Breeding early maturing, blast resistance water-saving and drought-resistance rice cultivar using marker-assisted selection coupled with rapid generation advance

doi:10.21203/rs.3.rs-1668126/v1

PDF

Research Article

Breeding early maturing, blast resistance water-saving and drought-resistance rice cultivar using marker-assisted selection coupled with rapid generation advance

https://doi.org/10.21203/rs.3.rs-1668126/v1

This work is licensed under a CC BY 4.0 License

You are reading this latest preprint version

The japonica water-saving and drought-resistance rice (Oryza sativa L.) (WDR) cultivar Huhan 9 harbors genes for resistance to rice blast (Magnaporthe oryzae), including Pi-ta and Pi-b. The early maturing japonica rice cultivar Suhuxiangjing and the high-yield WDR cultivars Huhan 3 and Huhan 11 were used as the parents to conduct single cross breeding and composite hybridization breeding. Strict drought resistance screening was conducted in the segregating generations, and the genotypes were determined using the functional markers of Pi-ta and Pi-b genes. By combining the rapid generation advance of the industrialized breeding system and multi-site shuttle identification, a new WDR cultivar Huhan 106 with early maturity, blast resistance, high yield, and high quality was bred, and it was certified by the Agricultural Crop Variety Certification Commission of Shanghai in 2020. Molecular marker-assisted selection coupled with rapid generation advance and multi-site shuttle identification is a rapid and efficient breeding method for the value-added improvement of varieties.

Water-saving and drought-resistance rice (WDR)

Rapid generation advance

Marker-assisted selection

Rice (Oryza sativa L.) is one of the main food crops in many Asian countries. Rice varieties with a short growth period in East China mature before October 1st, which is more than a month earlier than ordinary late japonica varieties, that contributes to the earlier availability of fresh rice for consumption and reserves enough sowing time and growth space for subsequent crops (Yan et al. 2019). Water-saving and drought-resistance rice (WDR) combines both the high yield potential and acceptable grain quality of lowland paddy rice and the water-saving properties and drought resistance of upland rice. Under well-irrigated conditions, WDR should have the same high yields and desirable grain quality as the modern lowland paddy cultivars, while saving more than 50% of the irrigation water in production. It is desirable for rice grown in rainfed fields to be drought resistant. In terms of cultivation, the management of WDR is simple, cost-effective, energy saving, and environmentally friendly. WDR cultivars are popular with farmers because of their characteristics of saving water, drought resistance, and their suitability for simple and labor-saving cultivation. They are widely planted in provinces, including Anhui, Hunan, and Jiangxi (Luo et al. 2019). Rice blast (Magnaporthe oryzae) is one of the most devastating diseases for rice production. The global rice yield is reduced by 10%-30% every year owing to rice blast, and the annual reduction in grain is enough to feed 60 million people (Skamnioti and Gurr 2009). Although the use of pesticides plays a very important role in stabilizing rice yield, the repeated and large-scale use of pesticides has led to serious environmental pollution (Miah et al. 2013). Practices have proven that breeding disease-resistant varieties by pyramiding multiple genes is an economic and effective control strategy. Among the cloned blast resistance genes, both Pi-ta and Pi-b are NBS-LRR disease resistance genes (Wang et al. 1999; Bryan et al. 2000). Based on the difference in DNA sequences of resistant and susceptible alleles, functional markers have been developed and widely used in marker-assisted selection (MAS) of japonica rice (Wang et al. 2004; Liu et al. 2008). With the continuous improvement in living standards and the requirements to prevent and control the sources of agricultural pollution, the market has increasingly sought rice cultivars with improvements, such as quality, blast resistance, and maturity periods. Therefore, breeding new WDR cultivars with early maturity, blast resistance, and high quality is highly significant for improving the maturity arrangement of rice varieties in Shanghai and improving rice production and ecological benefits.

Rapid generation advance (RGA) technology has been used to shorten the generation cycle of crops and promote the progress of research on genomics and breeding of many crops (Ohnishi et al. 2011; Tanaka et al. 2016; Collard et al. 2017). RGA methods have been reported in six major crops, including spring wheat (Triticum aestivum), Triticum durum, barley (Hordeum vulgare), chickpea (Cicer arietinum), pea (Pisum sativum) and rapeseed (Brassica napus), which shorten the growth cycle by the extending the photoperiod (Watson et al. 2018; Nagatoshi and Fujita 2019). RGA technology has also been used in research on genetic improvement of rice, such as the construction of recombinant inbred lines (RILs) and backcross breeding among others (Rana et al. 2019). The breeding of new rice varieties usually requires 4–6 generations of self-crossing advance. Currently, when japonica rice is grown in the middle and lower reaches of the Yangtze River, only one generation can be completed a year. To shorten the breeding period, Chinese breeders primarily use the high temperature natural conditions in the south to advance generations in different places (Fan and Han 2018), which has a large workload and low breeding efficiency. To improve the breeding efficiency of WDR, we developed an industrialized breeding system for WDR (Luo et al. 2017). In this system, environmental factors in the breeding plant were established, which ensures that the generation advance of WDR materials is not restricted by natural conditions. The generation of breeding materials for WDR can be advanced 3–4 times a year through short-day treatment and series methods (Wang et al. 2019).

In this study, in order to rapidly breed a new WDR cultivar with early maturity and blast resistance, the molecular markers of the rice blast resistance genes Pi-ta and Pi-b were used to conduct gene pyramiding in segregating generation materials. In combination with RGA technology and multi-site shuttle identification of traits, a new WDR cultivar Huhan 106 with high quality, high yield, blast resistance, and early maturity was cultivated. Our results suggest that the pyramiding of favorable traits and the value-added improvement of varieties can be quickly and efficiently achieved by the combined use of MAS and RGA.

Plant material

The breeding parents were as follows: japonica WDR cultivars Huhan 3, Huhan 9, Huhan 11, and the early maturing japonica rice cultivar Suhuxiangjing. Control varieties for the evaluation of drought resistance included IR36 and Hanyou 73. Yuanfengzao was the control variety for the evaluation of rice blast resistance. All of these cultivars were provided by the Shanghai Agrobiological Gene Center (SAGC), Shanghai, China.

Genomic DNA extraction and genotyping

Genomic DNA extraction was performed as previously described (Murray and Thompson 1980). The primers used for the genotyping of Pi-ta and Pi-b were synthesized by Sangon Biotech Co., Ltd. (Shanghai, China) (Table 1). The PCR amplification system was 20 μL, which consisted of 2 μL DNA template, 10 μL Taq PCR Master Mix (Tiangen Biotech Co., Ltd., Beijing, China), 1 μL upstream and downstream primers, and 6 μL dd H₂O. The reaction program was as follows: pre-denaturation at 95°C for 5 min, 30 cycles at 95°C for 30 s, 55°C for 30 s, 72°C for 1 min, and finally extension at 72°C for 5 min. PCR products (8 μL for each sample) were detected by electrophoresis on a 2.0% agarose gel.

Table 1 Specific primers of rice blast resistance genes
Resistance genes	Primer name	Sequence（5'-3'）	Product length (bp)	Allele	Reference
Pita	YL155	AGCAGGTTATAAGCTAGGCC	1042bp	Resistance	Wang et al. 2004
	YL87	CTACCAACAAGTTCATCAAA
pita	YLI83	AGCAGGTTATAAGCTAGCTAT	1042bp	Susceptible
	YL87	CTACCAACAAGTTCATCAAA
Pib	Pibdom F	GAACAATGCCCAAACTTGAGA	365bp	Resistance	Liu et al. 2008
	Pibdom R	GGGTCCACATGTCAGTGAGC
pib	Lys145 F	TCGGTGCCTCGGTAGTCAGT	803bp	Susceptible
	Lys145 R	GGGAAGCGGATCCTAGGTCT

RGA technology

The process of RGA method was shown in Fig. 1. The segregating generation population (F_2-6) was directly seeded on a plastic breeding tray, which was 580 mm×380 mm×50 mm with holes at the bottom. The sowing density was 5 g/tray, and the breeding tray was then placed in the culture basin, which was a 630 mm×450 mm×70 mm stainless steel tray, which could retain water. Moist soil was maintained in the breeding tray, but there was no standing water. The seedling tray was covered with black nylon cloth for 3-5 days of darkening treatment. The nylon cloth was uncovered after the seedlings had evenly emerged. When the first fully expanded leaf was shown, the seedlings were sprayed with 600-fold diluted paclobutrazol to cultivate short and strong seedlings. During this period, the excess tillers were cut out manually, with only the main stem retained on each seedling. The temperature and humidity settings in seedling stage were as follows: temperature of 28°C (6:00-19:00), 25°C (19:00-6:00 of the next day), and relative humidity of 80%.

The 25-day-old rice seedlings were grown with a short-day photoperiod (10/14 h of light/dark). The temperature and humidity settings were as follows: temperature of 32°C (7:00-17:00), 28°C (17:00-7:00 of the next day), and relative humidity of 80%. An LED artificial light source was used for the lighting treatment, and each group of LED lamps was composed of white, red, and blue LED lamps with a quantity ratio of 4:1:1. The water layer state of the seedling tray was observed every day. Water was added until the water layer reached a depth of approximately 2.0 cm, and the water was renewed recurrently after the water layer had drained. After the start of short-day treatment, the young panicles were stripped regularly to observe the differentiation process of young panicles. The short-day treatment was terminated when the plants reached the young panicle differentiation stage.

The rice after short-day treatment were screened for water-saving properties and drought resistance, and the individual plants with poor water-saving properties and drought resistance were manually removed from the population. After the screening, the plants were re-irrigated, and the breeding tray was kept moist until the plants had matured. One to two seeds in the upper part of each panicle were then collected, and all the collected seeds were mixed to obtain the next generation. Temperature and humidity for the identification of drought resistance and the growth environment at the later stage were established as follows: temperature of 35°C (6:00-19:00), 28°C (19:00-6:00 of the next day), and relative humidity of 80%.

Evaluation of rice blast resistance

From May to October 2014, leaf and neck blasts were investigated in two blast epidemic areas, Jinggangshan of Jiangxi Province and Jinzhai of Anhui Province, China. Each cultivar was planted in 10 rows with seven plants in each row, repeated three times, and arranged in random blocks. The fertilizer and water management were the same as that in the general fields. Two rows of control varieties were planted around the ridge as protective rows, and one row of control varieties was planted in the operation ditch of the field as an induction cultivar. The blast level was investigated based on the classification standard of grades 0-9 of the International Rice Research Institute (IRRI 2002).

Identification of drought resistance

From May to October 2015, the identification of drought resistance was conducted at the water-saving and drought-resistance identification center of SAGC in Zhuanghang Town, Shanghai, China. Drought and control treatments were established in the experiment. The treatments were repeated three times. Nine rows of plants were planted in each plot with nine plants in each row, and the plant-row spacing was 20 cm × 23 cm. From sowing to stage II of young panicle differentiation, intermittent irrigation was performed in the field to keep the soil wet without retaining a layer of water. Drought stress treatment was conducted at stage II of young panicle differentiation, and the treatment was terminated. Field water management in the early period was restored when all the rolled leaves of drought-sensitive control varieties did not recover for more than 5 days, or the leaf withering rate reached 50% in the morning. The control treatment was established in the adjacent paddy field, and the whole growth period was managed based on conventional cultivation in paddy fields. The yield of plot was measured at the maturity stage, and the drought resistance index was calculated. The identification method for drought resistance was applied as described in the agricultural standard of China (NY/T 2863-2005 Technical specification of identification and evaluation for rice drought resistance).

Determination of rice quality

The rice quality was determined after the harvested and sun-dried rice had been stored at room temperature for 3 months. The indicators included the percentage of brown rice, milled rice, head rice, chalky rice, chalkiness, and grain length (mm), length-width ratio, alkali dissipation value, amylose content (%), and gel consistency (mm). All the indicators were estimated based on the standards of determining the quality of rice (NYT83-2017).

A JSWL rice taste measuring instrument developed by Beijing Dongfu Jiuheng Instrument Technology Co., Ltd. (Beijing, China) and Satake Corporation (Hiroshima, Japan) was used to perform the measurements. The samples of milled rice > 200 g were placed in the sampling tank, and the instrument was adjusted. The setting for japonica rice was utilized to take the measurements. The full score of taste value reported in the instrument was 100. A taste value > 80 indicates good taste; a value of 70-80 indicates slightly good taste; a value of 60-70 indicates average taste; a value of 50-60 indicates slightly bad taste, and a value < 50 indicates bad taste (Zhang et al. 2007).

Identification of the genotypes in parents

The dominant molecular markers YL155/YL87 and Pibdom F/R that corresponded to the blast resistance alleles Pi-ta and Pi-b were genotyped in four parents, respectively. The results showed that Huhan 9 contained Pi-ta and Pi-b; Huhan 3 contained Pi-b, and Suhuxiangjing and Huhan 11 contained no blast resistance genes (Fig. 2).

Breeding process of Huhan 106

Pyramiding of Pi-ta and Pi-b using molecular markers

The four varieties Huhan 9, Huhan 3, Huhan 11, and Suhuxiangjing were used as parents for pyramiding hybridization since the summer of 2009 in Shanghai (Fig. 3). In 2010, these varieties were planted in dry land in Shanghai. Pi-ta and Pi-b were then tested in an individual plant with strong drought resistance using molecular markers. An individual plant with two heterozygous genes was selected, and the seeds were mixed. In the winter of 2010, the F₂ segregating population was screened for drought resistance in Hainan, and Pi-ta and Pi-b were genotyped in individual plants with excellent drought resistance using molecular markers. The dominant molecular marker YL155/YL87 could specifically amplify 1024 bp of the blast resistance allele Pi-ta. YL183/YL87 could specifically amplify 1024 bp of the susceptible allele pi-ta. The dominant molecular marker Pibdom F/R could specifically amplify 365 bp of the blast resistance allele Pi-b, and the dominant molecular marker Lys145 F/R could specifically amplify 803 bp of the susceptible allele pi-b. Among the 480 selected plants, 125 individual plants had the homozygous genotype for Pi-ta; 153 had the homozygous genotype for Pi-b, and 33 had the homozygous genotypes for both Pi-ta and Pi-b.

RGA breeding

From May 2011 to August 2012, the rapid advance of F₃-F₆ generations was conducted in the breeding plant system.

The seeds of individual plants with Pi-ta and Pi-b genes that had been pyramided by MAS were harvested in a mixed manner, and dry direct seeding was performed on 10 seedling trays (Fig. 4a). The soil on the seedling trays was kept moist, and the seedling tray was covered with black nylon cloth for 3 days of treatment in the dark (Fig. 4b). After the seedlings had evenly emerged, the nylon cloth was uncovered (Fig. 4c), and plants were sprayed with 600-fold diluted paclobutrazol to cultivate short and strong seedlings when the first leaf was observed (Fig. 4d).

Seedlings aged 25 days were treated with short-day periods (10/14 h of light/dark) (Fig. 4e). The plants that had undergone the short-day treatment were screened for water-saving properties and drought resistance, and the individual plants that did not effectively save water and lacked drought resistance were removed from the population (Fig. 4f). After rehydration, the moisture of the soil was maintained until the experimental materials were mature, and 1-2 seeds were then collected from the upper part of each spike (Fig. 4g). The collected experimental seeds were mixed to obtain the next generation. This generation advance process was repeated for the F₄ generation seeds until F₇ generation seeds were obtained.

Table 2 Adding generation experiment condition of the WDR materials in four consecutive generations
Generations	Sowing date	Maturity date	Whole growth duration (d)
F₃	2011-5-27	2011-9-13	109
F₄	2011-9-17	2012-1-3	108
F₄	2012-1-9	2012-4-30	111
F₆	2012-5-6	2012-8-21	106

Approximately 5,000 seeds of F₃ were sown on May 27, 2011, and 508 seeds (F₇) were harvested on August 21, 2012, after RGA and drought resistance screening (Table 2).

Yield identification and adaptability screening were carried out from the F₈ generation, and a cultivar Huhan 106 with water-saving properties, drought resistance, high yield, rice blast resistance, and early maturity was finally bred.

When planted as an early maturing japonica rice in Shanghai, the entire growth period of Huhan 106 was 136.5 d, which was 5.4 d earlier than that of control cultivar Songzaoxiang 1. Huhan 106 plants had well-developed root systems and a strong ability to tiller. The plant height reached 99.7 cm with spike lengths of 19.5 cm. Each spike had 150.5 grains with a seed-setting rate of 89.8% and a 1,000-grain weight of 23.3 g. The average yield of regional test in 2018-2019 was 623.3 kg/mu, which is 6.2% higher than that of control cultivar Songzaoxiang 1. The average yield in the test for production in 2019 was 591.5 kg/mu, an increase of 7.4% over the control cultivar Songzaoxiang 1. In 2020, this line was approved as a new cultivar by the Agricultural Crop Variety Certification Commission of Shanghai (No. 2020011).

The results of rice quality test were as follows: the brown rice rate of Huhan 106 was 84.3%; the head rice rate was 61.5%; the grain length was 5.0 mm; the length-width ratio was 2.0; the chalky grain rate was 11%; the chalkiness was 1.9; the transparency was grade 3; the alkali elimination value was grade 6.0; the gel consistency was 76 mm, and the amylose content was 13%. In addition, the taste score measured by the rice taste meter was 86 points, which indicates good flavor and taste.

Resistance performance of Huhan 106

To determine the ability of Huhan 106 to resist rice blast, the plants were infected naturally at the blast epidemic area in Jinggangshan of Jiangxi Province and Jinzhai County of Anhui Province, China. These two areas are the experimental areas for the identification of rice blast resistance of varieties used in national regional tests. Huhan 106 was moderately resistant with a score of 3 for leaf blast, 5 for neck blast incidence, and 3 for neck blast loss at the blast epidemic area in Jinggangshan of Jiangxi Province. The comprehensive blast index was 3.5, which corresponded to a moderate level of resistance. In Jinzhai County of Anhui Province, the susceptibility of Huhan 106 to leaf blast, neck blast incidence, and neck blast loss was level 5, level 5, and level 3. The comprehensive blast index was 4, which indicated a moderate level of resistance. The evaluation of the susceptible control cultivar Yuanfengzao for resistance in the two areas suggested that it was highly susceptible to rice blast (Table 3).

The results of identification of drought resistance showed that the drought resistance coefficient of Huhan 106 was 1.22; the grade of drought resistance was 2, and the drought resistance was evaluated as resistant, whereas the resistance level of the drought sensitive control cultivar IR36 was 5.

Table 3 Evaluation of leaf and neck blast resistances of Huhan106 and susceptible check in blast epidemic fields
Trait	Jiangxi		Anhui
Trait	Huhan 106	Yuanfengzao（CK）	Huhan 106	Yuanfengzao（CK）
Score of leaf blast	3	7	5	9
Incidence of neck blast (%)	12.6	72.6	20.3	94.3
Incidence score of neck blast	5	9	5	9
Loss of neck blast (%)	15.4	55.8	18.5	67.9
Loss score of neck blast	3	9	3	9
Comprehensive index	3.5	8.5	4.0	9
Resistant evaluation	MR	HS	MR	HS
MR: Moderate Resistant; HS: High Susceptible

Table 4 Performance of drought resistance for Huhan 106
Lines	Drought Resistance Index	Score	Resistance evavulation
Huhan 106	1.22	2	R
Hanyou 73（CK）	1.00	2	R
IR36（CK）	0.33	5	S
R: Resistant; S: Susceptible

Breeding method using the pyramiding of high yield, blast resistance, WDR and multi-site shuttle selection

The use of MAS technology for blast resistance breeding has become an important technical strategy for molecular breeding in rice. Compared with traditional resistance breeding, this strategy greatly improves the breeding efficiency since it is not limited by environmental conditions, and accurate selection can be achieved using closely linked target genes or functional markers without phenotypic screening. Genic functional markers refer to the functional changes caused by gene sequence differences, and the corresponding molecular markers are developed to screen the traits. Since there is no linkage exchange, the accuracy of selection is theoretically 100% (Andersen and Lübberstedt 2003). Among the cloned rice blast genes, functional markers have been developed for the Pi-ta and Pi-b genes (Fjellstrom et al. 2004, Wang et al. 2007). Wang et al. (2011) introduced the three blast resistance genes Pi-ta, Pi-b and Stv-b into high-yield varieties using MAS to breed a high-quality new cultivar 74121 with resistance to rice blast and striped leaf blight. Yao et al. (2017) pyramided the Pi-ta, Pi-b and Wx-mq genes in rice using MAS to generate a new high-yield rice cultivar Nanjing 0051, which was strongly resistant to blast and highly edible. The Pi-ta and Pi-b genes are widely distributed in japonica rice planted in Jiangsu Province but less in cultivars in Shanghai. Pyramiding these two blast resistance genes could effectively improve the resistance level of japonica rice to blast (Chen et al. 2016). Rice production is also facing severe challenges of resources and environment. With the increase in global climate change, the frequent occurrence of drought has become an increasingly important factor that limits rice yield. WDR is an important part of green super rice, and cultivating and developing WDR would change the traditional planting mode of rice and enable resource conservation and environmental friendliness; therefore, it is one of the important ways to alleviate the damage caused by water shortages and improve the yield of medium and low yield fields in China. Drought resistance is a complex trait, which involves a multi-gene regulated network and environmental interactions. The improvement of characteristics of yield, rice quality, blast and insect resistance, and nutritional efficiency should be conducted based on the existing WDR and theoretical achievements of breeding studies (Luo 2010). Xia et al. (2019) clarified the theoretical basis of an alternative breeding system for WDR composed of the hybridization of lowland and upland rice, the selection of drought avoidance in mountainous areas (without plow soles) under natural drought, and yield screening under fully irrigated conditions from the perspective of molecular evolution. Our experience in the breeding practice of WDR led us to conclude that although a potential trade-off exists between drought resistance and high yield for rice, bidirectional selection can overcome this trade-off and accumulate recombinant genotypes. It is proposed that lowland paddy rice and upland rice hybridization breeding with suitable selection in different environments is an effective approach to cultivating WDR (Luo et al. 2019). In this study, the rice blast resistance genes Pi-ta and Pi-b were effectively pyramided using MAS; large populations of low generations were planted, shuttle screening was conducted in multiple sites, including Hainan and Shanghai, and together with drought resistance, early maturity traits were simultaneously selected. Based on cross identification of the rice blast nurseries in Anhui and Jiangxi, traits, such as rice blast resistance, ecological adaptability, and high yield, can be selected synchronously. The yield potential could be fully investigated by planting high generation lines in high-yield fields in Shanghai and Anhui. A new conventional WDR cultivar Huhan 106 with wide adaptation, high yield, high quality, and multiple resistance was finally bred.

Breeding method of RGA

Since the breeding cycle is long for rice, even in combination with the propagation of generation advance in southern regions, generation advance can be conducted on japonica rice in the middle and lower reaches of the Yangtze River only twice a year, requiring 8-10 years to successfully breed new rice cultivars (Fang and Han 2019). Some studies in China have accelerated the differentiation of young panicles of rice through short-day induction, and it can be advanced for 1-3 times a year or 4-5 times a year when the growth period of rice was shortened by the combination of regulation of the sowing method, temperature, and fertilizer/water(Guo et al. 1997, Li et al. 2007). However, these studies were only aimed at the RGA of rice without trait selection. In this study, F₃-F₆ populations were treated with short-day conditions in a WDR breeding plant with controllable environmental conditions and supplemented with measures, such as dry direct-seeding, close planting, and water and tillering control. The process of generation advance was significantly accelerated, and four generations were advanced in 15 months. In this study, drought resistance selection was conducted simultaneously in the process of RGA. The individual plants with poor drought resistance were eliminated, and the highly efficient selection of rice plants with water-saving properties and drought resistance was finally achieved. It should be noted that in this study, only drought resistance was selected in the process of RGA without considering the selection of other agronomic traits. The method of ‘single seed descent’ was used, so that the segregated types could be continuously preserved in the population (Chahal and Gosal 2002). In this process, only 1-2 seeds were collected for each plant. To obtain a larger population, the rice plants in this study were grown in the breeding plant with high density without tillering. Direct seeding was performed in the breeding tray using 5 g of seeds, which is equivalent to the density of more than 900 rice plants per square meter. This high-density planting will also accelerate the flowering of plants (Wada and Takeno 2010). Therefore, the combined use of RGA and ‘single seed descent’ technology can effectively accelerate the breeding efficiency of rice with water-saving properties and drought resistance.

In this study, cross breeding was started in 2009, and the name of Huhan 106 was officially approved in 2014, which was a period five years. This process took 2-3 fewer years than traditional rice breeding, realizing the rapid, directional, and efficient cultivation of new cultivars. Our results showed that new WDR cultivars can be quickly and effectively generated using the method of RGA and MAS combined with the multi-site shuttle screening of traits. The future developmental goal of rapid breeding is to advance four to five generations every year. This faster and more effective method of reducing breeding cycles will contribute to rice genome research and breeding.

Ethics approval and consent to participate

This article does not contain any studies with human participants or animals performed by any of the authors.

Consent for publication

Not applicable.

Availability of data and materials

All data generated or analysed during this study are included in this published article.

Competing interests

The authors declare that they have no competing interests.

Funding

This research was supported by Shanghai Municipal Commission of Science and technology (21N11900200; 19391900100).

Author Contributions

Conceptualization: Feiming Wang and Lijun Luo; Methodology: Yi Liu and Anning Zhang; Formal analysis and investigation: Deyan Kong and Junguo Bi; Writing - original draft preparation: Feiming Wang and Yi Liu; Writing - review and editing: Lijun Luo. Supervision and funding acquisition: Guolan Liu and Xinqiao Yu.

Acknowledgments

The authors thank the editors and the reviewers for their useful feedback that improved this paper.

Yan Y, Zhang LX, Hu ZJ, Zhou JH, Cao LM, Wu SJ (2019) Breeding of a new japonica rice variety with early-maturity, high quality and fragrance by molecular marker-assisted selection. Mol Plant Breed 17(22):7408–7413
Luo LJ, Mei HW, Yu X, Xia H, Chen L, Liu HY, Zhang AN, Xu K, Wei HB, Liu GL, Wang FM, Liu Y, Ma XS, Lou QJ, Feng FJ, Zhou LG, Chen SJ, Yan M, Liu ZC, Bi JG, Li TF, Li MS (2019) Water-saving and drought-resistance rice: from the concept to practice and theory. Mol Breed 39(10):1–15
Skamnioti P, Gurr SJ (2009) Against the grain: Safeguarding rice from rice blast disease. Trends Biotechnol 27(3):141–150
Miah G, Rafii MY, Ismail MR, Puteh AB, Rahim HA, Asfaliza R, Latif MA (2013) Blast resistance in rice: A review of conventional breeding to molecular approaches. Mol Biol Rep 40(3):2369–2388
Wang ZX, Yano M, Yamanouchi U, Lwamoto M, Monna L, Hayasaka H, Katayose Y, Sasaki T (1999) The Pib gene for rice blast resistance belongs to the nucleotide binding and leucine-rich repeat class of plant disease resistance genes. Acta Agron Sin 19(1):55–64
Bryan GT, Wu KS, Farrall L, Jia YI, Hershey HP, McAdams SA, Fault KN, Donaldson GK, Renato T, Valent B (2000) A single amino acid difference distinguishes resistant and susceptible alleles of the rice blast resistance gene Pi-ta. Plant Cell 12:2033–2045
Ohnishi T, Yoshino M, Yamakawa H, Kinoshita T (2011) The biotron breeding system: A rapid and reliable procedure for genetic studies and breeding in rice. Plant Cell Physiol 52(7):1249–1257
Tanaka J, Hayashi T, Iwata H (2016) A practical rapid generation-advancement system for rice breeding using simplified biotron breeding system. Breed Sci 2016,66(4), 542–551
Collard BC, Beredo JC, Lenaerts B, Mendoza R, Santelices R, Lopena V, Verdeprado H, Raghavan C, Gregorio GB, Vial L, Demont M, Biswas PS, Iftekharuddaula KM, Rahman MA, Cobb JN, Islam MR (2017) Revisiting rice breeding methods-Evaluating the use of rapid generation advance (RGA) for routine rice breeding. Plant Prod Sci 20(4):337–352
Watson A, Ghosh S, Williams MJ, Cuddy WS, Simmonds J, Rey MD, Hatta MA, Hinchliffe A, Steed A, Reynolds D, Adamski NM, Breakspear A, Korolev A, Rayner T, Dixon LE, Riaz A, Martin W, Ryan M, Edwards D, Batley J, Raman H, Carter J, Rogers C, Domoney C, Moore G, Harwood W, Nicholson P, Dieters MJ, Delacy LH, Zhou J, Uauy C, Boden SA, Park RF, Wulff BB, Hickey LT (2018) Speed breeding is a powerful tool to accelerate crop researchand breeding. Nat Plants 4:23–29
Nagatoshi Y, Fujita Y (2019) Accelerating soybean breeding in a CO2-supplemented growth chamber. Plant Cell Physiol 60(1):77–84
Rana MM, Takamatsu T, Baslam M, Kaneko K, Itoh K, Harada N, Sugiyama T, Ohnishi T, Kinoshita T, Takagi H, Mitsui T (2019) Salt tolerance improvement in rice through efficient SNP marker-assisted selection coupled with speed-breeding. Int J Mol Sci 20(10):2585
Fang YD, Han TF (2019) Research progress in speed breeding of crops. Crops 2:1–7
Luo LJ, Wang FM, Yu XQ, Zhang AN, Liu Y, Liu GL, Bi JG, Yao WY, Tan JS (2017) A factory system for breeding of water-saving and drought-resistance rice. CN106962065A
Wang FM, Luo LJ, Zhang AN, Liu Y, Yu XQ, Liu GL, Bi JG, Zhang FY, Kong DY, Ye SF (2019) A rapid addition and selection method of WDR based on breeding factory system. CN109122145A
Murray MG, Thompson WF (1980) Rapid isolation of high molecular-weight plant DNA. Nucleic Acids Res 8:4321–4325
Zhang QF, Ji JA, Zhang YD, Zhao L, Zhu Z, Wang CL (2007) Correlation Analysis between Tested Value and Comprehensive Taste Evaluation of Japonica Rice. Jiangsu J Agr Sci 23(3):161–165
IRRI (2002) Standard evaluation system for rice (SES). International Rice Research Institute, Los Banos
Andersen JR, Lübberstedt T (2003) Functional markers in plants. Trends in Plant Sci 8(11):554–560
Wang Z, Jia Y, Rutger JN, Xia Y (2007) Rapid survey for presence of a blast resistance gene Pi-ta in rice cultivars using the dominant DNA markers derived from portions of the Pi‐ta gene. Plant Breed 126(1):36–42
Fjellstrom RG, Conaway-Bormans CA, McClung AM, Marchetti MA, Shank AR, Park WD (2004) Development of DNA markers suitable for marker assisted selection of three genes conferring resistance to multiple pathotypes. Crop Sci 44(5):1790–1798
Wang J, Yang J, Chen ZD, Fan FJ, Zhu JY, Yang JH, Zhong WG (2011) Pyramiding Resistance Gene Pi-ta, Pi-b, and Stv-bi by Marker-assisted Selection inrice (Oryza sativa L.). Acta Agron Sin 37(06): 1259–1265
Yao S, Chen T, Zhang YD, Zhu Z, Zhao QY, Zhou LH, Zhao L, Zhao CF, Wang CL (2017) Pyramiding Pi-ta, Pi-b, and Wx-mq genes by Marker-assisted selection in rice (Oryza sativa L.). Acta Agron Sin 43(11): 1622–1631
Chen T, Zhang YD, Zhu Z, Zhao CF, Zhao QY, Zhao L, Zhou LH, Yao S, Wang CL (2016) Distribution of Pi-b and Pi-ta genes in japonica rice of Jiangsu province and their relationship with neck blast resistance. Jiangsu J of Agr Sci 32(1):1–8
Luo LJ (2010) Breeding for water-saving and drought-resistance rice (WDR) in China. J Exp Bot 61(13):3509–3517
Xia H, Luo Z, Xiong J, Ma XS, Lou QJ, Wei HB, Qiu J, Yang H, Liu GL, Fan LJ, Chen L, Luo LJ (2019) Bi-directional selection in upland rice leads to its adaptive differentiation from lowland rice in drought resistance and productivity. Mol Plant 12(2):170–184
Guo EN, Du JY, Zhu JL, Wang JP, Zhong DX, Duanmu YX, Sun YY, Gao SR, Liu ZM, Wu JM, Qian MH, Jiang BZ, Tang BW, Shen XM (1997) Study on rice non greenhouse generation proliferating technique and its application. Acta Agri Shanghai 13(4):28–36
Li CG, Liu HZ, Li CC (2007) Main measures of increasing generation for rice breeding by utilizing modern greenhouse in frigid region. Modernizing Agri 7:7
Chahal G, Gosal S (2002) Principles and procedures of plant breeding: biotechnological and conventional approaches. Alpha Science Int'l Ltd
Wada KC, Takeno K (2010) Stress-induced flowering. Plant Signal Behav 5:944–947

PDF

Reviewers agreed at journal
22 May, 2022
Reviewers invited by journal
22 May, 2022
Editor assigned by journal
20 May, 2022
First submitted to journal
17 May, 2022

You are reading this latest preprint version

Breeding early maturing, blast resistance water-saving and drought-resistance rice cultivar using marker-assisted selection coupled with rapid generation advance

Status:

Version 1

Abstract

Figures

Introduction

Materials And Methods

Results

Discussion

Declarations

References

Status:

Version 1