The study was conducted in the municipality of Água Clara, Mato Grosso do Sul State, Brazil (20° 46'24′′S 52° 32'24′′W). Nineteen animals (9 Brangus and 10 Nellore cattle) in the growth phase aged eight to 10 months and with a mean weight of 219.5 kg were studied. These animals were naturally infested and kept together at a density of 0.6 animals per hectare. Acaricides were not used, and prophylactic control of tick-borne diseases (TBDs) was not performed.
Data collection was performed from June 2016 to June 2017, with intervals of 18 days between tick counts according to the method of Wharton and Utech [12]. Ticks with lengths greater than 4.5-8 mm on both sides of each animal were counted. Tick taxonomic classification was performed following the system of Pereira et al. [13]. Additionally, every 36 days, the animals were weighed on a digital scale (Coimma®, Dracena - SP) to assess animal welfare [14], and blood was harvested from the caudal vein using Vacutainer® tubes. In total, 228 samples were collected; these samples were kept at 4°C and transported to the laboratory for serum and gDNA extraction.
Genomic DNA (gDNA) was extracted from whole blood as described by Rodrigues et al. [15] using the phenol/chloroform method. The quantity and purity of each sample were estimated by spectrophotometry with a NanoDrop™ (Thermo Fisher Scientific, Waltham, Massachusetts, USA) according to the absorbance readings at 260 nm and the 260/280 nm absorbance ratios, respectively. Then, the 228 samples corresponding to each animal and collection time point were stored at -80°C until further use.
These gDNA samples were analyzed by PCR in duplicate following the methodology of Guerrero et al. [16] using the primers KB-18 (5’-GAT-GTA-CAA-CCT-CAC-CAG-AGT-ACC-3’ forward) and KB-19 (5’-CAA-CAA-AAT-AGA-ACC-AAG-GTC-CTA-C-3’ reverse), which produce a PCR product of 262 bp. Two negative controls (a blood sample extracted from a bovine healthy donor and water) and one positive control (a sample obtained from a bovine blood smear positive for B. bigemina) were tested.
The final product was visualized on a 1.5% agarose gel stained with ethidium bromide (EtBr). Twelve samples yielding the expected PCR product size for B. bigemina were purified using a PureLink quick gel extraction kit (Invitrogen, Carlsbad, CA, USA). These DNA samples were sequenced at the Human Genome and Stem-Cell Research Center (Universidade de São Paulo – USP, Brazil) in an automatic sequencer (ABI 3730 DNA Analyzer, Applied Biosystems, USA) with a 48-capillary DNA analysis system. The sequenced PCR products were analyzed with MEGA X software [17], and the consensus sequences of the analyzed samples were deposited in GenBank under accession number MZ542450.1.
gDNA samples were diluted to a concentration of 100 ng/µl and subjected to qPCR analysis to quantify the circulating copies of the cbisg gene. Absolute quantification was performed using primers (PrimeTime® Std qPCR Assay-IDT-Integrated DNA Technologies®) based on the B. bigemina LK054939.1 sequence in GenBank and designed using the PrimerQuest Tool (IDT Technologies, Coralville, Iowa, USA), which generated an 88-bp product of the cbisg gene (forward primer 5’CGAAGTGCCCAACCATATTA-3’, probe 5’-/56-FAmQCGAGTGTGT/Zen/TATCAGAGTATTAACTGAGGT/3IABkFQ/-3’, and reverse primer 5’TGTTCCAGGAGATGTTGATTCTT-3’).
Primer-dimer formation was tested with the OligoAnalyzer tool (https://www.idtdna.com/pages/tools/oligoanalyzer).
Specificity in silico was tested using the NCBI BLAST platform (https://blast.ncbi.nlm.nih.gov/Blast.cgi?PAGE_TYPE=BlastSearch). The organisms searched were limited to “bovine”, “human” and “babesia”.
The efficiency and reproducibility (Additional Files 1, 2 and 3) of the reaction were calculated as stated by Okino et al. [18]. Serial dilutions (1:10) from 101 to 1010 were used to construct a standard curve with different concentrations of synthetic DNA gBlocks® Gene Fragments (IDT, Coralville, IA, USA) containing the sequence of B. bigemina (5’- TGACCTTTTATTATGTTCCAGGAGATGTTGATTCTTTCGAGTGTGTTATCAGAGTATTAACTGAGGTTAATATGGGTTGGGCACTTCGTTATTTCCATGCTCAATGTGTTTCTTTTTGC TTTTTCTTTATGATGTTACATATGTTAAAAGGTTTATG-3 ’ - also constructed based on the sequence under accession number LK054939.1). Positive controls and duplicate negative template and negative control samples were added to each qPCR run.
The reaction volume was 10 µL per well and consisted of 5 µL of Taqman™ Universal PCR Master Mix (Thermo Fisher Scientific), 0.5 µL of each primer (10 µM), 3 µL of Milli-Q H2O and 1 µL of 100 ng/µL gDNA. The reactions were run in duplicate. Ultrapure water was used instead of gDNA as a negative control.
A five-point standard curve (concentrations of 105 to 1010 gBlocks®) was used in triplicate as an internal control in each 98-well plate. The samples were analyzed using a StepOnePlus™ Real-Time PCR System using a hydrolase probe activation cycle of 95°C for 10 min followed by 45 cycles of denaturation at 95°C for 45 s and annealing/extension at 60°C for 1 min.
The reaction signal was recorded during the extension step, and the data were analyzed using StepOne v2.3. The Minimum Information for Publication of Quantitative Real-Time PCR Experiments (MIQE) guidelines were followed [19].
Using the qPCR results, the number of target DNA molecules in each reaction (copy number – CN) was calculated according to the method of Ke et al. [20], as follows: CN (L) = [(6.022 × 1023 (copies/mol) × concentration (g/mol))/molecular mass (g/L)], where 6.022 × 1023 is Avogadro's number and the molecular mass is the average molecular weight of double-stranded DNA (330 × 2) multiplied by the size of the cloned fragment.
For antigen detection of anti-B. bigemina immunoglobulin G (IgG), the indirect ELISA (iELISA) technique was used following a protocol based on that of Machado et al. [21].
Total antigen from B. bigemina (produced by the Immunoparasitology Laboratory of the Faculty of Agricultural and Veterinary Sciences [FCAV]/São Paulo State University [UNESP] Jaboticabal) was diluted to an optimal concentration of 10 µg/mL in 0.5 M carbonate/bicarbonate buffer (pH 9.6). After 12 h of incubation at 4°C, blocking was performed with PBS Tween 20 (pH 7.2) and 6% powdered skim milk (Molico®, Nestlé, Brazil). The ninety-six-well plates (Maxisorp®; Nunc, Thermo Scientific, Brazil) were incubated for 90 min at 37°C within a moist chamber.
After three washes with PBS Tween 20 buffer, the positive, negative, and reference sera were added (all diluted 1:400 in PBS Tween + 5% rabbit normal serum). The plates were then incubated at 37°C for 90 min in a moist chamber. After three washes with PBS Tween 20, alkaline phosphatase-conjugated bovine anti-IgG (Sigma®, St. Louis, USA) diluted 1:30000 in PBS Tween + normal 5% rabbit serum was added, and the plates were washed again.
Then, the alkaline phosphatase substrate p-nitrophenyl phosphate (Sigma®, St. Louis, MO, USA) was diluted in 1 mg/mL diethanolamine buffer (pH 9.8). The plates were sealed in aluminum foil and incubated for 30 min at room temperature. The plates were then read at a wavelength of 405 nm on a micro-ELISA reader (B.T.-100; Embrabio, São Paulo, Brazil).
The R Project for Statistical Computing (R version 3.6.3) [22] and RStudio (8.15 build 180091) [23] were used for statistical analysis.
The Kolmogorov–Smirnov test was performed to check data normality, and then the Mann–Whitney U test was used to compare the weight, number of ticks and B. bigemina cbisg gene CN between the breeds because the data did not present a normal distribution.
The CNs and numbers of ticks were log10(n + 1)-transformed and then analyzed by Spearman’s rho statistic to estimate a rank-based measure of association among the weight, log10(CN) and log10(ticks).