, and its preparation methods, properties, and potential applications in life sciences have piqued the interest of many researchers [8–9]. Studies have shown that nano-selenium not only has strong antioxidant properties but also can exert its antioxidant function by regulating multiple signaling pathways such as p38 MAPK and ASK1/JNK, removing excess ROS and inhibiting lipid peroxidation, thereby inhibiting oxidative stress-induced apoptosis [10]. However, it remains to be seen whether nano-selenium supplementation protects against myocardial injury caused by ascites syndrome in broiler chickens, as well as the underlying molecular mechanisms.

Endoplasmic reticulum stress is one of the apoptotic pathways in cardiac myocytes, and glucose-regulated protein78 (GRP-78) is a signature protein of endoplasmic reticulum stress [11]. Transcriptional activation factor 6 (ATF-6) is a transmembrane sensor of the endoplasmic reticulum that is activated upon dissociation from GRP-78 [12]. Activated ATF-6 can enter the nucleus and induce the expression of CCAAT enhancer binding proteins (CHOP) [13]. Overexpression of CHOP can activate the DR5 receptor, which can only trimerize the receptor by adhering to tumor necrosis factor apoptosis-related ligands to form the death-inducing signaling complex (DISC) [14]. Then the caspase cascade reaction is activated and caspase 3 was directly activated by caspase 8 and caspase 9 [15]. Endoplasmic reticulum stress was shown to be a key process regulating the death/survival mechanism of cardiomyocytes under stress [6]. Therefore, targeting the ATF6-DR5 signaling pathway may be involved in the anti-apoptotic effect of nano-selenium, which helps to analyze the mechanism related to the antagonism of nano-selenium against cardiomyocyte apoptosis.

We investigated whether selenium nanoparticles could inhibit apoptosis in broiler ascites-derived cardiomyocytes by modulating the endoplasmic reticulum-related signaling pathway (ATF6-DR5), as well as the mechanism by which selenium nanoparticles inhibit apoptosis. This study can be used to aid in the clinical prevention and treatment of broiler ascites.

Synthesis of selenium nanoparticles

The original selenium nanoparticles were created and surface modified using the protocol described in [16]. Briefly, for 20 mmol/L sodium selenite (Na₂SeO₃) solution (China, Sinopharm Group Chemical Reagent Co., Ltd.), take 5 mL of sodium selenite solution and add 5 mL of 30 mmol/L potassium iodide solution (China, Sinopharm Group Chemical Reagent Co., Ltd.) and mix well, then put it on a magnetic stirrer for 10 min. then slowly add 5 mL of 60 mmol/L ascorbic acid solution (China, Sinopharm Group Chemical Reagent Co., Ltd. During the reaction, the color of the solution gradually changed from colorless to orange-red. After the reaction, the above colloidal solution was continued to be aged for 24 h. The synthesized nano-selenium was dialyzed for 2–3 d to remove the excess ascorbic acid, sodium selenite. To modify the selenium nanosurface,0.64 mg/mL chitosan (Feiyang Bio, China) was used.

Characterization of selenium nanoparticles

The selenium content was measured using an inductively coupled plasma emission spectrometer (Agilent, USA) in high-energy helium mode (HE He). The surface morphology and particle size of selenium nanoparticles were observed and photographed using a transmission electron microscope (HITACHI, Japan) at an accelerating voltage of 80 kV. Electrophoretic light scattering with a zeta potential analyzer (Malvern, UK) was used to determine the zeta potential of selenium nanoparticles at a measurement temperature of 25°C, an incidence angle of 90°, and a solvent refractive index of 1.33. Each measurement had a total of 100 measurements, and each sample was repeated three times.

Primary culture of broiler cardiomyocytes

Cardiomyocytes from 12-day-old chick embryonic eggs were isolated (Shandong Texas 817 crossbred white broiler breeder eggs). Under aseptic conditions, embryonic hearts were removed and minced, and the myocardial tissue was repeatedly rinsed with Hanks' solution. The supernatant was discarded and the precipitate was retained. The tissue blocks were digested in 0.12 percent collagenase (Biosharp, China) for approximately 9 min (with gentle shaking every 2–3 min) before being blown with a pointed pipette. The supernatant was transferred into another sterile centrifuge tube after each digestion and sedimentation, and the digestion was terminated by adding cold medium containing 10% fetal bovine serum (China, HYCEZMBIO), and the process was repeated five times. The supernatant was collected in a centrifuge tube, centrifuged at 1200 r/min for 8 min, the supernatant was discarded, and DMEM-F12 medium containing 0.1 mmol/L Brdu (China, Biosharp) was added to blow the precipitate to form a cell suspension, placed in sterile culture vessels, and incubated for 90 min in a 5 percent CO₂ constant temperature (37°C) incubator. The fibroblasts stuck together. After 90 min of incubation, the fibroblasts quickly adhered to the wall and sank to the bottom of the bottle, whereas the cardiomyocytes did not. The cell suspension was aspirated and transferred to another culture bottle, yielding cardiomyocytes with a purity of 95% or higher. When the cells had achieved approximately 80% fusion and pulsating cardiomyocytes, the myocardial cells were digested with 0.25 percent trypsin and used in subsequent experiments.

Cell test grouping and processing

The test was divided into four groups: control (con), selenium (Se), selenium + hydrogen peroxide (Se + H₂O₂), and hydrogen peroxide modeling (H₂O₂). Cardiomyocytes in the Se group were treated with nano-selenium for 24 hours. The Se + H₂O₂ group treated cardiomyocytes with nano-selenium for 24 hours, then removed the nano-selenium and treated the cardiomyocytes with hydrogen peroxide for 4 hours. The H₂O₂ group applied hydrogen peroxide directly to cardiomyocytes for 4 hours. For 4 hours, the H₂O₂ group was exposed to hydrogen peroxide directly on cardiomyocytes[17–18].

CCK-8 Assay

Using CCK-8 kit (Biosharp, China) to detect cell viability to verify the effect of hydrogen peroxide on broiler cardiomyocytes, and to verify the effect ofnano-selenium on broiler cardiomyocytes. Add 10 µL of CCK-8 solution to each well, taking care to avoid light, and incubate in the incubator for 2 h. Add medium to the wells without cells in them, and add 10 µL of CCK-8 solution to set up a blank control. Measure the OD value.

ROS Assay

DCFH-DA was diluted 1:1000 with serum-free medium to a final concentration of 10 µmol/L using the ROS assay kit (Bain Marie, China). A sufficient volume of diluted DCFH-DA was added to adequately cover the cells, and the cells were incubated in the dark at 37°C for 20 min. Cells were washed three times with serum-free medium before being examined under a fluorescence microscope (Japan Nikon).

Apoptosis rate analysis

Follow the Annexin V-FITC/PI Apoptosis Assay Kit's instructions (Biosharp, China). Cardiomyocytes were digested with EDTA-free trypsin for about 2 min before being transferred to a centrifuge tube and centrifuged at 1200 r/min for 10 min. The cells were collected and twice washed in PBS solution. After resuspending the cell precipitates in 100 µL Binding Buffer working solution, 5 µL Annexin V-FITC and 5 µL Propidium Iodide PI were added. After 15 minutes at room temperature and protection from light, cells were analyzed by flow cytometry (Beckman Coulter, USA).

Animals and Treatment

All experimental procedures were approved by the Scientific Ethics Committee of Huazhong Agricultural University. After one week of normal feeding, 48 1-day-old male broilers were randomly divided into four groups: the saline + selenium group (Se + Y) and the saline group (Y) received brine containing 5 mg/L sodium chloride (NaCl), while the control and selenium groups (con and Se) received purified water (0 mg/L NaCl). Broilers in the selenium (Se) and saline + selenium (Se + Y) experimental groups received 1 mg/kg of nano-selenium colloidal solution daily. During the 28-day feeding period, there were no dietary restrictions[19–21].

Calculation of AHI

The ascites heart index (AHI) reflects the degree of right heart hypertrophy and is used to diagnose ascites syndrome in broiler chickens. After dissecting the chicken, the heart was removed and washed with saline to remove the clot. The atrium was incised along the coronary sulcus and the anterior and posterior longitudinal sulci, the right ventricle and the left ventricle (including the atrial septum) were separated, and the mass ratio of the right ventricle to the entire ventricle (RV/TV) was calculated.

Biochemical Assays

Serum samples were tested using a fully automated biochemical analyzer to determine the activity levels of cardiac function-related indicators: glutamic aminotransferase (AST), creatine kinase (CK), and lactate dehydrogenase (LDH) (Myriad Biomedical Electronics Co., Ltd., China).

Antioxidant Assay

Broiler serum was taken at 4°C and serum samples were processed according to the kit instructions to determine the activities of glutathione peroxidase (GSH-Px), malondialdehyde (MDA), total antioxidant capacity (T-AOC), superoxide dismutase (SOD) and catalase (CAT) expression (Nanjing Jiancheng Institute of Biological Engineering, Nanjing, China).

Quantitative RT-PCR

Total RNA was extracted and purified from broiler heart tissues using Trizol solution (Eric Biotechnology Co., Ltd., China), reverse transcribed into cDNA using TSK302M Goldenstar™ RT6 cDNA Synthesis Kit Ver.2 kit (Beijing DynaScience Biotechnology Co., Ltd., China), and real-time quantitative PCR was performed using TSE202 2×T5 Fast qPCR Mix Kit (Beijing, China) was used for real-time quantitative PCR, and the relative expression was calculated using the 2-ΔΔct method. The QRT-PCR primers are shown in Table 1.

Table 1

Primer sequences used for the RT-qRCR
Gene	Primer Sequence (5’-3’)
β-actin	Forward 5’- ATGCCTTGCCCCATGCTATT- 3’ Reverse 5’- AATCTCCCGTTCCGCAGTG − 3’
Caspase3	Forward 5’- CCACCGAGATACCGGACTGT- 3’ Reverse 5’- ACTGCTTCGCTTGCTGTGAT − 3’
Caspase9	Forward 5’- CTGCCTGCACTGACTTCTGA- 3’ Reverse 5’- AATCTCCCGTTCCGCAGTG − 3’
Bcl-2	Forward 5’- TCGTCGCCTTCTTCGAGTTC- 3’ Reverse 5’- CCACAAAGGCATCCCATCCT- 3’
Bax	Forward 5’- ATCGTCGCCTTCTTCGAGTT − 3’ Reverse 5’- ATCCCATCCTCCGTTGTTCT − 3’
GRP-78	Forward 5’- TCGGAACCACCTACTCTTGC − 3’ Reverse 5’- ACGGTTTCCTTGGTCGTTGA − 3’
ATF-6	Forward 5’- GACGAGCCCGACTCATTTCA- 3’ Reverse 5’- GGCTCCGTCTTCACATTTGC- 3’
CHOP	Forward 5’- GGTGCACAGCAGGAAGAAGA- 3’ Reverse 5’- CTCATCCAGCTCACAGCACA − 3’

Western Blot

The protein concentration of broiler heart tissue was determined using a BCA kit (Biotian Biotechnology Co., Ltd., China), and the protein samples were denatured by boiling after being added to the loading buffer (Biosharp, China). The protein samples were separated by SDS-PAGE (Wuhan Bachandu Biotechnology Co., Ltd., China), and the proteins on the gel were transferred to PVDF membranes. Then, the membranes were blocked by 5 percent skimmed milk (Wuhan Bachandu Biotechnology Co., Ltd., China) for 2 hours at room temperature, followed by overnight incubation with primary antibody at 4°C. After that, the corresponding secondary antibody was added and incubated at room temperature for 1.5 hours. the protein expression density was detected with imaging system (Japan, Nikon).

Data statistics and analysis of the experiment

Significance analysis was performed using the software Graph Pad Prism 7.0, and the test results were expressed as mean ± standard deviation (Mean + SD), and the difference between the test groups compared to each other was expressed as * for (p < 0.05), ** for (p < 0.01), "#" for (p < 0.05), and## for (p < 0.01).

Preparation and characterization results of selenium nanoparticles

The selenium nanoparticles prepared using the ascorbic acid reduction method were red in color (Fig. 1a), and the chitosan selenium nanoparticles were more dispersed spherical particles with an average particle size of 117.3 nm and a zeta potential of + 60.5 mV (Fig. 1b-e). The selenium content in chitosan nano-selenium was determined to be 1726535 µg/L using inductively coupled plasma mass spectrometry (ICP-MS) (Table 2).

Table 2

Analysis of the results of selenium content determination by ICP-MS
Name of sample	Seleniumconcentration(µg/L)	RSD/%
CS-SeNP-1	17052.96	0.78
CS-SeNP-2	17456.22	0.81
CS-SeNP-3	17286.88	0.57
Average	17265.35
The sample is diluted 100 times and measured 3 times

Results of CCK-8 assay of cardiomyocyte activity

Using the CCK-8 method, the peroxide modeling concentration was determined, and the IC₅₀ was calculated as 169.4 µmol/L using GraphPad Prism 7.0 software, with 200 µmol/L as the modeling concentration (Fig. 2a). nano-selenium at low concentrations (0.001, 0.01, 0.1, and 1 µmol/L) had no proliferative effect on chicken cardiomyocytes. When the concentration of nano-selenium was increased to 5 µmol/L, it had a highly significant cellular proliferative effect on cardiomyocytes (p < 0.01). The nano-selenium concentration used in this experiment had no effect on chicken cardiomyocyte proliferation. For the follow-up test, a nano-selenium concentration of 1 µmol/L was chosen to investigate nano-selenium's anti-apoptotic effect on chicken cardiomyocytes (Fig. 2b).

Nano-selenium reduces H₂O₂-induced ROS production

Myocardial hypertrophy and failure are accompanied by a sustained increased oxygen radical response, such as the excessive production of oxygen radicals (ROS), which is also linked to myocardial apoptosis. Figure 3 shows the graph of the results of reactive oxygen species (ROS) detection in each group of broiler cardiomyocytes. Compared with the control group, ROS content in the H₂O₂ groups were highly significant increase (p < 0.01); a highly significant decrease in ROS content in the Se + H₂O₂ group compared with the H₂O₂ group (p < 0.01). We observed nano-selenium scavenging ROS generated by H₂O₂-induced oxidative stress.

Nano-selenium alleviates H₂O₂-induced apoptosis in chick cardiomyocytes

As shown in Fig. 4, compared with the con group, the apoptosis rate was highly significant higher in the H₂O₂ group (p < 0.01), and the apoptosis rate in the Se + H₂O₂ group was significantly higher than that in the con group (p < 0.05), the results of the Se + H₂O₂ group compared with the H₂O₂ group indicated that nano-selenium could reduce the apoptosis rate (p < 0.01) and inhibited the peroxide induced cardiomyocyte apoptosis.

Nano-selenium effectively reduce the heart index of ascites in broilers

Figure 5 shows the results of the analysis of the ascites cardiac index (RV/TV), compared with the con group, the ascites index of the Y group was extremely significantly greater than that of the con group (p < 0.01), and there was a significant difference between the ascites index values of the Se + Y group and the con group (p < 0.05). The RV/TV value can reflect the occurrence of pulmonary hypertension (PH) in broilers. The value of ascites index in group Y was much greater than 0.28[20], which predicted the right ventricular hypertrophy and pulmonary hypertension in group Y broilers.

Nano-selenium reduce enzyme indicators related to myocardial injury in Broiler myocardium

The results of serum cardiac function test in broiler chickens are shown in Fig. 6. Compared with the con group, CK and AST activities were significantly higher (p < 0.05), and LDH levels increased significantly (p < 0.01) in the Y group. compared with the Se + Y group, the Y group showed significantly higher AST, CK and LDH activities (p < 0.05). The results showed that nano-selenium could inhibit the increase of enzyme indexes related to myocardial injury and, to some extent, reduce the degree of myocardial injury.

Nano-selenium activates antioxidant enzyme system in broilers

Figure 7 depicts the results of antioxidant function indexes in serum. In the Y group, CAT, GSH-Px, SOD, and T-AOC activities were significantly lower than in the control group, while MDA levels were significantly higher. However, after selenium nano-treatment (Se + Y group), these changes were significantly reversed (p < 0.05), and serum total antioxidant capacity was significantly increased (p < 0.05), but GSH-Px and SOD activities were not significantly reversed. To summarize, nano-selenium treatment may reduce oxidative stress.

Nano-selenium antagonizes the expression of apoptosis-related genes in the ATF-6-DR5 signaling pathway

The mRNA expression of related genes in ATF-6-DR5 signaling pathway in heart tissues was detected by real-time fluorescence quantitative PCR, and the relative quantification was taken to process the results. The results showed (Fig. 8) that the mRNA expressions of caspase3, caspase9, Bax, ATF-6, GRP-78, and CHOP in the Y group were extremely significantly higher than those in the con group compared with the con group (p < 0.01). The mRNA expression levels of caspase3 and caspase9 were significantly lower in the Se + Y group compared with the Y group (p < 0.05), and the mRNA expression levels of ATF-6, Bax, GRP-78, Bcl-2 and CHOP were highly significantly lower in the Se + Y group (p < 0.01).

Nano-selenium antagonizes the expression of apoptosis-related proteins in the ATF-6-DR5 signaling pathway

Figure 9 shows that nano-selenium inhibited apoptosis in broiler cardiomyocytes via the endoplasmic reticulum stress ATF-6-DR5 signaling pathway, and its related factors of protein assay results. GRP-78 and ATF-6 protein expression were significantly higher in group Y compared to the control group (p < 0.01), and CHOP, caspase 12, caspase 3, caspase 9, and Bax protein expression were also significantly higher (p < 0.05). GRP-78 and Bax protein expression were significantly lower in the Se + Y group versus the Y group (p < 0.05); ATF-6, CHOP, caspase 12, and caspase 9 protein expression were significantly lower in the Se + Y group versus the Y group (p < 0.01). Bcl-2 protein expression was significantly lower in the Y group compared to the control group(p < 0.05). Bcl-2 protein expression was significantly higher in the Se + Y group than in the Y group (p < 0.01). These findings suggest that nano-selenium protects myocardium from broiler ascites via the endoplasmic reticulum stress ATF-6-DR5 signaling pathway.

Broiler ascites syndrome is a disease caused by metabolic disorders that is common and poses a serious threat to broiler health while also limiting the economic benefits of broiler farming [22]. Myocardial hypertrophy and failure are critical links in the development of broiler ascites syndrome[5]. The onset of cardiac hypertrophy and failure is accompanied by a sustained increased oxygen radical response, such as the production of large amounts of ROS and Lipid Hydroperoxide, which can cause cell membrane damage, which in turn causes DNA damage and eventually induces cardiomyocyte death via apoptosis[23]. Apoptosis of cardiomyocytes is a critical component of this pathogenesis [24]. Excessive apoptosis of cardiomyocytes causes irreversible myocardial damage to the heart, resulting in cardiac hypertrophy and failure, ascites, and even death [6]. Furthermore, endoplasmic reticulum stress is linked to a variety of cardiovascular diseases [6]. Selenium (Se), an essential trace element in humans and animals, is involved in numerous important physiological processes and exerts biological effects in the form of selenoproteins [25]. Selenoproteins are powerful antioxidants that play a role in immune enhancement and the prevention of cardiovascular disease[26]. To maintain the body's normal functioning, selenium nanoparticles scavenge ROS by converting into selenoproteins with antioxidant functions and promoting the synthesis of antioxidant enzymes[27].

Apoptosis in cardiomyocytes was induced by molding with hydrogen peroxide (China, Sinopharm Chemical Reagent Co., Ltd.)[17]. A hydrogen peroxide concentration gradient of 50, 100, 200, 300, and 400 µmol/L was designed and tested for 4 hours[18]. The hydrogen peroxide concentration close to the IC₅₀ was discovered to be the optimal concentration for modeling by measuring CCK-8[17]. The IC₅₀ was calculated using the GraphPad Prism 7.0 software based on the CCK-8 assay results, and a concentration close the IC₅₀ of 200 µmol/L hydrogen peroxide was used to replicate the apoptosis model by operating on the cells for 4 hours. The concentration of 200 µmol/L hydrogen peroxide applied to cells for 4 hours caused 23.2 percent early apoptosis and 16.3 percent late apoptosis, and the addition of Nano-selenium (1 µmol/L) reduced the early apoptosis rate by 9.2 percent and the late apoptosis rate by 12.16 percent. The findings showed that 1 µmol/L nano-selenium effectively reduced cardiomyocyte apoptosis caused by hydrogen peroxide simulation. In this experiment, the ROS assay was used to assess the effect of nano-selenium on hydrogen peroxide-induced oxidative stress in chicken cardiomyocytes. The fluorescence intensity of the Se + Y group was significantly lower than that of the Se + Y group, implying that nano-selenium inhibited hydrogen peroxide-induced oxidative stress in cells.

The biological effects of nano-selenium are dependent on the dose and duration of action[28]. The CCK-8 results of different concentrations of nano-selenium on chicken cardiomyocytes for 24 hours revealed that the lower concentration of nano-selenium had no significant effect on cardiomyocyte activity, that when the concentration of nano-selenium was gradually increased to 5 µmol/L, nano-selenium showed a significant proliferative effect on chicken cardiomyocytes, and that when the concentration of nano-selenium reached 10 µmol/L, The effect on the survival rate of chicken cardiomyocytes tended to the blank control group when the nano-selenium concentration reached 100 µmol/L, and there was a steady trend to suppress cell activity. Although nano-selenium is biocompatible and has a low toxicity, a high concentration of nano-selenium acting on cells may cause a Trojan horse effect, and the nano-small selenium's particle size allows for uncontrolled passage across the cell barrier, which may have negative effects on cells[29].

It has been demonstrated that broiler antioxidant capacity is proportional to selenium levels within a certain range, and GSH-Px activity in broiler serum and tissues increases with increasing selenium levels in the diet[30-[31], and when GSH-Px activity in serum reaches a plateau, GSH-Px activity does not increase further with increasing selenium concentration in the diet [32]. The activities of SOD, GSH-Px, and CAT in broiler serum were not significantly different between the Se and con groups in this experiment because the feed fed to the con group also had the basic selenium content of poultry. Meanwhile, the Se group added 1 mg/kg of nano-selenium to the basic diet. As stated above, when 0.15 mg/kg–1 mg/kg selenium was added to the diet, the activation response of broiler GSH-Px reached its peak [32]. The GSH-Px activity in the serum of broilers after a certain dose of selenium intake did not increase with the increase of selenium level.

Furthermore, oxidative stress regulates many selenoproteins. For example, GPx1, GPx4, and TRx1 expression levels have been shown to be upregulated during oxidative stress[33]. The expression of their associated cardioprotective selenoproteins and selenases has been shown to increase during cardiovascular oxidative stress [34], and mRNA and protein levels of MSRB1, TRx1, GPx3, and GPx4 were significantly increased in T3 or isoproterenol-induced myocardial hypertrophy[35].The results of this experiment revealed that there was no significant difference in serum GSH-Px activity between the Se + Y group and the Y group, and there was no significant difference in serum SOD activity between the Se + Y group and the Y group. SOD can scavenge oxygen radicals in the body, and its level in the organism can reflect the organism's ability to scavenge ROS indirectly. Serum CAT and T-AOC activities were significantly higher in the Se + Y group compared to the Y group, and MDA content was significantly lower in the Se + Y group. To sum up, nano-selenium can reduce oxidative stress in broiler chickens caused by brine modeling by increasing antioxidant enzyme activity.

The protein expression of ERS-related signaling pathways in broiler heart tissues was detected using Western Blot in this in vitro trial. The results of this experiment revealed that the expression levels of GRP-78, ATF-6, and CHOP proteins were significantly lower in the Se + Y group when compared to the Y group, indicating that Nano-selenium can reduce apoptosis in cardiomyocytes by inhibiting ERS. When ERS occurs, high levels of CHOP are induced[36], and high levels of CHOP induce the expression of apoptotic proteins such as GADD34 and DR5, where the DR5 receptor forms the death-inducing signaling complex (DISC), which activates the caspase cascade reaction. The results of this experiment showed that the Se + Y group had significantly lower caspase 3 and caspase 9 protein expression levels compared to the Y group, indicating that Nano-selenium could inhibit the activation of apoptotic proteins associated with the downstream of the ATF6-DR5 signaling pathway, thereby alleviating the occurrence of apoptosis in vivo. Overexpression of CHOP can also promote the production of ROS, which causes long-term endoplasmic reticulum stress and mediates apoptosis[37]. When high levels of CHOP protein can cause a decrease in Bcl-2 expression, this can also result in Bax translocation from the cytoplasm to the mitochondria and the initiation of the mitochondrial apoptotic pathway [36]. The current study found that the Se + Y group simultaneously decreased Bax protein expression while increasing Bcl-2 protein expression when compared to the Y group, and that Nano-selenium could inhibit caspase12 protein expression on the endoplasmic reticulum membrane.

In summary, this study shows that Nano-selenium can maintain endoplasmic reticulum homeostasis by inhibiting the expression of GRP-78, ATF-6, CHOP, caspase 12 and its downstream apoptosis-related proteins caspase 9, caspase 3, Bax, and increasing the expression level of Bcl-2, thereby alleviating cardiomyocyte apoptosis and reducing myocardial injury in broiler chickens. Broiler chicken myocardium was treated with nano-selenium. The ATF6-DR5 signaling pathway may be involved in the potential molecular mechanism.

Author Contribution

Conceptualization, Xin Liu; investigation, Xin Liu; writing – original draft, Xin Liu; writing – review and editing, Xiaoqi Yang, Jiabin Zhang, Jiaqi Liu, Yang Fu, KYEIN SAN LOON,Mengdi Zhang,Yuxuan Peng; supervision, Donghai Zhou; project administration, Donghai Zhou; funding acquisition, Donghai Zhou.

Funding

Central Fundamental Research Fund for Universities (No. 2662020DKPY013); Thirteenth Five-Year Plan Key R&D Program (No. 2016YFD0501208).

Data Availability

The authors confirmed that all data on which the study results are based are available without restriction. All relevant data are in the paper and its supporting information files.

Conflict of Interest

The authors state that there are no competing interests.

Tafti AK, Karima MR (2000) Morphological studies on natural ascites syndrome in broiler chickens.Vet Arhiv 70 (5):239–250
Shi S, Shen Y, Zhang S, Zhao Z, Hou Z, Zhou H, Zou J, Guo Y (2017) Combinatory Evaluation of Transcriptome and Metabolome Profiles of Low Temperature-induced Resistant Ascites Syndrome in Broiler Chickens. Sci Rep 7(1):2389–2492
Hassanzadeh M, Buyse J, Toloei T, Decuypere E (2014) Ascites Syndrome in Broiler Chickens: A Review on the Aspect of Endogenous and Exogenous Factors Interactions. J Poult Sci (51):229–241
Dong SS (2003) The relationship between cellular calcium signaling and the development of broiler ascites syndrome. Dissertation, China Agricultural University
Julian RJ (2000) Physiological, management and environmental triggers of the ascites syndrome: A review. Avian Pathology 29(6):519–527
Wang S, Binder P, Fang Q, Wang Z, Xiao W, Liu W, Wang X (2018) Endoplasmic reticulum stress in the heart: insights into mechanisms and drug targets. Br J Pharmacol 175(8):1293–1304
Qi YH, Wang WK (2006) Effect of Zhenwu soup on the prevention and treatment of ascites syndrome in broiler chickens. Animal Husbandry and Veterinary Medicine 38(4):15–17
Khurana A, Tekula S, Saifi MA, Venkatesh P and Godugu C (2019) Therapeutic applications of selenium nanoparticles. Biomed Pharmacother 111:802–812
Patra A, Lalhriatpuii M (2020) Progress and prospect of essential mineral nanoparticles in poultry nutrition and feeding: a review. Biol Trace Elem Res 197:233–253
Sadek KM, Lebda MA, Abouzed TK, et al (2017) Neuro- andnephrotoxicity of subchronic cadmium chloride exposure and the potential chemoprotective effects of selenium nanoparticles. Metab Brain Dis 32(5):1659–1673
Zeng FQ, Li XT, Lin XY, Li YL, Yang DL (2020) Icariside ameliorates isoproterenol-induced apoptosis in mouse left ventricular myocytes through down-regulation of ATF6-DR5 signaling pathway. Chinese Pharmacological Bulletin 36(12):1674–1678
Darling NJ and Cook SJ (2014) The role of MAPK signalling pathways in the response to endoplasmic reticulum stress. Biochim Biophys Acta 1843:2150–2163
Elimam HN, Papillon J, Takano T, et al (2015) Calcium-independent phospholipase A2γ enhances activation of the ATF6 transcription factor during endoplasmic reticulum stress. J Biol Chem 290(5):3009–3029
Guan LY, Xu CM, Pan HZ (2007) Endoplasmic reticulum stress-mediated apoptosis. Progress in Biochemistry and Biophysics 34(11):1136–1141
Lu M, Lawrence DA, Marsters S, et al (2014) Opposing unfolded-pro- tein-response signals converge on death receptor 5 to control apoptosis. Science 345(6192): 98–101.
Chen WW (2020) Preparation of chitosan complexes on the basis of selenium activity. Dissertation, Jiangnan University
Wang JX, Zhang XJ, Li Q, et al (2015) MicroRNA-103/107 regulate programmed necrosis and myocardial ischemia/re⁃perfusion injury through targeting FADD. Circ Res 117(4):352–363
Zhang C, Wang Z, Wang BH, Xu Q (2019) Experimental detection of H₂O₂-induced apoptosis in cardiac myocytes by high-intensity technique A discussion of the method. Chinese Journal of Integrative Medicine on Cardio-/Cerebrovascuiar Disease 17(2):196–199
Xi ZF (2012) Anti-apoptotic effects of ARC and IGF-1 in AS broilers. Dissertation, Huazhong Agricultural University
Peng YX (2021) High-salt drinking water elevates Ang ii mediates ascites syndrome and kidney injury in broiler chickens. Dissertation, Huazhong Agricultural University
Chen M, Li X, Fan R, Cao C, Yao H, Xu S (2017) Selenium Antagonizes Cadmium-Induced Apoptosis in Chicken Spleen but Not Involving Nrf2-regulated Antioxidant Response. Ecotox Environ Safe 145: 503–510
Zhang J, Schmidt CJ, Lamont SJ (2018) Distinct Genes and Pathways Associated with Transcriptome Differences in Early Cardiac Development between Fast- and Slow-growing Broilers. PloS One 13 (12): e0207715
Konstantinidis K, Whelan RS, Kitsis RN (2012) Mechanisms of cell death in heart disease. Arterioscler Thromb Vasc Biol 32(7):1552–1562
Beckman KB, Ames BN (1999) Endogenous oxidative damage of mtDNA. Mutat Res 424(1–2):51–58
Estevez H, Garcia-Calvo E, Rivera-Torres J, Vallet-Regí M, González B, Luque-Garcia JL (2021) Transcriptome Analysis Identifies Novel Mechanisms Associated with the Antitumor Effect of Chitosan-Stabilized Selenium Nanoparticles. Pharmaceutics 13 (3):356–376
Forootanfar H, Adeli-Sardou M, Nikkhoo M, Mehrabani M, Amir-Heidari B, Shahverdi AR, Shakibaie M (2014) Antioxidant and cytotoxic effect of biologically synthesized selenium nanoparticles in comparison to selenium dioxide, J Trace Elem Med Biol 28:75–79
Rocca C, Pasqua T, Boukhzar L, Anouar Y, Angelone T (2019) Progress in the emerging role of selenoproteins in cardiovascular disease: focus on endoplasmic reticulum-resident selenoproteins. Cell Mol Life Sci 76 (20):3969–3985
Lesnichaya M, Karpova E, Sukhov B (2021) Effect of High Dose of Selenium Nanoparticles on Antioxidant System and Biochemical Profile of Rats in Correction of Carbon Tetrachloride-Induced Toxic Damage of Liver. Colloids Surf B 197: 111381
Surai PF, Kochish II (2020) Food for Thought: Nano-Selenium in Poultry Nutrition and Health. Anim Health Res Rev 21 (2):103–107
Chen G, Wu J and Li C (2013) The effect of different selenium levels on production performance and biochemical parameters of broilers. Ital J Anim Sci 12(4):486–491
Boostani A, Sadeghi AA, Mousavi SN, Chamania M and Kashana N (2015) Effects of organic, inorganic, and nano-Se on growth performance, antioxidant capacity, cellular and humoral immune responses in broiler chickens exposed to oxidative stress. Livest Sci 178:330–336
Hu CH, Li YL, Xiong L, Zhang HM, Song J and Xia MS (2012) Comparative effects of nano elemental selenium and sodium selenite on selenium retention in broiler chickens. Anim Feed Sci Technol 177:204–210
Touat-Hamici Z, Legrain Y, Bulteau AL and Chavatte L (2014) Selective upregulation of human selenoproteins in response to oxidative stress. J Biol Chem 289:14750–14761
Hoffmann FW, Hashimoto AS, Lee BC, Rose AH, Shohet RV, Hoffmann R (2011) Specific antioxidant selenoproteins are induced in the heart during hypertrophy. Arch Biochem Biophys. 512(1):38–44
Kim HY, Gladyshev VN (2007) Methionine sulfoxide reductases: selenoprotein forms and roles in antioxidant protein repair in mammals. Biomed Pharmacother 407(3):321–329
Jiang H, Li JC, Wang HJ (2012) Signaling pathways and detection methods of apoptosis. China Feed Journal 13:24–29
Liu K, Fang W, Sun E, Chen Y (2017) Roles of Endoplasmic Reticulum Stress and Apoptosis Signaling Pathways in Gynecologic Tumor Cells: A Systematic Review. Transl Oncol 3 (3):131–135

No competing interests reported.

Download PDF

Editorial decision: Major revision
14 Aug, 2022
Reviews received at journal
25 Jul, 2022
Reviewers agreed at journal
16 Jul, 2022
Reviews received at journal
17 Jun, 2022
Reviewers agreed at journal
19 May, 2022
Reviewers agreed at journal
17 May, 2022
Reviewers invited by journal
17 May, 2022
Editor assigned by journal
16 May, 2022
Submission checks completed at journal
16 May, 2022
First submitted to journal
14 May, 2022

You are reading this latest preprint version

Selenium nanoparticles reduce cardiomyocyte apoptosis in Ascites Syndrome in Broiler Chickens via the ATF6-DR5 signaling pathway

Status:

Version 1

Abstract

Figures

Introduction

Materials And Methods

Synthesis of selenium nanoparticles

Characterization of selenium nanoparticles

Primary culture of broiler cardiomyocytes

Cell test grouping and processing

CCK-8 Assay

ROS Assay

Apoptosis rate analysis

Animals and Treatment

Calculation of AHI

Biochemical Assays

Antioxidant Assay

Quantitative RT-PCR

Western Blot

Data statistics and analysis of the experiment

Results

Preparation and characterization results of selenium nanoparticles

Results of CCK-8 assay of cardiomyocyte activity

Nano-selenium reduces H₂O₂-induced ROS production

Nano-selenium alleviates H₂O₂-induced apoptosis in chick cardiomyocytes

Nano-selenium effectively reduce the heart index of ascites in broilers

Nano-selenium reduce enzyme indicators related to myocardial injury in Broiler myocardium

Nano-selenium activates antioxidant enzyme system in broilers

Nano-selenium antagonizes the expression of apoptosis-related genes in the ATF-6-DR5 signaling pathway

Nano-selenium antagonizes the expression of apoptosis-related proteins in the ATF-6-DR5 signaling pathway

Discussion

Declarations

References

Additional Declarations

Status:

Version 1

Selenium nanoparticles reduce cardiomyocyte apoptosis in Ascites Syndrome in Broiler Chickens via the ATF6-DR5 signaling pathway

Status:

Version 1

Abstract

Figures

Introduction

Materials And Methods

Synthesis of selenium nanoparticles

Characterization of selenium nanoparticles

Primary culture of broiler cardiomyocytes

Cell test grouping and processing

CCK-8 Assay

ROS Assay

Apoptosis rate analysis

Animals and Treatment

Calculation of AHI

Biochemical Assays

Antioxidant Assay

Quantitative RT-PCR

Western Blot

Data statistics and analysis of the experiment

Results

Preparation and characterization results of selenium nanoparticles

Results of CCK-8 assay of cardiomyocyte activity

Nano-selenium reduces H2O2-induced ROS production

Nano-selenium alleviates H2O2-induced apoptosis in chick cardiomyocytes

Nano-selenium effectively reduce the heart index of ascites in broilers

Nano-selenium reduce enzyme indicators related to myocardial injury in Broiler myocardium

Nano-selenium activates antioxidant enzyme system in broilers

Nano-selenium antagonizes the expression of apoptosis-related genes in the ATF-6-DR5 signaling pathway

Nano-selenium antagonizes the expression of apoptosis-related proteins in the ATF-6-DR5 signaling pathway

Discussion

Declarations

References

Additional Declarations

Status:

Version 1

Nano-selenium reduces H₂O₂-induced ROS production

Nano-selenium alleviates H₂O₂-induced apoptosis in chick cardiomyocytes