Primary Cardiomyocyte Cultures
Postnatal Wistar rats younger than 12 h were chosen and disinfected using 75% ethanol. The hearts were separated and soaked in 1% PBS to remove the blood. Then, the ventricles were selected and cut into 1 mm3 blocks. The tissue blocks were digested with 0.25% trypsin-EDTA (Gibco, USA) at 37 °C for 8 min, and the upper layer suspension was discarded. Then, the remaining tissues were continued to be digested with 0.25% trypsin-EDTA at 37 °C for 8 min, and the upper layer suspension was collected. Then, the action of trypsin was terminated by the addition of the same amount of culture medium (10% fetal bovine serum, 1% L-glutamine, 1% penicillin-streptomycin solution and 88% DMEM). The remaining tissues were continued to be digested 3-5 times using the aforementioned steps until all the tissues were digested. The collected suspension was centrifuged at 1,000 rpm for 10 min. The cells were plated at a cell density of 5 × 105 cells/mL on the 0.1 mg/mL poly-D-lysine-coated 15-mm confocal dishes. Afterwards, the medium was changed every two days. The experimental results confirmed that the isolated cells expressed cadriac-α-acitn, and successfully established the model of cultured cardiomyocytes in vitro.
Cell culture
HEK293T cells for the luciferase reporter assay were purchased from the Institute of Biochemistry and Cell Biology (Shanghai). All cells were cultured in DMEM Medium (Gibco, USA) supplementing with 10% fetal bovine serum (FBS) (Invitrogen), and 1% penicillin/streptomycin at 37°C with 5% CO2.
Cell transfection
PcDNA3.1-SUMO1P3 (SUMO1P3) (5’-CAAUCAACUCUGAGAUCATT-3’), SUMO1P3 (si-SUMO1P3) siRNA, miR-93-5p mimic (Hsa-miR-93-5p:5'-UAGCAG-CACGUAAAUAUUGGCG-3'), miR-93-5p agomir, si-Bin1 (5'-UAGCAGCACAUAAUGGUUUGUG-3') and their corresponding controls (GenePharma, Shanghai, China) were synthesized by GenePharma (Shanghai China). Oligonucleotides were transfected into the cells by Lipofectamine 2000 (Invitrogen, Carlsbad, CA, USA).
In vivo studies
All animal studies were approved by First Affiliated Hospital of Xi’an Jiaotong University Animal Protection and Committee. DOX at a dose of 8 mg/kg was injected intraperitoneally into the rats at 3 week intervals (cumulative dose of 24 mg/kg). Rats in the control group (sham operation group, n = 10) were injected intraperitoneally with saline. The parameters of echocardiography were analyzed by VEVO 770 (VisualSonics Inc, Toronto, Canada). LVFS (left ventricular fractional shortening) and LVEF (Left ventricular ejection fraction) were analyzed by linear sensor (Minuo, Shenzhen, China).
Adenovirus gene delivery
Recombinant adenovirus containing mouse SUMO1P3 shRNA (Ad- SUMO1P3-shRNA), 7 days before DOX induction, adenovirus was intratracheally dripped into rats. Control adenovirus (Ad-GFP) was injected into the control group. MiR-93-5p mimic and its NC were purchased from GenePharma (Shanghai, China). 50 μg miR-93-5p mimic or its negative control was dissolved in 50 μl of sterile double distilled water, and 50 μl of glucose solution was added. Then, the tail vein of rats was injected with 200 μ l working solution.
Dual luciferase reporter gene assay
The wild-type (WT) 3'-UTR of SUMO1P3 cDNA was synthesized by PCR and cloned into pMIR-REPORT luciferase to generate WT- SUMO1P3 3'-UTR. Based on the mutants of SUMO1P3 3'- UTR, the resulting vectors were named as MUT-SUMO1P3 3'-UTR. These vectors (pMIR-REPORT plasmid, WT-SUMO1P3 3'-UTR or MUT-SUMO1P3 3'-UTR) and miR-93-5p mimic or NC was transiently transfected into HEK293 cells by Lipofectamine 2000 reagent (Invitrogen, Carlsbad, CA, USA). After 48 h, luciferase activity was analyzed by a dual luciferase reporter gene assay system (Promega, Madison, WI, USA).
RNA extraction and quantitative real-time PCR
Total RNA in tissues and cells was extracted using TRIzol reagent (Biosntech, Beijing, China). The quality of RNA was analyzed using NanoDrop 1000 (Thermo Fisher Scientific, Inc., Waltham, MA, USA). SYBR-Green (Takara Biotechnology, Co., Lt. (Dalian, China) was used in by qRT-PCR. Amplification was performed by ABI 7,500 real-time PCR system. A qScript microRNA cDNA synthesis kit (Quantabio, Beverly, CA, USA) was used for cDNA synthesis. The expression levels of SUMO1P3 and miR-93-5p were calculated using the 2-△△CT method. The expression levels of miRNA were standardized by U6. The expression levels of lncRNA were standardized by GAPDH. The primers used for qRT-PCR analysis were listed in Table 1 (n=3).
Table 1. Primers used in this study.
Name
|
Sequence (5′-3′)
|
SUMO1P3
|
forward: GTAGCCTTCTGAAACGGCAATTG
|
|
reverse: AGTGCAAGTGTGGGAGATTCATC
|
Bin1
|
forward: ACCCATCGAGCACCTAGAGA
|
|
reverse: CTGAGGATTGGCTATCGTGCC
|
miR-93-5p
|
forward: GCAGTGGCCTTAGCGGACAC
|
|
reverse: CAGATTCTTAGAACGAGGAC
|
U6
|
forward: AGAGAAGGTTAGCATGGCCCCTG
|
|
reverse: AGTGCAGGGTCCGAGGTATT
|
GAPDH
|
forward: CCAAGGTCATCCATGACAAC
|
|
reverse: GCTTCACCACCTTCTTGATG
|
Western blot
The cells were harvested and washed with 1 × PBS, and then we used 2 × SDS loading buffer to lyse cells. The lysates were boiled at 95℃ for 10 min. The solution was subject to centrifuge at 12,000 rpm for 1 min. About 60 ug of total protein (10 -15 ul) was loaded onto SDS-PAGE gel and resolved at 120 V for 0.5–1 h. After that, the proteins were transferred to PVDF membrane at 300 mA for 2–3 h. The membrane was blocked with 5% non-fat milk in 1 × TBST for 1 h at room temperature, and then the membrane was incubated with proper primary antibodies at 4℃, overnight. The following day, the membrane was washed with 1 × TBST for 3 times, 10 min each time. The membrane was incubated with secondary antibody at room temperature for 1 h. Finally, the membrane was incubated with ECL and then exposed using Bio-Rad ChemiDoc Touch Imaging System. The following antibodies were used in this study: anti-Bin1 (1: 1000, Youliante, Shanghai, China) and anti-GAPDH antibodies (1: 1000, Youliante, Shanghai, China) overnight. An anti-rabbit secondary antibody (1: 1000, Youliante, Shanghai, China). Results were visualized with using the Supersignal West Dura Substrate (Pierce). After that, the relative protein expression was expressed as the ratio of the gray value of the target band / GAPDH band.
Cell Counting Kit-8 Analysis
The Cell Counting Kit-8 (CCK-8; Dojindo Laboratories, Japan) was used to assess the rate of cell proliferation. In brief, primary cardiomyocytes were plated in 96-well plates at approximately 2000 cells per well with 200 μL of culture medium and were treated with DOX at different concentrations when needed. After 24 hours, 10 μl of CCK8 solution was applied to each well, and the plates were incubated for 1 h at 37 ˚C. Finally, the absorbance values at 450 nm were determined using a microplate reader (Multiskan, Thermo, USA) with a reference wavelength of 650 nm. All of the experiments were conducted at least in triplicate.
Annexin V-FITC/PI double-labeled flow cytometry
Cell apoptosis was analyzed by flow cytometry using Annexin V-FITC apoptosis detection kit (BD Biosciences; San Jose, CA, USA) according to the manufacturer’s protocols. Primary cardiomyocytes following transfection were collected, washed with cold PBS and stained with binding buffer containing Annexin V-FITC and propidine iodide (PI) at 4°C under darkness for 15 min. Finally, cells were recorded using flow cytometry (Beckman Coulter, Fullerton, CA, USA).
TUNEL analysis
The TUNEL method was used to analyze the apoptotic index of myocardial cells. The nuclei of positive apoptotic cells were brown-yellow granules. Five 400 high-power fields were randomly observed. The apoptotic index (AI), AI (%) = (number of apoptotic positive nuclei / total counted nuclei) × 100%, was calculated.
Statistical methods
Data are expressed as mean ± SEM. Statistical analysis of the results was performed with GraphPad Prism version 5.0 (GraphPadSoftware Inc., San Diego, CA, USA). Student's t-test was used for two group comparison. One-way ANOVA followed by Dunnet t-test was used for multiple group comparison. P < 0.05 was considered statistically significant.