Generation of IL-6 shRNA-expressing CAR constructs
We designed 8 different short hairpin RNA (shRNA) sequences targeting the 3’ untranslated region (UTR) of the human IL-6 gene using human U6 as the promotor (sequence: 5’AATTCAAAAAAGGGCACAGAACTTATGTTGTTCTCGAGAGAACAACATAAGTTCTGTGC-3’). Different shRNAs were synthesized by GENERAY Biotech (Shanghai, China) and inserted into a CAR construct (Unicar-Therapy Bio-medicine Technology Co., Ltd., Shanghai, China) containing a CD19-targeted single-chain variable fragment (FMC63), the EF1a promoter, the costimulatory 4-1BB domain, and the CD3 zeta domain. The construct was cotransfected with three packaging plasmids into HEK 293T packaging cells, and the resulting lentiviruses were isolated, concentrated by ultracentrifugation, and immediately stored at -80 °C.
CART-19 cells and target cell lines
Peripheral blood mononuclear cells (PBMCs) were obtained from healthy donors by gradient centrifugation using Lymphoprep™ (Oriental Hua Hui, Beijing, China). For CAR T cell preparation, T lymphocytes were purified using anti-CD3 positive-selection beads (Miltenyi Biotec, Bergisch-Gladbach, Germany) and stimulated with anti-CD3/CD28 monoclonal antibodies (Miltenyi Biotec) for 18-24 h. The T cells were then transduced with recombinant lentiviral vectors for 48 h. The CAR T cells were cultured for 12-14 days in AIM-V medium (Gibco, NY, USA) supplemented with 10% autologous human serum, 100 IU/mL recombinant human IL-2 (PeproTech, Rocky Hill, USA), 5 ng/mL recombinant human IL-7 (PeproTech) and 5 ng/mL recombinant human IL-15 (PeproTech).
Monocytes were collected as previously described[23]. In total, 2×106 cells were seeded per well in 1 mL of RPMI 1640 medium (Gibco) supplemented with 0.1 mmol/L minimum essential medium containing nonessential amino acids (Solarbio, Beijing, China), 2 mmol/L L-glutamine (Thermo Fisher, Waltham, USA), and 10% fetal bovine serum (FBS; Gibco). Cells were supplemented with fresh medium every two days, harvested using 2 mmol/L ethylenediaminetetraacetic acid (EDTA, Klamar, Shanghai, China) and stained with an APC-conjugated antibody against CD14 (BD Bioscience, New Jersey, USA) to confirm differentiation.
A CD19-expressing Burkitt human B lymphoma (Raji) cell line and the K562 human leukemia cell line (ATCC, Manassas, VA, USA) were used as target cells in vitro and as control cells. The cells were maintained in RPMI 1640 medium (Gibco) supplemented with 10% FBS (HyClone, UT, USA) according to manufacturer protocols. Raji cells were transfected with a firefly luciferase construct (Unicar-Therapy Bio-medicine Technology Co., Ltd., Shanghai, China) using a lentiviral vector, and stably transfected cells were selected using puromycin.
Coculture assay
An “effector/target cell” culture model was used for the coculture assay. CAR T cells (effector cells) and Raji cells (target cells) were incubated at a ratio of 5:1 for 24 h in 100 µL of T cell culture medium AIM-V (Gibco) in 96-well plates. The culture supernatant was then added to primary monocytes, and IL-6 levels in the supernatant were measured using the Th1/Th2 Cytometric Bead Array Kit II (BD Bioscience). The IL-6 levels at 0 h (immediately after the addition of the coculture supernatant) were used as the baseline.
Then, 10 ng/mL human recombinant IL-6, IL-2, IL-1 or IFN-γ (PeproTech) was added to the monocyte cultures. Supernatant samples were collected at 6 h, 24 h and 48 h after beginning the coincubations of the different cytokines and monocytes, and monocytes incubated with an equal volume of saline were used as a control for comparisons of cytokine profiles in this experiment.
For re-stimulation cocultures, CAR T cells expressing an shRNA against IL-6 (ssCART-19) or regular CAR T cells were cocultured with Raji cells at a ratio of 5:1 for 6 days, and the different types of CAR T cells were re-stimulated with Raji cells every 36 h. Supernatants were collected every 12 h, and the levels of IL-6, IFN-γ and IL-2 were measured with the Th1/Th2 Cytometric Bead Array Kit II.
Flow cytometry
All samples were washed twice in 0.1 mL of phosphate-buffered saline (PBS) containing 2% FBS. The transduction efficiency and CD4/CD8 ratio were determined by labeling CAR T cells with a FITC-labeled human CD19 protein, Fc Tag (CD9-HF251, ARCO, Biosystems, Beijing, China), an APC-conjugated antibody against CD8 (catalog no. 344722, BioLegend, California, USA), and a PE-Cy7-conjugated antibody against CD4 (25-0047-42, eBioscience, San Diego, CA) at 4°C for 45 min in the dark.
For assessing the CAR T cell phenotype to analyze CAR T cell differentiation stages, CAR T cells were incubated with the following antibodies: APC-Cy7-conjugated anti-CD8 (344714, BioLegend), AF700-conjugated anti-CD4 (56004942, eBioscience), PE-conjugated anti-CCR7 (353204, BioLegend), PerCP-Cy5.5-conjugated anti-CD45RA (304122, BioLegend), and PE-Cy7-conjugated anti-CD127 (25-1287-42, eBioscience).
CD19 expression on Raji cells was detected by staining with an APC-conjugated antibody against CD19 (302212, BioLegend), and monocyte CD14 expression was determined by staining with an Alexa Fluor 700-conjugated antibody against CD14 (325614, BioLegend).
After antibody labeling, samples were washed twice in 0.1 mL of PBS containing 2% FBS before detection using an Attune NxT flow cytometer (Thermo Scientific, USA). Data were analyzed using FlowJo V10 (TreeStar, USA).
Cell proliferation assay
The cell proliferation assay was performed using a carboxyfluorescein diacetate succinimidyl ester (CFSE) assay kit (Abcam, UK) following the manufacturer’s instructions. In brief, 2x105 CART-19 cells were labeled with 2.5 mM CFSE and cocultured with Raji cells, which were inactivated by exposure to 10 µg/mL mitomycin C (Selleck, Houston, USA) at a ratio of 2:1 in 24-well plates in 200 µL of serum-free AIM-V medium (Gibco, USA) for 5 days. CFSE was detected by flow cytometry on days 0 and 5 to analyze CAR T cell proliferation.
Degranulation assay
CD107a expression on CD8 T cells was detected by flow cytometry. In brief, 1x106 CAR T cells were cocultured with target cells at a 5:1 ratio in 96-well plates with a total of 200 µl of T cell culture medium AIM-V (Gibco) per well, The Golgi inhibitor Monessen (Invitrogen, Carlsbad, US) and CD107a- AF700 antibody (BD, New Jersey, USA) were added before coincubation. A protease inhibitor cocktail (Invitrogen, Carlsbad, US) was added to the well containing the positive control. After 6 h incubation, the cells were collected and washed twice before analyzed by flow cytometry.
Cytotoxicity assay
Raji cells (1x104) and CART-19 cells were seeded in 200 µL of serum-free RPMI 1640 medium (Gibco) at an effector : target (E:T) ratio of 10:1, 5:1, 2.5:1, or 1.25:1 in 96-well plates for 16 h. Lactate dehydrogenase (LDH) activity in the medium was measured using a cytotoxicity detection kit (Promega, Wisconsin, USA) according to the manufacturer’s protocol, and the absorption at 490 nm was measured using a full wavelength reader Multiskan GO (Thermo Scientific). The percentage of tumor lysis was calculated as follows: % tumor lysis = (experimental value - low control of CART-19 cells - low control of target cells) x 100/(high control of target cells - low control of target cells), where the low control was the assay medium + cells and the high control was the assay medium + 2% Triton X-100 + cells.
Quantitation of cytokine levels
Cytokine levels in culture supernatants were measured using the Th1/Th2 Cytometric Bead Array Kit II (BD Bioscience) according to manufacturer protocols. In brief, supernatants collected from the coculture system or mouse serum was incubated with fluorophore-labeled antibodies against IL-2, IL-4, IL-6, IL-10, IFN-γ, TNF-α and IL-17A for 3 h. After the incubation, the samples were washed with the wash solution and analyzed by flow cytometry.
Quantitative RT-PCR
Total mRNA was extracted from cells using TRIzol (Invitrogen) and converted into cDNA using HiScript® II Q RT SuperMix (Vazyme Biotech, Nanjing, China). Quantitative RT-PCR was performed using an ABI-7500 system (Life Technologies, USA) and primers against IL-6 (forward: 5’-TAACCACCCCTGACCCAACCA-3’; reverse: 5’-GCGCAGAATGAGATGAGTTGTCA-3’) and a fluorescent probe (5’-AAATGCCAGCCTGCTGACGAAGCTGCA-3’). The Ct for samples was normalized to that of the β-actin housekeeping gene as follows: ΔCt (sample) = Ct (IL-6) – Ct (β-actin). Expression relative to that of the control sample was calculated as follows: 2 -ΔΔCt = 2^-(ΔCt [sample] – ΔCt [control]).
RNA extraction and purification
Total RNA was extracted using TRIZOL Reagent (Cat#15596-018, Life technologies, Carlsbad, CA, US) following the manufacturer’s instructions and checked for a RIN number to inspect RNA integrity by an Agilent Bioanalyzer 2100 (Agilent technologies, Santa Clara, CA, US). Qualified total RNA was further purified by RNAClean XP Kit (Cat A63987, Beckman Coulter, Inc. Kraemer Boulevard Brea, CA, USA) and RNase-Free DNase Set (Cat#79254, QIAGEN, GmBH, Germany).
Xenograft model
All experiments were approved by the Institutional Animal Care and Use Committee of East China Normal University. Male NOD/SCID/γc-/- (NSG) mice aged 4 to 6 weeks were obtained from Biocytogen (Beijing, China). Mice were injected with 1x106 Raji cells that stably expressed luciferase (Raji-luc) via the tail vein to establish a xenograft leukemia tumor model. The mice were then randomly divided into four groups and treated with saline (n=3, control), 6x106 untransduced T cells (n=3, negative treatment control), 6x106 regular CART-19 cells (n=3), or 6x106 ssCART-19 cells (n=3) on day 4. Tumor progression was monitored by bioluminescence imaging (BLI) using a Xenogeny-IVIS imaging system (Perkin Elmer, MA, USA) every 3 days beginning on day 1. The mice were sacrificed by vertebral dislocation when moribund or upon development of hind-limb paralysis.
For in vivo imaging of Raji-luc cells, mice were injected intraperitoneally with D-luciferin (YEASEN, Shanghai, China), anesthetized with isoflurane and imaged using the Xenogeny-IVIS imaging system (Perkin Elmer).
Statistical analysis
Statistical analyses were carried out using Prism 8.0 (GraphPad Software Inc., San Diego, CA, USA). Each experiment was repeated with three biological replicates, and data are presented as the mean ± SD. The group means from degranulation assays and cytokine secretion assays were compared using one-way analysis of variance (ANOVA). Differences among treatment groups and control groups in vitro killing assays were analyzed using two-way ANOVA followed by Dunnett’s multiple-comparison test. Differences associated with a p-value < 0.05 were considered significant.