Prophyromonas gingivalis promotes the progression of oral squamous cell carcinoma by activating the neutrophil chemotaxis in the tumor microenvironment

Materials And Methods

Clinical samples

One hundred and forty formalin-fixed, paraffin-embedded blocks of OSCC samples and twenty normal samples were collected from the Oncology Department of Oral and Maxillofacial Surgery of The First Affiliated Hospital of Xinjiang Medical University (Urumqi, China) between March 2010 and March 2021. The use of OSCC samples was approved by the ethics review board (approval no. IACUC20180411‑13). The TNM and clinicopathological classification and staging of patients with OSCC were performed according to the American Joint Committee on Cancer (AJCC) guidelines.

Bioinformatics analyses

The GSE87539 [18] and GSE138206 [19] data were downloaded from Gene Expression Omnibus (GEO; http://www.ncbi.nlm.nih.gov/geo). The probe ID was converted into an international standard name for gene symbols using perl programming and the gene expression matrix of the two datasets were merged by perl language also. The data normalized were used by R language “sva” and “limma” packages, the differentially expressed genes (DEG) were filtered by “limma” package and using a cutoff criterium of adj. P.Val < 0.05 and |log2(fold change)|> 2. The Gene Ontology (GO) and Kyoto Encyclopedia of Genes and Genomes (KEGG) enrichment analysis were used by R language “colorspace” and “string” packages, and Bioconductor packages(“DOSE”, “clusterProfiler” and “pathview”). The PPI network of DEGs using online database STRING version 11 (https://string-db.org/) and the combining score >0.9 were used for the PPI network construction. The top 30 hub genes were visualized by using Cytoscape software. Gene set enrichment analysis (GSEA) was used to evaluate the gene function between treated and control groups.

Immunohistochemistry (IHC) and immunofluorescence (IF) evaluation

OSCC samples and normal oral mucosa samples were harvested from humans and mice for HE staining and IHC; the methods for HE and IHC were described in our previous study [20]. Samples for IHC and IF were embedded in the optimal cutting temperature (OCT) compound and sectioned into 8-μm sections. IHC and IF were performed with anti‑P. gingivalis (Dia‑An, lnc, 1:200), anti‑CXCL2 (bs‑1162R, BIOSS, 1:500) and anti‑TANs (CD66b⁺, ab197678, Abcam, 1:500) antibodies. The immune expression of TANs in mice was assessed with an antibody against CD11b⁺ (bs-1014R, BIOSS, Biotech, Beijing, China, 1:500) [21]. Image-Pro Plus version 6.0 software (Media Cybernetics, Inc., Bethesda, MD, USA) was used to evaluate the IHC expression levels. The IOD/total area of each field was also calculated simultaneously. According to the IOD value, the staining proportions (PS) were divided into: 0 (–), 1 (+), 2 (++), and 3 (+ + +). Four levels: 0 (0%); 1 (1–25%); 2 (26–50%); 3 (51–75%); and 4 (76–100%) were divided by the staining proportion score (PS). The IS multiplied by PS was the final result of the staining score [22]. The expression level were categorized into a low expression group (0–6) and a high expression group (7–12) in this study.

Bacterial and cell culturing

The P. gingivalis ATCC33277 strain was purchased from The American Type Tissue Culture Collection (ATCC), and the bacteria were grown in two culture systems: (1) Columbia liquid medium (purchased from Bei-Na Biotech, Inc., Beijing, China) and (2) Columbia blood agar culture medium (purchased from Bei-Na Biotech, Inc., Beijing, China). The human OSCC cell line TSCCa was provided by the Central Laboratory of First Affiliated Hospital of Xinjiang Medical University. TSCCa cells were maintained in RPMI 1640 (Thermo Fisher Scientific, CA, USA) containing 10% FBS (Thermo Fisher Scientific, CA, USA), penicillin and streptomycin (100 µg/ml) (Thermo Fisher Scientific, CA, USA). The coculture cell model (P. gingivalis and TSCCa) was established with a multiplicity of infection (MOI) of 50. Human TANs were extracted from the peripheral blood of OSCC patients with a human peripheral blood neutrophil isolation kit (Solarbio, Biotech, Inc., Beijing, China). TANs were added to the coculture cell model at a 1:1 ratio.

Fluorescent staining of cell co-culture model

Bacterial staining: P. gingivalis was marked by the fluorochrome of SYTO9 Green Fluorescent Nucleic Acid Stain (Thermo Fisher Scientific, CA, USA). Nuclear staining was performed with DAPI (Bioss, Biotech, Inc., Beijing, China). Cellular mitochondrial staining was marked by MitoTracker red (Beyotime Biotech, Inc., Beijing, China). The coculture cell model was established at an MOI of 50 in a 37 °C incubator for 48 hours, and confocal laser photography was performed.

Neutrophil chemotaxis assay

We used Transwell chambers (Corning, Bioscience, NY, USA) with 5-µm polycarbonate membranes. Briefly, TANs were treated with the supernatant of different groups, and the supernatant was placed into the bottom chamber. TANs suspended in RPMI 1640 containing 2% FBS (1×10⁵ cells/100 µL) were added to the upper wells and incubated for 2 hours in a 37 °C incubator. We collected TANs that migrated to the lower chamber and counted them after staining with crystal violet.

Cell Counting Kit-8 (CCK-8) assay

Cell proliferation was evaluated by CCK-8 assay (Keygen Biotech, China) following the manufacturer’s instructions. Ten microlitres of CCK-8 were added to each well. The 96-well plates were incubated for 2 hours at 37 °C, and wells with only RPMI 1640 medium were used as blank controls. The absorbance of the coloured solution was quantified at 450 nm using a microplate reader (Tecan, Untersbergstrasse, Austria).

Invasion assay

Basement Matrigel membrane (BD Biosciences, CA, USA) was used to precoat the Transwell chamber with a filter with 8‐μm pores (Corning, Bioscience, NY, USA); 2 × 10⁵ cells from 5 different groups were suspended in FBS-free medium and seeded on the upper chamber. In the lower chamber, medium containing 10% FBS was added. Forty-eight hours later, the medium was aspirated, and the cells on the upper chamber were wiped away. The cells on the lower surface of the filter were counted after staining with crystal violet.

Enzyme-linked immunosorbent assay (ELISA)

To detect the level of CXCL2 in cell culture supernatants, we used the corresponding Quantikine Human ELISA Kit (Boster Biotech, Inc., Wuhan, China) in accordance with the manufacturer’s instructions. The absorption was measured at 450 nm on a Thermo Scientific microplate reader. The assay can determine the levels in unknown samples according to the standard curve, which is made based on the absorption values of the standard sample.

OSCC mouse model

C57BL/6 mouse OSCC models were created with SCC7 cell lines, and all animal protocols were approved by the Animal Care Committee. The mice were divided into 4 groups, the treatment groups were injected with different doses of SCH527123 in the tumour cell site at 4, 8, 12 and 16 days. The mice were sacrificed at 10 or 20 days. The tumour tissue was removed for volume calculation, IHC and IF studies.

Transfection of lentiviral vectors

Recombinant lentiviruses named sh-CXCL2 and sh-CXCR2 were used to interfere with CXCL2/CXCR2 axis expression, and two empty carrier lentiviruses were used as negative controls. The lentivirus was purchased from GeneChem Biotech, Inc. (Shanghai, China). The cells were incubated with lentivirus for 48 hours and screened with puromycin.

RNA isolation and quantitative real-time PCR

Total RNA was isolated from cells according to the TRIzol method (Invitrogen, Carlsbad, CA) in accordance with the manufacturer’s instructions. We measured mRNA expression in cells via qRT-PCR. qRT-PCR was performed using the SYBR Prime Script RT-PCR Kit (Thermo Fisher Scientific, CA, USA) in accordance with the manufacturer's instructions. We used GAPDH as an internal control. The primers used are listed in Table 4.

Western blot analysis

The same amounts of protein samples (40 μg each) were separated by 12% sodium dodecyl sulfate polyacrylamide gel electrophoresis for 150 min at 75 V, and then the proteins were transferred to polyvinylidene difluoride (PVDF) membranes for 2 hours at 100 V; the membranes were incubated in blocking buffer (5% milk in 1× tris‐buffered saline [TBS]) for 1 hour at RT. The PVDF membranes were rocked in 1:1,000 primary antibody solution for at least one overnight at 4 °C. Then, the PVDF membranes were incubated in 1:1,000 secondary antibody solution for 1 hour at RT. The results were visualized with chemiluminescent HRP substrate (Millipore, MA). Primary antibodies against P. gingivalis (Dia‑An, lnc, it was freshly prepared, 1:1000), CXCL2 (bs‑1162R, BIOSS, Biotech, Beijing, China, 1:2000), CXCR2 (bs‑1629R, BIOSS, Biotech, Beijing, China, 1:2000), JAK1 (bs‑1439R, BIOSS, Biotech, Beijing, China, 1:2000), STAT3 (bs‑55208R, BIOSS, Biotech, Beijing, China, 1:2000), p-JAK1 (bs‑3238R, BIOSS, Biotech, Beijing, China, 1:2000), p-STAT3 (bs‑1658R, BIOSS, Biotech, Beijing, China, 1:2000), E-cadherin (bs‑10009R, BIOSS, Biotech, Beijing, China, 1:2000), N-cadherin (bs‑1172R, BIOSS, Biotech, Beijing, China, 1:2000), and GAPDH (bs‑13282R, BIOSS, Biotech, Beijing, China, 1:2000) and secondary antibodies (anti‐rabbit‐HRP, Cell Signalling Technology, Inc, Boston, USA) were used in this study.

Statistical analysis

All data were expressed as mean ± SE of three independent experiments and were analysed using Student’s t-tests or one‐way analysis of variance as indicated. For analysis of clinical data, counting data were expressed by frequency and composition ratio, chi-square test was used for comparison between groups, COX regression were used to analyze the correlation between clinical indicators and death. Statistical significance was defined as p < 0.05 (*p < 0.05, **p < 0.01, and ***p < 0.001).

Results

Identification of CXCL2 as a differentially expressed gene (DEG) in the TME of OSCC infected with P. gingivalis by bioinformatics analyses

After merging and standardizing the two datasets, the DEGs (298 genes up and 294 genes down) were identified. (Fig. 1A and B). The chemokine signalling pathway was identified as enriched via KEGG and GO analysis (Fig. 2A and 2B). The CXCL2 was a hub DEGs in the PPI network and Cytoscape (Fig. 2C and 2D), the neutrophil chemotaxis function was enriched by GSEA analysis (Fig. 2E).

IHC and IF staining of P. gingivalis, CXCL2 and TANs in the OSCC and normal oral mucosa samples

The IF double-labelling results for OSCC samples showed the location relationships of the three components, however, normal samples were negative for all three. (Fig. 3A). The IHC results for 140 OSCC samples showed that samples were positive for P. gingivalis, CXCL2 and TANs, there were strong expression in III-IV clinical stage of OSCC, however, the weak expression in I-II clinical stage of OSCC. (Fig. 3B).

P. gingivalis, CXCL2 and TANs predicted the survival of 140 OSCC patients independently

To further evaluate the impact of P. gingivalis, CXCL2 and TANs in OSCC, the association between P. gingivalis, CXCL2 and TANs expression and patient clinicopathological parameters was investigated. In total, 140 primary OSCC patients, samples were divided into two groups according to the expression levels of the three indicators. P. gingivalis, CXCL2 and TANs high expression was found to be correlated with clinical indicators. (Table 1). Furthermore, multivariate Cox-regression analysis illustrated that P. gingivalis, CXCL2 and TANs were an independent prognostic factor for OSCC. (Table 2,3 and Figure 3 C).

Development of a coculture cell model of P. gingivalis and TSCCa cells and biological behaviour assays of cell models

The coculture model was established successfully (Fig. 4A). The protein level of P. gingivalis in the coculture group was significantly higher than that in the TSCCa cells group (Fig. 4B). The mRNA level of P. gingivalis in the coculture group was also significantly higher than that in the TSCCa cells group (P<0.001) (Fig. 4C).

TANs were treated with the supernatant of TSCCa, P. gingivalis and TSCCa + P. gingivalis cultures, and the results showed that the supernatant of the TSCCa + P. gingivalis culture had the strongest chemotactic ability to TANs (Fig. 4D). The CXCL2 protein levels of the supernatant of the TSCCa + P. gingivalis + TANs culture were significantly higher than those of the TSCCa (P<0.001) and TSCCa + P. gingivalis cultures (P<0.001) (Fig. 4E). The invasion and proliferation capacities of TSCCa cells improved significantly in the TSCCa + P. gingivalis + TANs group. After using SCH527123, the invasion and proliferation capacities of TSCCa cells were reduced significantly (Fig. 4F, G).

P. gingivalis promotes OSCC tumour progression via CXCL2/CXCR2 axis in C57BL/6 mouse models

A diagram of our experimental protocol is shown (Fig. 5A). The tumours of the experimental group were significantly larger than those of the control group. When SCH527123 was used for treatment, the tumour volume of the treatment group was reduced compared with that of the experimental group. Compared with that in the low-dose treatment group, the tumour inhibition in the high-dose treatment group was more obvious (Fig. 5B). Successful generation of the tumour-bearing mouse model was confirmed by HE staining. IHC showed that the expression of P. gingivalis was negative in the control group but positive in the experimental group (Fig. 5C). The IF double-labelling of mouse model samples showed that the levels of CXCL2 and TANs in the experimental group were higher than those in the control group; in the low-dose treatment group, the levels of CXCL2 and TANs were lower than those in the experimental group. In the high-dose treatment group, the levels of CXCL2 and TANs were significantly lower than those in the experimental group. In addition, compared with those in the low-dose treatment group, the levels of CXCL2 and TANs were lower than those in the high-dose treatment group (Fig. 5D).

The CXCL2/CXCR2 axis is activated by P. gingivalis and induces the EMT phenotype via the JAK1/STAT3 signalling pathway

The protein levels of CXCL2, CXCR2, JAK1, STAT3, p-JAK1, p-STAT3, and N-cadherin were significantly increased, however, the protein levels of E-cadherin were significantely decreased as shown by Western blot analysis, which means that the EMT phenotype was presented and the signaling pathway of JAK1/STAT3 was activated in the group of TSCCa + P. gingivalis +TANs. (Fig. 6A).

CXCL2/CXCR2 knockdown inhibits the activation level of the JAK1/STAT3 signalling pathway and reverses the EMT phenotype of OSCC cells

CXCL2 and CXCR2 lentiviruses were transfected into a cocultured cell model (Fig. 6B). The knockdown level was verified by qRT – PCR and Western blotting (Fig. 6C, D). The lentiviruses of sh-CXCL2 and sh-CXCR2 were co-transfected into TSCCa cells (Fig. 7A). Flow cytometry was used to screent out the positive cells that expression both lentiviruses of sh-CXCL2 and sh-CXCR2 (Fig. 7B). The cloned of positive cells were screen out by limited dilution method (Fig. 7C). Four different cell models were established using sh-CXCL2/CXCR2 lentivirus-positive cells. At the molecular level, the activation of JAK1/STAT3 was decreased, and the phenotype of EMT was reversed according to Western blot assays (Fig. 7D).

Discussion

The oral microbiota plays an important role in promoting the development of OSCC through mediating the direct metabolism of chemical carcinogens and the systemic inflammatory response [23]. Oral microbiota such as P. gingivalis can destroy the local immune response by establishing chronic inflammation and can lead to the immune escape of tumour cells [24]. In this study, we have evidenced that when P .gingivalis infects the TME of OSCC, the novel CXCL2/CXCR2/JAK1/STAT3 signaling pathway is crucial for the progression and EMT phenotype acquisition of OSCC cells. Our initial study has screened out the CXCL2 was not only a hub DEGs but also a hub gene in the PPI network from the two datasets has been merged. Moreover, the neutrophil chemotaxis related signalling pathway and gene function were enriched by GO, KEGG and GSEA analysis. Previous studies has reported that P .gingivalis induced the production of reactive oxygen species ,CXCL8 and CCL2 by neutrophils to deteriorate periodontitis [25]. Key periodontal pathogens P. gingivalis and F. nucleatum could enhance OSCC cell migration, invasion, stemness and tumor aggressivity [26]. Based on the results of our bioinformatics analysis and previous studies, we speculated that elevated P .gingivalis infected OSCC samples may exacerbate the OSCC progression via CXCL2/CXCR2 axis to recruit TANs. To verify this assumption, we then evaluated the expression of P. gingivalis in OSCC samples. We found that the P. gingivalis, CXCL2 and TANs were positive expression in OSCC samples and negative expression in normal samples. Moreover, the strong expression of P. gingivalis, CXCL2 and TANs in OSCC patients may be tightly relate to the poor prognosis of OSCC patients.

It is well known that P. gingivalis has been reported to disrupt the normal immune response of the host and is associated with the progression of OSCC by regulating the immune response [27]. Recently, it has been reported that CXCL2 can promote the occurrence of colorectal cancer by recruiting myeloid-derived suppressor cells (MDSCs) to increase their abundance [28]. Studies have pointed out that neutrophils in the TME increased the invasiveness of OSCC, because the oral cavity has a constant population of neutrophils, in specific inflammatory states, including periodontal disease [29]. Although a large number of studies have confirmed the close relationship between P. gingivalis and OSCC, few studies have analysed the molecular mechanism by which P. gingivalis promotes tumour progression in the TME of OSCC. As the TANs recruited from TME when P .gingivalis infected, the TME may have the potential for pro-tumor effect. Because of a neurmous inflammatory cytokines were released, various types of immune cells were recruited increasingly and to form a positive loop to further promote tumor progression. For determining the chemotactic ability of P .gingivalis to TANs, the co-culture cell models were constructed and then we found that the protein and mRNA expression level of CXCL2 and the chemotaxis ability were evaluated seriously compare to control groups. In our study, P. gingivalis was found to invade and colonize tumour cells and by building the cells and animal model, the ability of P .gingivalis on promoting tumor progression were assessed in vitro and in vivo, we found that the P .gingivalis could promote the invasion and proliferation of tumor cells, and promte tumor progression in tumor-bearing mice. Human papillomavirus (HPV) is a key pathogenic factor that facilitates OSCC formation by establishing a coculture system between microbiota and tumour cells [30]. This is consistent with the conclusion that P. gingivalis can promote the aggressive phenotype of tumour cells in the present study.

Chemotactic factors have been identified as kinds of key regulator of tumor progression, by binding to corresponding receptors, they activate various kinds of immune cells [31]. CXCL2 is a secreted chemokine that mainly produced by tumor cells, neutrophils, macrophages, and pathogenic microorganisms [32], CXCL2 interacts with its receptor CXCR2 to regulator biological functions, CXCL2/CXCR2 asix could activates a board spectrum downstream signaling, such as JAK1/STAT3, PI3K/AKT and MAPK/p38 etc [33]. Although the effect of CXCL2/CXCR2 and its downstream signaling pathways on tumor progression has been studied for years, the biofunction of CXCL2 in OSCC is still unclear. In our study, we found that CXCL2/CXCR2 axis and its downstream signaling, both JAK1/STAT3 and EMT phenptype were activated after the TME was infected by P .gingivalis. In addition, the biological behavior of tumor cells and the tumor volume of tumor-bearing mice were reduced clearly by specific CXCL2/CXCR2 inhibitor application. Moreover, immunofluorescence showed that the expression of CXCL2 and TANs were significantly reduced in tumor-bearing samples of mice.

The CXCL2/CXCR1 signalling axis has been found to promote tumour progression by mediating angiogenesis in different types of tumours [34]. CXCR2, as a nonspecific receptor for CXCL2, has been proven to promote tumour development in a variety of tumours [35]. We targeted the CXCL2/CXCR2 signalling axis and blocked the expression of this signalling axis through lentivirus interference, resulting in the reversal of the highly invasive phenotype of cells and reduced activation of the JAK1/STAT3 signalling pathway. Small molecule inhibitors are promising targeted therapies, and after oral administration of SCH527123 inhibitor to transplanted tumour-bearing mice, the tumour volume was decreased significantly, suggesting that SCH527123 may be a promising drug for melanoma treatment [36]. Our study verified that inhibition of the signalling axis can indeed reduce the proliferation and invasion of OSCC cells at the cellular and animal levels and demonstrated the molecular mechanisms involved.

In summary, P. gingivalis promotes OSCC progression by recruiting TANs by increasing the secretion of CXCL2 in the TME of OSCC. These findings suggest that P. gingivalis may be a potential risk factor for poor prognosis in OSCC patients. The CXCL2/CXCR2 signalling axis may be a new potential target for the management of OSCC patients with severe periodontal disease.

References

Chi A. C., Day T. A., Neville B. W. Oral cavity and oropharyngeal squamous cell carcinoma--an update. CA Cancer J Clin. 2015;65:401-21.
Siegel R. L., Miller K. D., Fuchs H. E., Jemal A. Cancer Statistics, 2021. CA Cancer J Clin. 2021;71:7-33.
Li P., Cao Q., Shao P. F., Cai H. Z., Zhou H., Chen J. W., et al. Genetic polymorphisms in HIF1A are associated with prostate cancer risk in a Chinese population. Asian J Androl. 2012;14:864-9.
Amieva M., Peek RM Jr. Pathobiology of Helicobacter pylori-Induced Gastric Cancer. Gastroenterology. 2016;150:64-78.
Inaba H., Sugita H., Kuboniwa M., Iwai S., Hamada M., Noda T., et al. Porphyromonas gingivalis promotes invasion of oral squamous cell carcinoma through induction of proMMP9 and its activation. Cell Microbiol. 2014;16:131-45.
Liu X. B., Gao Z. Y., Sun C. T., Wen H., Gao B., Li S. B., et al. The potential role of P.gingivalis in gastrointestinal cancer: a mini review. Infect Agent Cancer. 2019;14:23.
Irfan M., Delgado RZR, Frias-Lopez J. The Oral Microbiome and Cancer. Front Immunol. 2020;11:591088.
Libby P. Inflammatory mechanisms: the molecular basis of inflammation and disease. Nutr Rev. 2007;65:S140-6.
Wang J., Jia Y., Wang N., Zhang X., Tan B., Zhang G., et al. The clinical significance of tumor-infiltrating neutrophils and neutrophil-to-CD8+ lymphocyte ratio in patients with resectable esophageal squamous cell carcinoma. Transl Med. 2014;12:7.
Powell D. R., Huttenlocher A. Neutrophils in the Tumor Microenvironment. Trends Immunol. 2016;37:41-52.
Sahingur S. E., Yeudall W. A. Chemokine function in periodontal disease and oral cavity cancer. Front Immunol. 2015;6:214.
Vashishta A., Jimenez-Flores E., Klaes C. K., Tian S., Miralda I., Lamont R. J., et al. Putative Periodontal Pathogens, Filifactor Alocis and Peptoanaerobacter Stomatis, Induce Differential Cytokine and Chemokine Production by Human Neutrophils. J Pathogens. 2019;8
Chen Y, Shao Z, Jiang E, et al. CCL21/CCR7 interaction promotes EMT and enhances the stemness of OSCC via a JAK2/STAT3 signaling pathway. J Cell Physiol. 2020,235(9):5995-6009.
Hardaway A. L., Herroon M. K., Rajagurubandara E., Podgorski I. Marrow adipocyte-derived CXCL1 and CXCL2 contribute to osteolysis in metastatic prostate cancer. Clin Exp Metastasis. 2015;32:353-68.
Acharyya S., Oskarsson T., Vanharanta S., Malladi S., Kim J., Morris P. G., et al. A CXCL1 paracrine network links cancer chemoresistance and metastasis. Cell. 2012;150:165-78.
Yu H., Lee H., Herrmann A., Buettner R., Jove R. Revisiting STAT3 signalling in cancer: new and unexpected biological functions. Nat Rev Cancer. 2014;14:736-46.
Wang J, Lv X, Guo X, et al. Feedback activation of STAT3 limits the response to PI3K/AKT/mTOR inhibitors in PTEN-deficient cancer cells. Oncogenesis. 2021,10(1):8.
Geng F., Liu J., Guo Y., Li C., Wang H., Wang H., et al. Persistent Exposure to Porphyromonas gingivalis Promotes Proliferative and Invasion Capabilities, and Tumorigenic Properties of Human Immortalized Oral Epithelial Cells. Front Cell Infect Microbiol. 2017;7:57.
Qiu X., Lei Z., Wang Z., Xu Y., Liu C., Li P., et al. Knockdown of LncRNA RHPN1-AS1 Inhibits Cell Migration, Invasion and Proliferation in Head and Neck Squamous Cell Carcinoma. J Cancer. 2019;10:4000-8.
[20 ] Guo Z. C., Jumatai S., Jing S. L., Hu L. L., Jia X. Y., Gong Z. C. Bioinformatics and immunohistochemistry analyses of expression levels and clinical significance of CXCL2 and TANs in an oral squamous cell carcinoma tumor microenvironment of Prophyromonas gingivalis infection. Oncol Lett. 2021;21:189.
Schmid M C, Khan S Q, Kaneda M M, et al. Integrin CD11b activation drives anti-tumor innate immunity. Nat Commun. 2018,9(1):5379.
Xue Y, Du HD, Tang D, et al. Correlation Between the NLRP3 Inflammasome and the Prognosis of Patients With LSCC[J]. Front Oncol. 2019,9:588.
Vyhnalova T, Danek Z, Gachova D, et al. The Role of the Oral Microbiota in the Etiopathogenesis of Oral Squamous Cell Carcinoma[J]. Microorganisms. 2021,9(8).
Whitmore S. E., Lamont R. J. Oral bacteria and cancer. Plos Pathog. 2014;10:e1003933.
Damgaard C, Kantarci A, Holmstrup P, et al. Porphyromonas gingivalis-induced production of reactive oxygen species, tumor necrosis factor-alpha, interleukin-6, CXCL8 and CCL2 by neutrophils from localized aggressive periodontitis and healthy donors: modulating actions of red blood cells and resolvin E1. J Periodontal Res. 2017,52(2):246-254.
Kamarajan P, Ateia I, Shin J M, et al. Periodontal pathogens promote cancer aggressivity via TLR/MyD88 triggered activation of Integrin/FAK signaling that is therapeutically reversible by a probiotic bacteriocin. PLoS Pathog. 2020,16(10):e1008881.
Lafuente Ibanez De Mendoza I., Maritxalar Mendia X., Garcia De La Fuente AM, Quindos Andres G., Aguirre Urizar JM. Role of Porphyromonas gingivalis in oral squamous cell carcinoma development: A systematic review. J Periodontal Res. 2020;55:13-22.
Harusato A, Viennois E, Etienne-Mesmin L, et al. Early-Life Microbiota Exposure Restricts Myeloid-Derived Suppressor Cell-Driven Colonic Tumorigenesis. Cancer Immunol Res. 2019,7(4):544-551.
Glogauer J E, Sun C X, Bradley G, et al. Neutrophils Increase Oral Squamous Cell Carcinoma Invasion through an Invadopodia-Dependent Pathway. Cancer Immunol Res. 2015,3(11):1218-1226.
Lakschevitz F S, Aboodi G M, Glogauer M. Oral neutrophils display a site-specific phenotype characterized by expression of T-cell receptors. J Periodontol. 2013,84(10):1493-1503.
El-Bayoumy K, Christensen N D, Hu J, et al. An Integrated Approach for Preventing Oral Cavity and Oropharyngeal Cancers: Two Etiologies with Distinct and Shared Mechanisms of Carcinogenesis. Cancer Prev Res (Phila). 2020,13(8):649-660.
Zhang Q, Wang J, Yao X, et al. Programmed Cell Death 10 Mediated CXCL2-CXCR2 Signaling in Regulating Tumor-Associated Microglia/Macrophages Recruitment in Glioblastoma. Front Immunol. 2021,12:637053.
Lin T, Zhang E, Mai P P, et al. CXCL2/10/12/14 are prognostic biomarkers and correlated with immune infiltration in hepatocellular carcinoma. Biosci Rep. 2021,41(6).
Grepin R, Guyot M, Giuliano S, et al. The CXCL7/CXCR1/2 axis is a key driver in the growth of clear cell renal cell carcinoma. Cancer Res. 2014,74(3):873-883.
Wei Z. W, Xia G. K, Wu Y, Chen W, Xiang Z, et al. CXCL1 promotes tumor growth through VEGF pathway activation and is associated with inferior survival in gastric cancer. Cancer Lett. 2015;359:335-43.
Susek K. H, Karvouni M, Alici E, Lundqvist A. The Role of CXC Chemokine Receptors 1-4 on Immune Cells in the Tumor Microenvironment. Front Immunol. 2018;9:2159.
hapman R. W, Minnicozzi M, Celly C. S, Phillips J. E, Kung T. T, et al. A novel, orally active CXCR1/2 receptor antagonist, Sch527123, inhibits neutrophil recruitment, mucus production, and goblet cell hyperplasia in animal models of pulmonary inflammation. J Pharmacol Exp Ther. 2007;322:486-93.
Lee J, Roberts J. S, Atanasova K. R, Chowdhury N, Han K, et al. Human Primary Epithelial Cells Acquire an Epithelial-Mesenchymal-Transition Phenotype during Long-Term Infection by the Oral Opportunistic Pathogen, Porphyromonas gingivalis. Front Cell Infect Microbiol. 2017;7:493.

Tables

Table 1

Immunohistochemical expression of P . gingivalis, CXCL2 and TANs in samples from 96 patients with oral squamous cell carcinoma according to clinical data and follow‑up.

Variable		P. gingivalis				P	CXCL2				P	TANs				P
		Weak		Strong			Weak		Strong			Weak		Strong
Gender						0.460					0.795					0.888
	Male		36(40.9)		52(59.1)			42(47.7)		46(52.3)			40(45.5)		48(54.5)
	Female		18(34.6)		34(65.4)			26(50.0)		26(50.0)			23(44.2)		29(55.8)
Age						0.784					0.902					0.800
	<60 years		17(37.0)		29(63.0)			22(47.8)		24(52.2)			20(43.5)		26(56.5)
	≥60 years		37(39.4)		57(60.6)			46(48.9)		48(51.1)			43(45.7)		51(54.3)
Living Status						<0.001					<0.001					<0.001
	Living		52(48.1)		56(51.9)			65(60.2)		43(39.8)			60(55.6)		48(44.4)
	Dead		2(6.3)		30(93.8)			3(9.4)		29(90.6)			3(9.4)		29(90.6)
Differentiation						0.495					0.090					0.436
	Poor- Moderately		18(42.9)		24(57.1)			25(59.5)		17(40.5)			21(50.0)		21(50.0)
	Well		36(36.7)		62(63.3)			43(43.9)		55(56.1)			42(42.9)		56(57.1)
T Stage						<0.001					<0.001					<0.001
	T1-2		49(55.1)		40(44.9)			62(69.7)		27(30.3)			58(65.2)		31(34.8)
	T3-4		5(9.8)		46(90.2)			6(11.8)		45(88.2)			5(9.8)		46(90.2)
N Stage						<0.001					<0.001					<0.001
	N0		34(68.0)		16(32.0)			32(64)		18(36.0)			32(64)		18(36.0)
	N+		34(37.8)		56(62.2)			31(34.4)		59(65.6)			31(34.4)		59(65.6)
Clinical Stage						<0.001					<0.001					<0.001
	I-II		29(78.4)		8(21.6)			31(83.8)		6(16.2)			29(78.4)		8(21.6)
	III-IV		25(24.3)		78(75.7)			37(35.9)		66(64.1)			34(33)		69(67)
Recurrence						0.153					0.090					0.422
	No		43(42.2)		59(57.8)			54(52.9)		48(47.1)			48(47.1)		54(52.9)
	Yes		11(28.9)		27(71.1)			14(36.8)		24(63.2)			15(39.5)		23(60.5)

Porphyromonas gingivalis, P. gingivalis; C‑X‑C motif chemokine ligand 2, CXCL2; Tumour-associated neutrophils, TANs, *P< 0.05, **P< 0.01, ***P< 0.001.

Table 2

Univariate COX regression analysis of influencing factors of OSCC patients death


Variable		β	SE	Waldχ²	HR(CI 95%)	P
Gender	Male				1.000
	Female	-0.174	0.372	0.217	0.841(0.405-1.744)	0.641
Age	<60 years				1.000
	≥60 years	-0.035	0.372	0.009	0.966(0.465-2.004)	0.925
Differentiation	Poor- Moderately				1.000
	Well	-0.809	0.354	5.214	0.445(0.222-0.892)	0.022
T Stage	T1-2				1.000
	T3-4	1.019	0.357	8.146	2.769(1.376-5.574)	0.004
N Stage	N0				1.000
	N+	1.454	0.535	7.385	4.279(1.5-12.209)	0.007
Clinical Stage	I-II				1.000
	III-IV	1.784	0.73	5.969	5.956(1.423-24.929)	0.015
Recurrence	No				1.000
	Yes	1.175	0.354	11.02	3.238(1.618-6.48)	0.001

Porphyromonas gingivalis, P. gingivalis; C‑X‑C motif chemokine ligand 2, CXCL2; Tumour-associated neutrophils, TANs, *P< 0.05, **P< 0.01, ***P< 0.001.

Table 3

Correlation analysis of the expression levels of P .gingivalis ,CXCL2 and TANs between OSCC patients deaths.


Variable		Mdel1		Model2
Variable		HR (95% CI)	P	HR (95% CI)	P
P. gingivalis	Weak	1.000		1.000
	Strong	11.547(2.758-48.346)	<0.001	7.128(1.562-32.537)	0.011
CXCL2	Weak	1.000		1.000
	Strong	11.906(3.622-39.142)	<0.001	9.519(2.619-34.604)	<0.001
TANs	Weak	1.000		1.000
	Strong	10.081(3.067-33.138)	<0.001	8.092(2.253-29.063)	0.001

Porphyromonas gingivalis, P. gingivalis; C‑X‑C motif chemokine ligand 2, CXCL2; Tumour-associated neutrophils, TANs. No indicators were adjusted in Model 1, indicators such as T stage and recurrence were adjusted in Model 2, *P< 0.05, **P< 0.01, ***P< 0.001.

Table 4

Primer sequence of qRT-PCR

Name of bacterial and genes	Primer sequence（3'→5’） Reference
P. gingivalis	F：TGTAGATGACTGATGGTGAACC J Lee et al，2017^[37]
	R：ACGTCATCCACACCTTCCTC
CXCL2	F：ATCCAAAGTGTGAAGGTGAAGTC
	R：CCCATTCTTGAGTGTGGCTATG
CXCR2	F：GCCATGGACTCCTCAAGATT
	R：AAGTGTGCCCTGAAGAAGAG
GAPDH	F：GGGAAACTGTGGCGTGAT
	R：AAAGGTGGAGGAGTGGGT

Porphyromonas gingivalis, P. gingivalis; C‑X‑C motif chemokine ligand 2, CXCL2; C-X-C motif chemokine receptor 2, CXCR2

Prophyromonas gingivalis promotes the progression of oral squamous cell carcinoma by activating the neutrophil chemotaxis in the tumor microenvironment

Abstract

Introduction

Materials And Methods

Results

Discussion

Abbreviations

Declarations

References

Tables