Animals
In this experimental study, overall 30 healthy adult male rats of the Wistar strain (Rattus norvegicus), 8 weeks old and weighing approximately between 200 to 250 g, were obtained from Pasteur Institute of Iran (Tehran, Iran). The rats studied were exclusively housed in plastic cages with sawdust bedding. All rats were fed a standard diet and urban water. The temperature and humidity used for cages were 20 ± 2 ° C and about 60%, respectively. Lighting period was held at 12h light/12h dark cycle. All the procedures were approved and monitored by the ethics committee of laboratory animals of Islamic Azad University (Tehran, Iran) and the procedures followed the National Institutes of Health guide for the care and use of laboratory animals (NIH Publications No. 8023, revised 1978) (ethical cod: IR.MUK.REC.1398.242). In this study, the animals were randomly assigned to 5 groups (n=6). Groups were as follows: 1) control (CO), 2) deep frying oil (DFO), 3) deep frying oil + exercise (DFO+EXE), 4) deep frying oil + octopamine (DFO+OCT), and 5) deep frying oil + exercise + octopamine (DFO+EXE+OCT).
Chemicals
DFO
Deep frying oil was made by frying 5 kg catfish 3 times in 2.5 L cooking palm oil at 200ºC (measured with a cooking thermometer) for 15 min[18-20]. After each frying the oil was left to cool for 5 hours at room temperature[21]. The 3-times heated DFO preparation will subsequently be referred to as DFO. DFO was gavage 5 days per week (10 mL/kg) for 4 weeks.
Octopamine
OCT (Sigma, UK) was dissolved in distilled water and then diluted with Krebs-bicarbonate solution. OCT (100 µL in each injection) was injected intraperitoneally 5 days per weeks (10 mL/kg) for 4 weeks.
Aerobic exercise protocol
Exercised rats were introduced to treadmill running for a habituation period, during which each animal exercised on a motorized rodent treadmill at 9 m/min for 20 min per day (including 10 min at a prescribed speed, a 5-min warm-up, and 5-min cool-down). After the habituation period, rats were subjected to run at moderate exercise intensity for 5 days per week over 4 weeks (total duration of the exercise protocol and OCT supplementation). On the first day of exercise, the training began with the rats exercising at 11 m/min for 10 min per day. The speed gradually accelerated from 11 to 20 m/min over the duration of the experiment. The exercise time was also increased by 2 min per day over the same period until it reached 26 min/day at the end of the second week.
Animal tissue sampling
48 hours after the last intervention, all rats were sacrificed and heart tissue was removed immediately and washed in saline normal 0.9%. The tissues were divided to two parts for freezing and fixing. Body weight and heart weight also measure at the end of protocol (table 1).
Table 1. body weight and heart weight in different groups of study (mean ± SD).
Heart weight (g)
|
Body weight (g)
|
Groups
|
1.05 ± 0.03
|
256 ± 7
|
Co
|
1.03 ± 0.05
|
265 ± 4
|
DFO
|
1.11 ± 0.07
|
249 ± 8
|
DFO+EXE
|
0.99 ± 0.03
|
261 ± 3
|
DFO+OCT
|
1.08 ± 0.07
|
260 ± 5
|
DFO+EXE+OCT
|
CO: control, DFO: deep frying oil, DFO+EXE: deep frying oil + exercise, DFO+OCT: deep frying oil + octopamine, DFO+EXE+OCT: deep frying oil + exercise + octopamine.
Terminal transferase dUTP nick end labeling (TUNEL) assay
The apoptotic effects of aerobic exercise and octopamine on heart tissue samples in DFO treated rats were determined using the transferase-mediated deoxyuridine triphosphate (dUTP)-digoxigenin nick end labeling assay. The control and experimental groups were fixed with 4 % (w/v) paraformaldehyde and processed using a commercial kit (In Situ Cell Death Detection Kit; Roche, Germany) in accordance with the manufacturer’s instructions. Cells were stained with Hoechst dye and imaged in a fluorescent microscope. The data were expressed as a percentage of the area of terminal deoxynucleotidyl transferase deoxyuridine triphosphate nick end labeling (TUNEL)-positive cells in ten random fields. The number of TUNEL positive cells was measured carefully in 3 sections of the heart tissue per animal. The percentage of positively stained cells against total nuclei in the area was analyzed with Image J software v1.8 (NIH, USA).
Masson's trichrome staining
Masson's trichrome stain (Histogenotech. Co., Iran) were performed according to kit directions except as follows: Aniline Blue-Solution I-90 min incubation. The prolonged incubation is a standard procedure for trichrome stains of muscle. Briefly, heart tissue slides were placed in staining jar and deparaffinized by submerging into three series of absolute xylene for 4 min. After that, the slides were washed with running tap water for 2 min. Then, slides were treated with the phosphomolybdic acid solution for another 10 min as a mordant and immediately slides were submerged into methyl blue (Merck, Germany). Next, slides were washed in running water for 2 min and lastly treated with 1% acetic acid solution for 1 min.
RNA and protein extraction
RNA and protein were extracted from the heart tissue using TRizol reagent (Invitrogen, USA) according to the manufacturer’s instruction. The quality of the extracted RNA and protein were determined according to the 260/280 absorbance ratio, measured by NanoDrop spectrometer (Thermo Scientific, USA).
cDNA synthesis and quantitative RT-PCR analysis (qRT-PCR)
cDNA synthesis for Caspase 3 and pro-Caspase 3 was carried out using a universal cDNA synthesis kit (Exiqon, Denmark) according to manufacturer's instructions. Specific primers for Caspase and GAPDH (as housekeeping gene) genes were designed using primer premier 5 software (Premier Bio-Soft International, Palo Alto, CA, USA) and summarized in table 2. Real-time quantitative PCR reactions were carried out in triplicate by using standard protocols with a ABI step one system (ABI, USA). Briefly, in a total volume of 10 μl, 20 ng/μl of cDNAs were added to a master mix comprising 10 pmol/μl of each primer (Caspase 3) and 5 mL of SYBR premix ExTaq II (Thermo Scientific, USA). The program for the run was set as follows: 95 °C for 15 min followed by 40 cycles of 95 °C for 15 s, 60 °C for 30 s, and 72 °C for 30 s. The PCR reaction was followed by a melting curve program (60–95 °C with a temperature transition rate of 1 °C s−1 and a continuous fluorescence reading). GAPDH was quantified as the reference to normalize differences in total RNA levels. The calculation was performed as follows: (see Equation 1 in the Supplementary Files)
Table 2. Primer sequences for real time PCR assessment
Product length (bp)
|
TM()
|
Primer sequences
|
Gene name
|
121
|
81.1
|
F: 5′- CAT ACT CAG CAC CAG CAT CAC C -3′
R: 5′- CATACTCAGCACCAGCATCACC -3′
|
Gapdh
|
82
|
80.5
|
F:5′- GCACAAAGTGACTGGATGAAC-3′
R:5′- TGTATTCTTACTCTACCGCAC-3′
|
Caspase 3
|
Western blotting analysis
Heart tissue were lysed in lysis buffer (RIPA, Beyotime Institute of Biotechnology) supplemented with protease inhibitors (PMSF, Aladdin). The equal amounts of protein were separated by SDS-PAGE with 5%–12% Tris-Glycine gel (Invitrogen) and subjected to standard western blotting analysis. Western blotting was performed using Caspase 3 and pro-Caspase 3 antibody (1:1000 dilution; Abcam), which was then reacted with the corresponding secondary HRP-conjugated antibodies (1:2000 dilution; Abcam, USA). Finally, blots were developed using the ECL western blotting detection system (Amersham Life Sciences Inc., Arlington Heights, IL). The results were subjected to densitometry analysis using the ImageJ software to assist with blind analysis of image data. To ensure equal amounts of protein were loaded; the GAPDH protein was employed as an internal control.
Statistical analysis
The statistical analysis of the obtained data was performed using the Graph Pad Prism statistical software version 5.01 (GraphPad, San Diego, CA, USA). The normality of the data was evaluated using the Kolmogorov–Smirnov test, two-way ANOVA and Tukey post-Hoc test was used to analyze the data from different groups. Data are expressed as the mean ± SD. The level of significance was set at P<0.05.