Protective effect of N-acetyl cysteine on mitochondrial dynamic imbalance in Temporal lobe Epilepsy: possible role of mTOR

doi:10.21203/rs.3.rs-1657596/v1

Download PDF

Research Article

Protective effect of N-acetyl cysteine on mitochondrial dynamic imbalance in Temporal lobe Epilepsy: possible role of mTOR

https://doi.org/10.21203/rs.3.rs-1657596/v1

This work is licensed under a CC BY 4.0 License

Version 1

posted

You are reading this latest preprint version

Epilepsy is a neurological disorder, and understanding the underlying molecular mechanisms is critical for the development of more effective therapies. It is believed that mTOR (Mechanistic Target of Rapamycin kinases) activity and the mitochondrial dynamic balance change during epilepsy. mTOR affects mitochondrial fission by stimulating the translation of mitochondrial fission process 1 (MTFP1). In this study, the protective role of N-acetylcysteine was studied in temporal lobe epilepsy (TLE) through the regulation of mTOR and mitochondrial dynamic proteins. Rats received N-acetylcysteine (oral administration) seven days before induction of epilepsy, followed by one day after epilepsy. TLE was induced by microinjection of kainite into left lateral ventricle. The total mTOR and Drp1 levels were detected in the hippocampus by western blotting. MFN1 was assessed using immunohistochemistry, and the expression of Fis.1 and MTFP1 (fission-related proteins) and OPA (fusion-related protein) was detected by real time PCR. The mitochondrial membrane potential was measured by Rhodamin 123. The results showed that 72 h after induction of epilepsy, the mTOR protein level increased, and the balance of the mitochondrial dynamic was disturbed; however, oral administration of NAC decreased the mTOR protein level and improved the mitochondrial dynamic. We concluded that NAC plays a neuroprotective role in temporal lobe epilepsy, probably through decreasing the mTOR protein level, which can improve the imbalance in the mitochondrial dynamic.

N-acetyl cysteine

Mitochondrial dynamic

temporal lobe epilepsy

mTOR

Epilepsy is a frequent neurological disorder affecting about 39 million people worldwide (Vos et al., 2016). Understanding the molecular mechanisms underlying the pathogenesis of epilepsy is critical for developing more effective therapies (Zeng et al., 2009). In most kinds of epilepsies, secondary damage to the mitochondria exists (Zsurka and Kunz, 2015). The role of mitochondrial dysfunction has been considered pivotal in the pathogenic process of epileptogenesis and further seizure generation (Folbergrová and Kunz, 2012). Among the variant mitochondrial dysfunction, an imbalance in the mitochondrial dynamic plays an important role in the pathology of epilepsy. We recently reported that a mitochondrial dynamic imbalance was detected in the kainate model of epilepsy (Nikbakht et al., 2020). Some form of mitochondrial dynamic disruption has also been observed in several other major neurodegenerative diseases, including Parkinson’s, Alzheimer’s, and Huntington’s disease (Chen and Chan, 2009).

Mitochondrial dynamics consist of repeated cycles of fusion and fission, which help intermix the contents of mitochondria, change mitochondrial shapes, and enable mitochondria to communicate with the cytosol (Chen and Chan, 2009). Normally there is a balance between mitochondrial fission and fusion; however, in pathogenic circumstances, the balance is disrupted (Bossy-Wetzel et al., 2003). In neurodegenerative diseases, like Parkinson's disease, diabetic neuropathies, ischemic stroke, and epilepsy, the imbalance in mitochondrial dynamics results in abnormally long or short mitochondria (Knott and Bossy-Wetzel, 2008, Nikbakht et al., 2020).

Several proteins are involved in the mitochondrial dynamic process. Mitofusin 1 and 2 (MFN1 & 2) and optic atrophy 1 (OPA1) are the primary proteins for mitochondrial fusion. MFN1 and MFN2 promote fusion in the outer membrane, while OPA1 is necessary for inner membrane fusion (Meeusen et al., 2006). Mitochondrial fission involves the cleavage of mitochondria through the Dynamin-related protein 1 (Drp1) and fission 1 (Fis.1). Drp-1 is a large GTPase similar to dynamin that typically resides in the cytoplasm, but to start the fission process, it must be recruited to the mitochondrial outer membrane via Fis.1 (Estaquier and Arnoult, 2007, Mozdy et al., 2000, Smirnova et al., 2001). Fis1 is anchored in the outer mitochondrial membrane and plays an important role in Drp1 recruitment to the inner mitochondria (Yoon et al., 2003, Zhang and Chan, 2007). The mitochondrial dynamic balance is important for having an appropriate mitochondrial membrane potential.

mTOR is a serine-threonine kinase that controls several important aspects of mammalian cell functions, such as changes in the rate of translation, transcription, protein degradation, cell signaling, metabolism, and cytoskeleton dynamics. mTOR activity is modulated by various intra- and extracellular factors (OF mTOR, 2016). It has been reported that mTOR can also control mitochondrial fission, and by stimulating the translation of the mitochondrial fission process 1 (MTFP1), it can ultimately lead to cell apoptosis (Morita et al., 2017). It has been established that epilepsy increases mTOR activity. In kainate-induced temporal lobe epilepsy, the increase in mTOR activity shows a biphasic pattern with the first peak appearing within a few hours after seizures and the second peak, starting 3 days after seizures reaching its peak 5–10 days after seizures (Zeng et al., 2009). Since the administration of mTOR inhibitors like rapamycin blocked the development of epilptogenesis in animal models (Zeng et al., 2009), mTOR inhibitors are a good candidate for controlling epilepsy. Also, some previous studies have reported that N-acetyl cysteine (NAC) reduces the symptom of systemic lupus erythematosus (SLE) by blocking the mTOR pathway (Lai et al., 2012, Perl et al., 2015, Zeng et al., 2018).

N-Acetylcysteine (NAC) is a thiol-containing compound that has been shown to exhibit a protective ability in neurodegenerative diseases (Arakawa and Ito, 2007). NAC is a cysteine precursor that can be transported to the cell without an active transporter, and by increasing intracellular GSH protects cells against oxidative stress (Ferrari et al., 1995). In addition to attenuating oxidative stress, NAC increases cell survival by reversing mitochondrial depolarization and increasing the activities of mitochondrial complexes (Soiferman et al., 2014). In animal models studies, NAC improves mitochondrial function by controlling the mitochondrial membrane potential and decreasing membrane permeability, which leads to apoptosis (Amrouche-Mekkioui and Djerdjouri, 2012, Basha and Priscilla, 2013, Sandhir et al., 2012).

In this regard, NAC can be considered a good supplement in controlling epilepsy by both controlling mTOR level and mitochondrial function. However, the link between NAC’s effect, mitochondrial dynamics, and mTOR levels in temporal lobe epilepsy has not been investigated.

In this study, we hypothesized that NAC may exert a protective effect in TLE model, by modulation of the mitochondrial dynamics and the mTOR level.

In this study, 64 adult male Wistar rats weighing between 200–250 g were used. During the test, the rats were kept in 12 h light/darkness cycles with controlled temperature and humidity and free access to water and food. All experiments were carried out under the guidelines of the Institutional Animal Care and Use Committee of the Tehran University of Medical Sciences (TUMS) (IACUC protocol number: [93-02- 45-26666]). Rats were randomly divided into four groups:1) Control intact group (n = 16), 2) N-acetyl cysteine (NAC) group (n = 16), 3) Kainic acid-induced epilepsy (KA) group (n = 16), and 4) pretreatment with NAC before temporal lobe epilepsy induction (NAC + KA) group (n = 16). Rats in NAC and NAC + KA groups received 100 mg/kg NAC (Cat No: 112422, Millipore) orally for eight days, starting seven days before KA micro-injection and continued one day after surgery. The dose of NAC used in the present study (100 mg/kg) was chosen according to the pilot study (data not shown), employing two NAC doses (100 and 50 mg/Kg). In the pilot study, NAC was not lethal in either dose, but the 100 mg/kg offered better protection. In the research conducted by Zaeri and Emamghoreishi (2015) different doses of NAC (50-300-mg/kg) were used in the PTZ -induced seizure in mice. The data showed that chronic administration of 300 mg/kg NAC was fully lethal, while lower doses (100 and 150 mg/kg) resulted in a significant weight loss and decreased stay time on rotarod. Altogether, it was concluded that higher doses of NAC can be toxic and NAC is better working in lower doses (Zaeri and Emamghoreishi, 2015). Moreover, in a recently published clinical trial on the effects of NAC in patients with sepsis admitted in ICU (Peivandi Yazdi et al., 2020), the intravenous 25 mg/kg bolus followed by the 75 mg/kg one over 24 hours, were implemented. Taking this into consideration, the those 100mg/kg is of clinical relevance.

The rats were sacrificed 72 h after surgery, and their brains were removed for further experiments. The rats in each group underwent four different procedures; 1- histological procedures (immunohistochemistry IHC, and Nissl staining n = 4), western-blot analysis (n = 4), real-time PCR analysis (n = 4), and mitochondria membrane potential assessment (n = 4).

Temporal lobe epilepsy

Temporal lobe epilepsy was induced using microinjection of Kainic acid (KA) into the left lateral ventricle of the brain. First, the rats were anesthetized by an intraperitoneal (IP) injection of a mixture of ketamine (100 mg/kg) and xylazine (10mg/kg). Then, the head of the animal was fixed in the stereotaxic apparatus. After finding the left ventricular coordinates (1 mm posterior to the bregma, 1.5 mm lateral, and 3.5 mm below the scalp), KA was injected in a volume of 1.0 µl containing 0.8 µg of KA.

Nissl staining analysis

For transcardial perfusion of the brain, rats were first deeply anesthetized with the mixture of ketamine and xylazine (up to 100 mg/kg body weight ketamine and 10 mg/kg body weight xylazine). The perfusion was started with saline and then continued with a 4% paraformaldehyde fixative. After removing the brain, paraffin blocks were prepared, and 5 µm microtome sections of the hippocampus area were cut for Nissl staining or IHC. Six different sections with the interval of two sections of each brain (n = 4 in each group) were used for staining. The Nissl staining was performed using Cresyl violet (0.1%) to assess the neuronal loss in the hippocampus. The number of intact cells was counted blindly in an area about 15×103 µm² of CA3. The area was equal to two fields of microscope with 200X magnification.

Immunohistochemistry (IHC)

For immunohistochemistry, tissue sections (six different sections with the interval of two sections of each brain) were prepared as previously described in section 2.1. After the section was deparaffinated and rehydrated, the immunohistochemistry protocol consisted of fusing 3% hydrogen to eliminate the endogenous peroxidase. Antigens were unmasked using a water bath at 70 ° C for 30 min. Next, the sections were incubated for 30 min with goat’s serum and then with MFN1 (1:250 dilution, rabbit anti-rat Abcam ab104274) primary antibody. The incubation was performed in a wet chamber overnight at 4 ° C. Then, after washing, the second incubation was performed with goat anti-rabbit HRP secondary antibody (1:100 dilution, Biorbyt orb53693) for 2 h. We used DAB (3, 3′-diaminobenzidine) as a chromogen for horseradish peroxidase for staining, and lastly, the antigen positive cells were counted in the whole area of CA3 area which was approximately equal to three fields of microscope with 200X magnification.

Western blot analysis

The total mTOR (mTORc1 and mTORc2) and Drp-1 protein levels were detected by western blotting in the hippocampus of rat brains. The isolated left hippocampus was homogenized in a cold lysis buffer (Ripa 1 ml and inhibitor cocktail 10 µl Protein), then centrifuged at 13,000 g for 5 min at 4°C. Total protein concentration in the supernatant was determined using the BIO-RAD Kit USA. Protein samples (40 µg per lane) were separated on an 8% SDS-polyacrylamide gel and then transferred onto polyvinylidene fluoride (PVDF) membranes for immunoblotting. The membranes were blocked with blocking buffer (5% fat-free milk solved in Tris-buffered saline containing 0.1% Tween 20) for 1 h at room temperature (RT). The membranes were then incubated (overnight at 4°C) with rabbit antibodies against mTOR (1:500 Abcam ab32028), Drp-1 (1:200 dilution) (Biorbyt, orb229172), and β-actin (1:1000 dilution) (PADZA, Iran), and followed by 1 h of RT incubation with a secondary anti-rabbit antibody (1:700 dilution, Biorbyt ORB10584). All western blotting data were repeated in at least three independent experiments.

The relative intensities of mTOR and Drp1 were normalized to the internal reference protein β-actin, and then normalized to the control group. Image J software was used for densitometric analysis.

Real-time PCR Analysis

For DNA synthesis, the total RNA from each rat’s left hippocampus was isolated using an RNX kit (CinnaGen, Iran), then 0.5 µg/µl of the total RNA was used for complementary DNA (cDNA) synthesis. For this purpose, RNA was first denatured at 70°C then cooled immediately. The first strand of cDNA was synthesized according to the guidelines of the DNA synthesis kit using deoxynucleotide primers and reverse transcriptase.

The primers were designed by using Primer 3 software, and the specificity of the designed primers was checked for each gene of interest using the Primer-BLAST system available at the National Center for Biotechnology Information (NCBI). The sequences and sizes of Fis.1 (fission gene), OPA (fusion gene), MTFP1, and β-actin (housekeeping genes) primers are given in Table 1.

The 2^−ΔΔCT method has been used for analysis of real-time reaction data.

Table 1

The sequences of gene-specific PCR primers for real-time.
MTFP1. Forward	TAATCCACCCCATCGACAG
MTFP1. Reverse	TCCACTGACGGGTACAGCTT
Fis.1 Forward	GCCTGCCGTTACTTCTTCTAC
Fis.1 Reverse	ATCCTTCACGCTACAACTACTATG
OPA1 Forward	CTCGCTATCACTGCCAACAC
OPA1 Reverse	ACCTTCTTCTCGCCGTCTTC
β- actin. Forward	CACGGCATTGTCACCAACTG
β- actin. Reverse	AACACAGCCTGGATGGCTAC

Mitochondria membrane potential (ΔΨm)

The mitochondrial membrane potential used is a good indicator of mitochondrial function. For this purpose, hippocampus tissues in each group were first washed with phosphate-buffered saline (PBS), then homogenized in a mitochondrial isolation buffer (10%) on ice. The homogenate was then centrifuged at 226g for 10 min, and the supernatant was centrifuged again at 10062g for 15 min. The precipitate contained mitochondria (Ding et al., 2013) .

Twenty µl of rhodamin 123 (Sigma Aldrich, CAS No. 62669-70-9) and 180 µl of PBS were added to the precipitate, and after 30 min of incubation, the mitochondrial membrane potential was measured in a fluorescent microplate reader. Fluorescence signals of mitochondria excited at 488 nm and a wavelength of 525 nm emission were monitored.

Statistical Analysis

To identify any statistical differences among the groups, a one-way analysis of variance (ANOVA) followed by post hoc Bonferroni analysis was performed. P values of less than 0.05 were considered significant. Data are shown as the mean ± SD. We used scatter plot to report the values of individual data points.Version 8 of Prism was used for all statistical analyzes.

The effect of NAC pretreatment on cell loss in the CA3 area of the hippocampus after epilepsy

Cresyl violet staining showed vast hippocampal cell loss 72 h after induction of epilepsy by KA. The photomicrograph of the hippocampal coronal sections of the different groups is shown in Fig. 1A. The intact group did not show any histopathological changes in the CA3. The nuclei and arrangement of neurons also remained intact after the administration of NAC. However, severe neuronal loss was observed in the CA3 region of the hippocampus 72 h after the injection of KA (P < 0.0001 compared to the intact group). The results showed pretreatment with NAC (7 days pretreatment followed by one day after epilepsy) increased the number of surviving neurons in the CA3 area of the hippocampus (NAC + KA vs. KA, P = 0.0024). There was no significant difference between intact, NAC and, NAC + KA groups.

Western blot analysis

The effect of NAC pretreatment on mTOR protein in TLE

The expression of mTOR in the different groups was measured by the western blotting technique. Comparison of protein bands revealed no significant difference between the intact, NAC, and KA + NAC groups. However, after the induction of epilepsy by KA, the level of mTOR significantly increased in the treatment groups compared with the intact group (P = 0.003). Administration of NAC (8 days) returned it to the normal level (P = 0.01, KA + NAC group compared with KA group) (Fig. 2A and B).

The effect of NAC pretreatment on Drp1 protein in TLE

The western blotting result showed that Drp1 protein as a fission factor increased in the KA-induced epilepsy group 72 h after surgery (P < 0.0001). Pretreatment with NAC for 8 days (seven days before surgery and one day after surgery) returned the level of Drp1 to the normal level as there was no difference between NAC + KA and the intact group. (Fig. 3A &B).

The effect of NAC pretreatment on mitochondrial dynamic protein in TLE detected by real-time PCR

The effect of NAC pretreatment on Fis.1 gene expression in real-time PCR analysis after epilepsy

The results showed that although the expression of the amount of Fis.1 as a mitochondrial fission gene increased, the amount was not statistically significant. This increase is probably due to the time of the experiment, which was 72 h after epilepsy. However, administration of NAC (7days pretreatment with 1day treatment) caused a decrease in Fis.1 expression in the KA + NAC group compared to the KA group (P = 0.03) (Fig. 4A).

The effect of NAC pretreatment on OPA gene expression in real-time PCR analysis after epilepsy

The results showed that epilepsy cause a significant decrease in the expression of OPA as a mitochondrial fusion gene compared with the intact group (P = 0.001). Statistical analysis of Real-time PCR revealed that the administration of NAC (7 days pretreatment with 1day treatment) significantly compensated for the decrease in the expression of OPA in the NAC + KA group ( NAC + KA vs. KA P = 0.02) (Fig. 4B).

The effect of NAC pretreatment on MTFP1 gene expression in real-time PCR analysis after epilepsy

Statistical analysis of Real-time PCR revealed that MTFP1 gene expression did not significantly change in the KA-induced (post 72 h) group compared with the intact and the NAC groups. However, after oral administration of NAC, the expression level showed a statistically significant decrease compared with the KA (P = 0.01) and the intact groups (P = 0.03 Fig. 4C).

Immunohistochemistry analysis of MFN1 protein in the CA3 area of the hippocampus

Immunohistochemistry was used to show the expression of MFN1, a mitochondrial fusion protein in the CA3 area of the hippocampus, 72 hours after induction of epilepsy (Fig. 5A). Statistical analysis of MFN1 revealed no significant change in MFN1 expression in the KA group compared with the intact one. However, following pretreatment with NAC, the MFN1 protein level increased significantly in the NAC + KA group compared to the intact (P = 0.0002) and KA group (P < 0.0001) (Fig. 5B). There was no significant difference between the intact, and NAC groups.

The effect of NAC pretreatment on mitochondrial membrane potential after epilepsy

The mitochondrial membrane potential was measured in order to reveal the hippocampal integrity after epilepsy and pretreatment with NAC as a protective factor. Figure 6 displays a significant reduction in the mitochondrial membrane potential 72 hours after epilepsy (P = 0.007). Mitochondrial membrane potential reduction returned to a normal level after eight days of pretretamnet with NAC (Intact vs. NAC + KA, P = 0.999 and NAC + KA vs. KA, P = 0.006) (Fig. 6).There was no significant difference between the intact,and NAC groups.

In the present study, we first evaluated the neuroprotective effects of N-acetyl cysteine (NAC) on neuronal loss in the rat model of temporal lobe epilepsy. Histological analysis of the Nissl staining showed massive hippocampal cell loss, specifically in the CA3 region; and oral administration of 100 mg/kg NAC (7 day pretreatment followed by 1day after epilepsy) increased the surviving neuron number in the CA1, hilar, and the CA3 areas (only CA3 data are shown in this article). The protective effect of NAC against excitotoxicity induced by KA may be due to its alleviative role in Oxidative stress damage. There are several lines of evidence indicating an anti-oxidative role for NAC in cerebral ischemia, traumatic brain injury, and Alzheimer's disease (Chandra et al., 2000, Harrison et al., 1991, Morganti-Kossmann et al., 2001, Tchantchou et al., 2005). In this study, we show the neuroprotective effect of NAC in the experimental temporal lobe epilepsy model.

Oxidative stress is not the only cause of cell death in epilepsy (Luo et al., 2020). The imbalance in the mitochondrial dynamic (fusion and fission) induced by epilepsy (Luo et al., 2020) is another important pathological reason underlying several neurodegenerative disorders (Burté et al., 2015, Nikbakht et al., 2020). Our data show an increase in fission proteins (Drp1- Fis.1) and a decrease in the fusion protein OPA following induction of epilepsy by KA. This ultimately leads to a reduction in mitochondrial membrane potential and a disturbance in mitochondrial function, which is observed in our data. The results also show that the level of Drp1 as a cytoplasmic essential protein for mitochondrial fission increased 72 h post-KA injection. This confirms the previous report from our lab (Nikbakht et al., 2020).

It seems that there is crosstalk between DRP1-dependent mitochondrial fission and oxidative stress (Nikbakht et al., 2021). NAC, as a potent anti-oxidant, reduced the level of Dynamin-related protein-1. This is in accordance with previous studies, i.e., an in vitro study where NAC was effective in reducing Drp1 and preventing mitochondrial fragmentation (Li et al., 2015a). In another study, NAC prevented mitochondrial damage and apoptosis in a model of hepatocyte apoptosis induced by silver nanoparticles by interfering with the crosstalk between oxidative stress and Drp1 (Nikbakht et al., 2021). NAC was also effective in reducing Drp1-dependent mitochondrial fission in osteogenic dysfunction (Zhang et al., 2017). A recent study reported that NAC could mitigate renal ischemia-reperfusion injuries by decreasing phosphorylated Drp1 (Peerapanyasut et al., 2020). Some studies on human stem cells also stated that NAC could reduce Drp1 by inhibiting the translocation of Drp1 to the mitochondria and decreasing necroptosis (Agarwal et al., 2016, Li et al., 2015b). Aside from Drp1, NAC was able to control the mitochondrial imbalance induced by folic acid in an experimental study on acute kidney damage (Aparicio-Trejo et al., 2019). In the central nervous system, NAC was able to improve mitochondrial dysfunction in a mouse model of Huntington's disease (Wright et al., 2015). However, to our knowledge, there is no data available showing the effect of NAC on the mitochondrial dynamic in temporal lobe epilepsy.

For mitochondrial fission it is necessary that Drp1, which is normally present in the cytoplasm (Smirnova et al., 2001), be recruited into a foci on the outer surface of mitochondria. For this purpose the presence of a small protein, mitochondrial fission 1 protein) Fis.1), is crucial (Mozdy et al., 2000). Fis.1 performs as an adaptor in the assembly of high-molecular-weight fission complexes (Bossy-Wetzel et al., 2003), and down-regulating of Fis.1 causes mitochondrial elongation (Stojanovski et al., 2004). According to our results, Fis.1 expression did not increase significantly 72 h after epilepsy. Our previous data also confirmed the same result (Nikbakht et al., 2020). The question is, if Fis.1 is an adaptor for the recruitment of Drp1, why was the Fis.1 not elevated after epilepsy? One must consider that Fis.1 is not the only adaptor involved in mitochondrial fission. The other adaptors, Mff, MiD49, and Mid51, each play an important role in the pathology of different diseases (Atkins et al., 2016). According to the present data, Fis.1 is not the pivotal adaptor for mitochondrial fission in temporal lobe epilepsy. However, NAC was very effective in lowering the expression of Fis.1, thereby showing its ability to lower the important adaptors for fission. The beneficial effect of NAC was not limited to controlling fission proteins. There was also an elevation in the expression of Mitofusin 1 (MFN1) and optic atrophy 1 (OPA1) (major fusion proteins) under the administration of NAC in TLE. So, NAC is an important factor for controlling the mitochondrial dynamic imbalance- induced by epilepsy.

The mitochondrial dynamic balance is an important factor in appropriate mitochondrial membrane potential. Our study confirmed that KA causes a reduction in mitochondrial membrane potential, and this is consistent with previous studies that have shown the role of mitochondrial membrane potential on the pattern of epileptic discharges (Kovac et al., 2012, Kovács et al., 2005). NAC administration at doses of 100 mg/kg improved this loss of mitochondrial membrane potential probably by balancing the dynamics of the mitochondria. There are only a few studies considering the effect of NAC on mitochondrial membrane potential. It has been reported that NAC was unable to prevent a reduction in mitochondrial membrane potential in a study on mitochondrial biogenesis (Dabrowska et al., 2015), while another study declared that NAC reversed the mitochondrial membrane potential reduction resulting from Phyllanthus urinaria (Huang et al., 2014).

The other factor that we tried to evaluate in this study was mTOR. It has been reported that the mammalian target of the rapamycin (mTOR) signaling pathway plays an important role in epileptogenesis and that it increases in a rat temporal lobe epilepsy (TLE) 3 days after kainite injection (Zeng et al., 2009). mTOR can be triggered by glutamate receptor stimulation (Lenz and Avruch, 2005), so widespread mTOR activation in status epilepticus, which causes massive glutamate release, is not surprising. Our results confirmed that the mTOR protein significantly increased 72 h after kainite injection, and oral NAC administration reduced the mTOR protein level.

In the second step of this study, we tried to evaluate any possible relationship between NAC, the mitochondrial dynamic, and mTOR levels in TLE. In this regard, the mitochondrial fission process 1 (MTFP1) gene (the mTOR mediator in the mitochondrial fission process) was detected after pretreatment with NAC. MTFP1 is a mitochondrial inner membrane protein that causes mitochondrial reticulum fission (Wai and Langer, 2016). A recent study reported that mTOR stimulates the translation of MTFP1 to control mitochondrial fission and apoptosis (Morita et al., 2017). We expected an overexpression in MTFP1 72 h after KA injection along with an increase in the mTOR level. Conversely, the expression of MTFP1 experienced no change. This discrepancy may be explained by the way we detected MTFP1. In this study, MTFP1 gene expression was detected using real time PCR. After seven days, the gene expression likely returns to the basic level while the protein level remains high. In this case, it is necessary to use the western blot method to estimate the MTFP1 protein level or detect MTFP1 gene expression in an earlier time. However, MTFP1 gene expression was down-regulated in the NAC pretreated rats after KA injection. Certainly confirming the exact realtion between mTOR and mitochondrial dynamic needs more investigation.

In summary, we conclude that NAC has a neuroprotective factor in temporal lobe epilepsy and is able to balance the disturbance in mitochondrial dynamic probably through the reduction in mTOR level.

Acknowledgement

This work was supported by a grant (No. 97-3-4-12863) from Iran University of Medical Sciences (Vice Chancellor for Research & Technology), Hemmat Highway, Tehran, Iran.

Funding: This work was supported by a grant (No. 97-3-4-12863) from Iran University of Medical Sciences (Vice Chancellor for Research & Technology), Hemmat Highway, Tehran, Iran.

Competing interest: The authors declare that there is no conflict of interest associated with this work.

Author Contribution: Farnaz Nikbakht; Study Conception and design. Ekram Mohammadi; data preparation and first draft of the manuscript. Mahmoud Barati; data preparation and analysis. Mehrdad Roghani; data preparation and analysis. Ali Mhamadkhanizadeh; data preparation. The final manuscript was approved by all authors.

Data availability statement: Data are available from the corresponding author on reasonable request.

AGARWAL S, YADAV A, TIWARI SK, SETH B, KHARE CHAUHANLKS, CHATURVEDI RK (2016) Dynamin-related protein 1 inhibition mitigates bisphenol A-mediated alterations in mitochondrial dynamics and neural stem cell proliferation and differentiation. J Biol Chem 291:15923–15939
AMROUCHE-MEKKIOUI I, DJERDJOURI B (2012) N-acetylcysteine improves redox status, mitochondrial dysfunction, mucin-depleted crypts and epithelial hyperplasia in dextran sulfate sodium-induced oxidative colitis in mice. Eur J Pharmacol 691:209–217
APARICIO-TREJO OE, REYES-FERMÍN LM, BRIONES-HERRERA A, TAPIA E, LEÓN-CONTRERAS JC, HERNÁNDEZ-PANDO R, SÁNCHEZ-LOZADA LG, PEDRAZA-CHAVERRI J (2019) Protective effects of N-acetyl-cysteine in mitochondria bioenergetics, oxidative stress, dynamics and S-glutathionylation alterations in acute kidney damage induced by folic acid. Free Radic Biol Med 130:379–396
ARAKAWA M, ITO Y (2007) N-acetylcysteine and neurodegenerative diseases: basic and clinical pharmacology. The Cerebellum 6:308–314
ATKINS K, CHEN DASGUPTAA, ARCHER SL (2016) The role of Drp1 adaptor proteins MiD49 and MiD51 in mitochondrial fission: implications for human disease. Clin Sci 130:1861–1874
BASHA RH, PRISCILLA DH (2013) An in vivo and in vitro study on the protective effects of N-acetylcysteine on mitochondrial dysfunction in isoproterenol treated myocardial infarcted rats. Exp Toxicol Pathol 65:7–14
BOSSY-WETZEL E, BARSOUM MJ, GODZIK A, SCHWARZENBACHER R, LIPTON SA (2003) Mitochondrial fission in apoptosis, neurodegeneration and aging. Curr Opin Cell Biol 15:706–716
BURTÉ F, CARELLI V, CHINNERY PF, YU-WAI-MAN P (2015) Disturbed mitochondrial dynamics and neurodegenerative disorders. Nat reviews Neurol 11:11–24
CHANDRA J, SAMALI A, ORRENIUS S (2000) Triggering and modulation of apoptosis by oxidative stress. Free Radic Biol Med 29:323–333
CHEN H, CHAN DC (2009) Mitochondrial dynamics–fusion, fission, movement, and mitophagy–in neurodegenerative diseases. Hum Mol Genet 18:R169–R176
DABROWSKA A, IWASAWA VENEROJL, RAHMAN RHANKIRM-K, BOOBIS S, HAJJI N (2015) PGC-1α controls mitochondrial biogenesis and dynamics in lead-induced neurotoxicity. Aging 7:629
DING J, XI YUHLMAWW, ZHAO YD, XIAO R (2013) Soy isoflavone attenuates brain mitochondrial oxidative stress induced by beta-amyloid peptides 1–42 injection in lateral cerebral ventricle. J Neurosci Res 91:562–567
ESTAQUIER J, ARNOULT D (2007) Inhibiting Drp1-mediated mitochondrial fission selectively prevents the release of cytochrome c during apoptosis. Cell Death & Differentiation 14:1086–1094
FERRARI G, GREENE L (1995) N-acetylcysteine (D-and L-stereoisomers) prevents apoptotic death of neuronal cells. J Neurosci 15:2857–2866
FOLBERGROVÁ J, KUNZ WS (2012) Mitochondrial dysfunction in epilepsy. Mitochondrion 12:35–40
HARRISON PM, GIMSON WENDONJA, ALEXANDER AE, WILLIAMS R (1991) Improvement by acetylcysteine of hemodynamics and oxygen transport in fulminant hepatic failure. N Engl J Med 324:1852–1857
HUANG S-T, KUO BIK-W, LIN H-M, LIAO T-K, LIOU C-W (2014) Phyllanthus urinaria induces mitochondrial dysfunction in human osteosarcoma 143B cells associated with modulation of mitochondrial fission/fusion proteins. Mitochondrion 17:22–33
KNOTT AB, BOSSY-WETZEL E (2008) Impairing the mitochondrial fission and fusion balance: a new mechanism of neurodegeneration. Ann N Y Acad Sci 1147:283
KOVAC S, ABRAMOV AY (2012) Prolonged seizure activity impairs mitochondrial bioenergetics and induces cell death. J Cell Sci 125:1796–1806
KOVÁCS R, HEINEMANN KARDOSJ, KANN O (2005) Mitochondrial calcium ion and membrane potential transients follow the pattern of epileptiform discharges in hippocampal slice cultures. J Neurosci 25:4260–4269
LAI ZW, HANCZKO R, BONILLA E, CAZA TN, CLAIR B, MIKLOSSY BARTOSA, JIMAH G, DOHERTY J, TILY H (2012) N-acetylcysteine reduces disease activity by blocking mammalian target of rapamycin in T cells from systemic lupus erythematosus patients: a randomized, double‐blind, placebo‐controlled trial. Arthr Rhuem 64:2937–2946
LENZ G, AVRUCH J (2005) Glutamatergic regulation of the p70S6 kinase in primary mouse neurons. J Biol Chem 280:38121–38124
LI C-J, PANG C-Y (2015a) Synergistic protection of N-acetylcysteine and ascorbic acid 2-phosphate on human mesenchymal stem cells against mitoptosis, necroptosis and apoptosis. Sci Rep 5:1–12
LI C-J, PANG C-Y (2015b) Synergistic protection of N-acetylcysteine and ascorbic acid 2-phosphate on human mesenchymal stem cells against mitoptosis, necroptosis and apoptosis. Sci Rep 5:9819
LUO Z, WANG J, TANG S, ZHENG Y, ZHOU X, TIAN F, XU Z (2020) Dynamic-related protein 1 inhibitor eases epileptic seizures and can regulate equilibrative nucleoside transporter 1 expression. BMC Neurol 20:1–12
MEEUSEN S, CASSIDY-STONE DEVAYRBLOCKJ, WAYSON A, NUNNARI J (2006) Mitochondrial inner-membrane fusion and crista maintenance requires the dynamin-related GTPase Mgm1. Cell 127:383–395
MORGANTI-KOSSMANN MC, RANCAN M, STAHEL OTTOVI, KOSSMANN T (2001) Role of cerebral inflammation after traumatic brain injury: a revisited concept. Shock 16:165–177
MORITA M, BASU PRUDENTJ, GOYON K, KATSUMURA V, HULEA S, PEARL L, MCGUIRK DSIDDIQUINSTRACKS, ST-PIERRE S, LARSSON J, TOPISIROVIC O, MCBRIDE IVALIH, SONENBERG N (2017) mTOR Controls Mitochondrial Dynamics and Cell Survival via MTFP1. Mol Cell 67:922–935e5
MOZDY A, MCCAFFERY J, SHAW J (2000) Dnm1p GTPase-mediated mitochondrial fission is a multi-step process requiring the novel integral membrane component Fis1p. J Cell Biol 151:367–380
NIKBAKHT F, GOLAB KHANIZADEHAM, BALUCHNEJADMOJARAD F, VAZIFEHKHAH T, MOEINSADAT A (2020) Mitochondrial ATP-sensitive potassium channel, MitoKATP, ameliorates mitochondrial dynamic disturbance induced by temporal lobe epilepsy.Journal of Chemical Neuroanatomy,101808
NIKBAKHT F, GOLAB KHANIZADEHAM, BALUCHNEJADMOJARAD F, VAZIFEHKHAH T, MOEINSADAT A (2021) Mitochondrial ATP-sensitive potassium channel, MitoKATP, ameliorates mitochondrial dynamic disturbance induced by temporal lobe epilepsy. J Chem Neuroanat 113:101808
OF MTOR MN (2016) NEUROSCIENCE FOREFRONT REVIEW. neuroscience, 2016, 017
PEERAPANYASUT W, KOBROOB A, PALEE S, CHATTIPAKORN N, WONGMEKIAT O (2020) Bisphenol A aggravates renal ischemia–reperfusion injury by disrupting mitochondrial homeostasis and N-acetylcysteine mitigates the injurious outcomes. IUBMB Life 72:758–770
PEIVANDI YAZDI A, RAZAVI M, SHEIKH S, BOROUMAND N, SALEHI M, HASHEMY SI (2020) Clinical trial assessment of intermittent and continuous infusion dose of N-acetylcysteine on redox status of the body in patients with sepsis admitted to the ICU. J Intensive Care Med 35:1383–1388
PERL A, OAKS HANCZKORLAIZ-W, KELLY Z, PHILLIPS PE (2015) Comprehensive metabolome analyses reveal N-acetylcysteine-responsive accumulation of kynurenine in systemic lupus erythematosus: implications for activation of the mechanistic target of rapamycin. Metabolomics 11:1157–1174
SANDHIR R, MEHROTRA SOODA, KAMBOJ SS (2012) N-Acetylcysteine reverses mitochondrial dysfunctions and behavioral abnormalities in 3-nitropropionic acid-induced Huntington’s disease. Neurodegenerative Dis 9:145–157
SMIRNOVA E, GRIPARIC L, SHURLAND D-L, VAN DER BLIEK AM (2001) Dynamin-related protein Drp1 is required for mitochondrial division in mammalian cells. Mol Biol Cell 12:2245–2256
SOIFERMAN D, WEISSMAN AYALONO, SAADA A (2014) The effect of small molecules on nuclear-encoded translation diseases. Biochimie 100:184–191
STOJANOVSKI D, OKAMOTO KOUTSOPOULOSOS, RYAN MT (2004) Levels of human Fis1 at the mitochondrial outer membrane regulate mitochondrial morphology. J Cell Sci 117:1201–1210
TCHANTCHOU F, GRAVES M, ROGERS E, ORTIZ D, SHEA TB (2005) N-acteyl cysteine alleviates oxidative damage to central nervous system of ApoE-deficient mice following folate and vitamin E-deficiency. J Alzheimers Dis 7:135–138
VOS T, ARORA ALLENC, BHUTTA MBARBERRM, BROWN ZA, CASEY ACARTERA, CHARLSON DC, CHEN AZ (2016) Global, regional, and national incidence, prevalence, and years lived with disability for 310 diseases and injuries, 1990–2015: a systematic analysis for the Global Burden of Disease Study 2015. The Lancet 388:1545–1602
WAI T, LANGER T (2016) Mitochondrial dynamics and metabolic regulation. Trends in Endocrinology & Metabolism 27:105–117
WRIGHT D, RENOIR T, SMITH Z, FRAZIER A, FRANCIS P, THORBURN D, MCGEE S, HANNAN A, GRAY L (2015) N-Acetylcysteine improves mitochondrial function and ameliorates behavioral deficits in the R6/1 mouse model of Huntington's disease. Translational psychiatry 5:e492–e492
YOON H-G, CHAN DW, QIN REYNOLDSAB, WONG J (2003) N-CoR mediates DNA methylation-dependent repression through a methyl CpG binding protein Kaiso. Mol Cell 12:723–734
ZAERI S, EMAMGHOREISHI M (2015) Acute and chronic effects of N-acetylcysteine on pentylenetetrazole-induced seizure and neuromuscular coordination in mice. Iran J Med Sci 40:118
ZENG L-H, WONG M (2009) The mammalian target of rapamycin signaling pathway mediates epileptogenesis in a model of temporal lobe epilepsy. J Neurosci 29:6964–6972
ZENG X-F, LI Q, LI J, WONG N, LI Z, HUANG J, YANG G, SHAM PC, LI S-B, LU G (2018) HIV-1 Tat and methamphetamine co-induced oxidative cellular injury is mitigated by N-acetylcysteine amide (NACA) through rectifying mTOR signaling. Toxicol Lett 299:159–171
ZHANG L, GAN X, HE Y, ZHU Z, ZHU J, YU H (2017) Drp1-dependent mitochondrial fission mediates osteogenic dysfunction in inflammation through elevated production of reactive oxygen species. PLoS ONE 12:e0175262
ZHANG Y, CHAN DC (2007) Structural basis for recruitment of mitochondrial fission complexes by Fis1. Proceedings of the National Academy of Sciences, 104, 18526–18530
ZSURKA G, KUNZ WS (2015) Mitochondrial dysfunction and seizures: the neuronal energy crisis. Lancet Neurol 14:956–966

Download PDF

Version 1

posted

You are reading this latest preprint version

Protective effect of N-acetyl cysteine on mitochondrial dynamic imbalance in Temporal lobe Epilepsy: possible role of mTOR

Status:

Version 1

Abstract

Figures

Introduction

Methods And Materials

Temporal lobe epilepsy

Nissl staining analysis

Immunohistochemistry (IHC)

Western blot analysis

Real-time PCR Analysis

Mitochondria membrane potential (ΔΨm)

Statistical Analysis

Results

The effect of NAC pretreatment on cell loss in the CA3 area of the hippocampus after epilepsy

Western blot analysis

The effect of NAC pretreatment on mTOR protein in TLE

The effect of NAC pretreatment on Drp1 protein in TLE

The effect of NAC pretreatment on mitochondrial dynamic protein in TLE detected by real-time PCR

The effect of NAC pretreatment on Fis.1 gene expression in real-time PCR analysis after epilepsy

The effect of NAC pretreatment on OPA gene expression in real-time PCR analysis after epilepsy

The effect of NAC pretreatment on MTFP1 gene expression in real-time PCR analysis after epilepsy

Immunohistochemistry analysis of MFN1 protein in the CA3 area of the hippocampus

The effect of NAC pretreatment on mitochondrial membrane potential after epilepsy

Discussion

Declarations

References

Status:

Version 1