Preparation of plant extract
Plant samples (wild type) was collected from Southern part of Nigeria, and was authenticated by Prof. J. D. Olowokudejo, at the Dept. of Botany University of Lagos, Nigeria, with the Voucher Number 7491. The fresh leaves of B. coccineus were air dried and the powdered sample was extracted by maceration in ethanol. The filtrate was collected and evaporated to dryness using the evaporator at reduced pressure, to get the ethanol extract. Stock concentration of 20mg/mL was prepared by dissolving 200mg of ethanol leaf extract in 1ml of DMSO and 9mL of PBS. Stock solution was stored at -20 °C.
Materials
All chemicals used for this study were of analytical grade. All the primary and horseradish peroxidase-conjugated secondary antibodies were obtained from Cell Signalling Technology (Danvers, MA). Annexin V Apoptosis Detection Kit with PI was purchased from Bio-legend (San Diego, CA). The two human epithelial, adherent ovarian cancer cell lines OVCAR3 and SW626 were obtained from ATCC (Manassas, VA).
Cultures
OVCAR3 cells were grown in RPMI media supplemented with 50 mL of Fetal Bovine Serum (FBS), 5 mL of HEPES Buffer, 5 mL of Non-essential amino acid solution, 5 mL of penicillin/streptomycin solution and 0.5 mL of vitamin Solution. SW626 is a grade 111 adenocarcinoma. SW626 cells were grown in L-15 media and supplemented with 50 mL of Fetal Bovine Serum (FBS) and 5 mL of Penicillin/Streptomycin.
MTT assay
3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT) assay was carried out to determine cell viability of OVCAR3 and SW626 cell lines after treatment with B. coccineus ethanol leaf extract. OVCAR3 and SW626 growing cells were trypsinized with 0.25% Trypsin-EDTA (Fisher Scientific, Pittsburgh PA). 10,000 cells/well were seeded in 96 well plates in triplicates for the two cell lines for 48 h and 72 h time points and incubated for 24 h at 37℃. The cells were treated with different concentrations of B. coccineus ethanol leaf extract ranging from 0.020 mg/ml - 5 mg/ml, DMSO was added to control and media to blank, the plates were incubated for 48 h and 72 h time points. 20µL of 5 mg/ml MTT solution was then added to each well and incubated for 2 h, 100µL of DMSO was added to dissolve the formazan crystals, and the optical density was read at 570 nm using a micro-plate reader (Spectramax M5, Molecular devices, Sunnyvale, CA) [12].
Live/Dead cell staining
Live/Dead cell staining was carried out as per manufacturer's protocol (NucGreen and NucBlue molecular probes by life technology), by seeding 100,000 cells/well for 24 h, treating with plant extract for 48 h and adding Nuc blue for live cells and Nuc green for dead cells. Images were taken using immunofluorescence microscope at x4.
Annexin V/PI apoptosis detection
FITC annexin V apoptosis detection kit with PI (Biolegend, San Diego, CA) was used to investigate if plant extract could induce cell apoptosis in OVCAR3 and SW626 ovarian cancer cell lines. OVCAR3 and SW626 cells were seeded and treated with plant extract for 48 h, after which the cells were trypsinized with 0.25% trypsin. The hemocytometer (Countess II FL, Life Technology) was used to count the cells and 0.5 × 107 cells/ml were added to 5 μL of FITC Annexin V and 10 μL of Propidium Iodide solution. The mixture was vortexed gently and kept in the dark 30min at room temperature then FACS buffer (400 μL) was added to each sample tube. The flow cytometer with guava easy Cyte HT (EMD Millipore, Brillarica) was used to analyze 50,000 cells [11].
Cell Migration Assay
To investigate the effect of plant extract on OVCAR3 and SW626 ovarian cancer cell line migration, 40,000 cells/well were seeded, in 24well plate and place in the incubator for 24h. Cells were treated with extract and a monolayer of the cells was scratched with a 10 μl plastic pipette tip to create a uniform wound. The scratch width was observed after 24 h, 48 h and 72 h of incubation under a phase-contrast microscope ((EVOS XL Core), at ×10 magnification and photographs were taken [13].
Clonogenic assay
Clonogenic or colony formation assay is based on the cells ability to form a colony from one cell. The effect of the plant extract on OVCAR3 and SW626 colony formation was investigated to determine. 1600 cells/well were seeded in 24 well plate and place in the incubator for 24h. Cells were treated with extract and incubated at 37 °C for10 days. Colonies were fixed with methanol for 20 min, stained with 0.1% crystal violet, and visualize using a phase-contrast light microscopy at ×4, formation of 50 cells and above will be regarded as a colony [13].
RNA insolation
RNA was isolated from OVCAR3 and SW626 cells treated with plant extract to determine its effect on apoptotic and cell cycle gene expression. The two cells were treated for 24 h and 48 h after which the cells were lysed with lysis buffer. The binding, washing and elution of cells were done as per protocol using PureLink RNA Mini Kit. RNA was quantified using Nanodrop 2000. The primers sequences of all the genes used in this study were synthesized at the National Center for Biotechnology Information (NCBI) gene bank database. The following are the sense and antisense primers sequences used in this study; MCL-1: For 5’-AAGAGGCTGGGATGGGTT TG-3’ and Rev 5’-CAGCAGCACATTCCTGATGC-3’; BCL-2: Rev 5’-GATAACGGAGGCTGGGATGC-3’and Rev 5’- TCACTTGTGGCCCAGATAGG-3’; BID: For 5’-AGCACAGTGCGGATTCTGTC- 3’and Rev 5’-ACCGTTGTTGACCTCACAGT-3’; BAD: For 5’-CGAAGGGATGGGGGAGGA- 3’ and Rev 5’ –GGCGAGGAAGTCCCTTCTTA-3’; BAX: 5’- AAACTGGT GCTCAAGGCCC-3’and 5’-CTTCAGTGACTCGGC CAGG-3’; BAK:5’- TTTACCGCCATCAGCAACCT-3’ and 5’-ATAGGCA TTCTCTGCCGTGG-3’; PARP:5’-GC TTCAGCCTCCTTGCTACA-3’and 5’-TTCGCCACTTC ATCCACTCC-3’; Cyclin D1: For 5’-TGCATCTACACCGACAACTC-3’ and Rev 5’- TGGAGAGGAAGTGTTCAATG-3’; CDK2: For 5’-CGAGCTCCTGAAATCCTCCTG-3 and Rev 5’- GGCGAGTCACCATCTCAGCAA-3’; P21: For 5’- TGCCGAAGTCAGTTCCTTGT-3’ and Rev 5’- GTTCTGACATGGCGCCTCC-3’; P19: For 5’- TAGTCTTACGACCCTGGTGC-3’ and Rev 5’- GTGCATATCTGGCTCGGGTA-3’; TNF alpha: For 5’- ATGAGCACTGAAAGCATGATCC and Rev 5’- GAGGGCTGATTAGAGAGAGGTC-3’; IL10: For 5’- TCAAGGCGCATGTGAACT-3’ and Rev 5’- GATGTCAAACTCACTCATGGCT-3’; P53: For 5’- TTTTCCCCTCCCATGTGCTC-3’ and Rev 5’- TGGACGGTGGCTCTAGACTT. The control was 18S primer (5’-GGCCCTGTAATTGGAATGAGTC-3’ and 5’- CCAAGATCCAACTACGAGCTT-3’). SYBR® Green PCR master mix reagents (Biorad, USA) were used for RT-PCR and CFX-manager software (CFX96 Real-Time System; Bio-Rad). All experiments were repeated three times.
Western blot analysis
Western blotting was employed to analyze pro- and anti-apoptotic protein levels. Seeded OVCAR3 and SW626 cells were treated for 24 h, 48 h and 72 h time points, harvested and lysed with RIPA buffer with 1X protease inhibitor (Thermo Scientific, Rockford, IL). BCA (bicinchoninic acid) protein assay kit (Thermo Scientific, Rockford, IL) was used to determine the cell lysates. Protein concentrations, 30 μg of cell lysates was denatured by heating in Laemmli buffer and resolved by 4–12% polyacrylamide gels (Life Technologies, Carlsbad, CA). The cell lysates containing protein were transferred to PVDF membranes, and blocked in 5% non-fat dry milk (Biorad, USA) with TBS-T (Fisher Scientific, Pittsburgh, PA) containing 0.1% Tween 20 for 1 h at 25 °. The membrane was then probed at 4 °C overnight with primary antibodies (in 5% non-fat milk with Tris-Buffered Saline-Tween 20) against pro-apoptotic (BAD, BID), anti-apoptotic (BCL-Xl, MCL-1) and reprobed with glyceraldehyde 3-phosphate dehydrogenase (GAPDH; Cell signaling, USA) at 1:1000 dilution (Cell Signaling Technology MA, USA). After washing, the membrane was incubated with horseradish peroxidase (HRP)-conjugated secondary antibodies for 1 h at 25 ° and 1:2000 dilution. The membrane was washed three times, and chemiluminescent reagent (Thermo fisher Scientific, Rockford, IL) was added to the membrane to detect and visualize the proteins using Image Quant LAS4000 (GE Healthcare- Biosciences, Pittsburgh, PA). Image-J software (NIH) was used to quantify the intensity of the bands [3].
Statistical analysis
Statistical analysis was done by using one-way analysis of variance (ANOVA) and the unpaired t-tests. Results are expressed as standard errors of means (±SEM). P values less than 0.05 were statistically significant.