Clinical specimens and follow-up
From December 2017 to February 2021, 59 patients with glioma underwent surgery at the Department of Neurosurgery, Tongji Hospital, Tongji University. Pathological examinations of surgically removed brain tumor tissues confirmed the glioma diagnosis. Types of gliomas are shown in Table 1. Normal brain tissues were obtained from 5 patients with brain injury to serve as controls. All patients received no radiation or immunotherapy prior to the surgery. Tissue samples were stored at -80oC until being used for RNA isolation and were classified into three groups, including normal, low-grade glioma, and high-grade glioma. Thirty-nine of the 59 patients were confirmed to have glioblastoma (GBM), and 37 of these patients were followed by outpatient visits or phone calls for 8–25 months, mainly for survival after surgery. This study was approved by the Institutional Review Board of Tongi University Hospital, and informed consent was obtained from all patients.
Table 1
The clinical pathological information of gliomas
Pathological information | N |
Pilocytic astrocytoma | 2 |
Astrocytoma | 9 |
Oligodendroglioma | 2 |
Anaplastic astrocytoma | 6 |
Anaplastic oligoastrocytoma | 1 |
Glioblastoma | 39 |
Tissue culture and anti-sense RNA
Human embryonic kidney cell line 293T and human glioblastoma cell lines A172, U251, and U87 were purchased from China Nature Science Academy. These cells were cultured in DMEM medium with 10% fetal calf serum at 37oC, 5% CO2 in a humidified incubator. The vitality of cells was determined by trypan blue, which stains dead cells. The anti-sense RNA si-hsa_circ-0021483 (5’ACGAGAAAGAUCUACACAGTT-3’) against hsa_cir-0021483 RNA and the negative control scrambled anti-sense RNA NC (5’UUCUCCGAACGUGUCACGUTT-3’) were synthesized by GenePharma. miR-185-5p and double-stranded miR-185-5p (referred to as miR-185-5p mimic) were also purchased from GenePharma. Introduction of these RNAs into U87 or A172 cells was performed as described previously (Zhang et al 2015, 2017).
Bioinformatic analyses
The ENCORI (Encyclopedia of RNA Interactions) software (Li et al 2014) was used to analyze microarray results of two groups of 5 pairs of glioblastoma-normal brain tissues to detect potential interactions among circRNAs, miRNAs, and SALL4 mRNA.
Quantitative RT-PCR
The TRIzol reagent was used to isolate RNA from glioma tissues, normal brain cells, and cultured A172, U251, or U87 cells. The isolated RNAs were converted to cDNA by reverse transcription using the M-MLV kit (Promega, Madison, USA) at 37oC for 60 minutes, followed by inactivation at 85oC for 5 minutes. PCR was performed using the SYBR Green Master Mix (TaKaRa, Tokyo, Japan) on an ABI7500 PCR platform (Applied Biosystems, Life Technology, Foster City, USA) for 40 cycles of 95oC, 10s; 58oC, 30s; and 72oC, 30s after an initial treatment at 95oC for 3 minutes. A portion of GAPDH mRNA and U6 RNA was amplified simultaneously as internal controls. Fold change in gene expression was calculated using the 2− ΔΔCT equation. All PCR primers used are listed in Table 2.
Table 2
Primer sequence used for qPCR
| Forward | Reverse |
SALL4 | CCCGGCAGTAAGGACTGTC | TCTCTGTCTTTAGGTACACCACA |
GAPDH | CATGAGAAGTATGACAACAGCCT | AGTCCTTCCACGATACCAAAGT |
mir-433-3p | GACGATCATGATGGGCTCCT | TATGCTTGTTCACGAGTCCTTGTC |
mir-129-5p | CAACCTTACCTTTTTGCGGTC | TATGCTTGTTCTCGTCTCTGTGTC |
mir-204-3p | GATGGCTGGGAAGGCAAAG | TATGGTTGTTCACGACTGGTTCAC |
mir-128-3p | GAAGTGACCTCACAGTGAACCG | TATGGTTTTGACGACTGTGTGAT |
mir-491-5p | CAATCAGTGGGGAACCCTTC | TATGCTTGTTCTCGTCTCTGTGTC |
mir-4476 | AAGGTCACAGGAAGGATTTAGGG | GTGCAGGGTCCGAGGT |
mir-485-5p | AATATTAAGAGGCTGGCCGTG | TATGGTTTTGACGACTGTGTGAT |
U6 | CAGCACATATACTAAAATTGGAACG | ACGAATTTGCGTGTCATCC |
hsa_circ_0021483 | AAGCAACATGGCTGCACA | CTCGTCATTCCCTGGGTG |
hsa_circ_0048000 | GTGAGCTGCACGCAACAG | TCCAAATGCGCAGACTCA |
si- hsa_circ_0021483 | ACGAGAAAGAUCUACACAGTT | CUGUGUAGAUCUUUCUCGUTT |
Si-NC | UUCUCCGAACGUGUCACGUTT | ACGUGACACGUUCGGAGAATT |
Western blotting
Proteins were extracted from cells using RIPA buffer (KenGEN, Shanghai, China), electrophoresed in 10% SDS polyacrylamide gel, and then transferred from the gel to a nitrocellulose membrane. After 2 hours of blocking reaction in 5% BSA solution, the membrane was reacted with an appropriate primary antibody(Anti-SALL4 polyclonal antibody, PP1488b, GenePharma, 1:1000; Anti-PTEN polyclonal antibody, PP18619c, GenePharma, 1:1000; Anti-PI3K polyclonal antibody, PP8016C, GenePharma, 1:2000;Anti-Akt polyclonal antibody, PP7028B, GenePharma, 1: 1000; Anti-p-PI3K monoclonal antibody, #17366, CST, 1:1000; Anti-p-Akt polyclonal antibody, PP3434a, GenePharma, 1:1000; anti-β-Actin antibody produced in mouse, AM1021B, Abcepta, 1:1000) at 4oC overnight, followed by reaction with HRP-conjugated secondary at room temperature for 2 hours. Protein bands that reacted with the antibodies were visualized using the ECL Plus reagent (Applygen, Beijing, China).
CCK-8 Assay
The Cell Counting Kit-8 (CCK-8) was used to quantify viable cells. For the assay, 5.0 x 103 glioblastoma cells were placed in each well of a 96-well plate and incubated at 37oC overnight. The CCK-8 reagent, [WST-8: 2-(2-methoxy-4-nitrophenyl)-3-(4-nitrophenyl)-5-(2,4-disulfophenyl)-2H-tetrazolium, monosodium salt], was mixed with complete DMEM medium at 1:5 ratio, and 100 µl of the solution was added to each well. After 2 hours of incubation in darkness, the water-soluble formazan formed due to the reduction of WAST-8 by cellular dehydrogenases was quantified by measuring the optical density at 450 nm light (OD450). The OD450 value is directly proportional to the number of live cells. Each measurement was repeated 3 times, and each group of cells were tested by CCK-8 for 5 times.
Apoptosis Assay
Cultured U87 and A172 cells were treated with trypsin and then washed with PBS twice. The washed cells were suspended in 400 µl of binding buffer (Mbchem M3036) and then mixed with 5 µl of Annexin-FITC to bind to phosphatidylserine, which was translocated to cell surface due to apoptosis. After an incubation at 4oC in darkness for 15 minutes, 10 µl of propidium iodide (PI) was added to stain dead cells for 5 minutes also at 4oC in darkness. The stained cells were subjected to flow cytometry to determine the degree of apoptosis.
Cell migration and invasion assay
A Transwell device (Corning, MA, USA) with two chambers separated by an 8-µm pore size polycarbonate membrane was used. 5.0 × 103 each of cells transfected with siRNAs or un-transfected control cells were then placed in the upper chamber to assay their ability to migrate through the membrane. For invasion assay, the membrane was coated with 60 µl of Matrigel, and cells that penetrated the Matrigel coating were considered as invasive cells. The bottom chamber was filled with 700 µl of DMEM containing 20% fetal calf serum. After an incubation at 37°C, 5% CO2 for 36 hours, the cells on the upper surface of the membrane were removed with a cotton swab, and those on the lower surface were fixed on the membrane with 100% ethanol for 10 minutes at -20°C. The membrane was then reacted with crystal violet to stain proteins and examined by light microscopy to enumerate cells that migrated through the membrane or penetrated the Matrigel coating. Five randomly selected fields were examined, and the average number of invasive cells was calculated.
Cell cycle assay
The cell cycle assay was performed by measuring cellular DNA contents with flow cytometry. Forty-eight hours after transfection with siRNA against hsa_circ_0021483 or negative control siRNA, cells were treated with trypsin, washed with PBS twice, and fixed with cold (-20°C) 75% ethanol at 4°C overnight. The cells were than stained with propidium iodide (PI) and subjected to flow cytometry.
Xenotransplantation of tumor cells
A total of 20 BALB/c nude mice aged 4–6 weeks, female, 18-22g, SPF grade, were inoculated subcutaneously with 1 × 107 cells per mouse without glue. The tumor size was 150–200 mm3, and 15 tumors were guaranted as far as possible. These mice were divided into 3 groups with 5 mice in each group, including blank control (BC), negative control (NC), and si-circ_0024183 groups. SiRNA injections were taken every 3 days, for 6 consecutive times, with 2OD multipoint injection per mouse. The size (length × width) of each tumor was observed and measured every 3 days. After 25 ~ 30 days of inoculation, tumor formation was observed and photos were taken. On day 30, the nude mice were sacrificed by cervical dislocation. All animal studies were approved by the Institutional Animal Care and Use Committee (IACUC) of Tongji Hospital, Tongji University.
Dual reporter assay
The binding sites of miR-485-5p in hsa_circ_0021483 and SALL4 were identified from circAtlas by TargetScan. The identified sequences were then mutated (Fig. 4B). Both the wild type (WT) and mutated (Mut) miR-485-5p target sites were separately cloned into pmirGLO vector downstream of the firefly luciferase gene (luc2), which was the primary reporter gene. A positive control reporter plasmid was also constructed by cloning a DNA fragment with the sequence complementary to that of miR-485-5p into pmirGLO in the same manner. A reduced firefly luciferase activity indicates the binding of introduced miRNAs to the cloned miRNA target sequence. An internal control vector containing Renilla luciferase (hRluc-neo) gene was used for normalization of results of the dual reporter assay, which was performed using the Promega Dual-Luciferase® Assay system. 293T cells were grown in wells of a 12-well plate and then transfected with miR-485-5p or negative control RNA together with the internal control vector and pmirGLO- hsa_cir-0021483-WT, pmirGLO- hsa_circ_0021483-Mut, pmirGLO- SALL4-WT, or pmirGLO- SALL4-Mut vector. The dual reporter assay was then performed 48 hours after transfection.
RNA immunoprecipitation (RIP)
The Millipore RIP kit (Billerica, MA, USA) was used. U87 cells were washed with PBS and then lysed with the RIP reagent. The cell lysate was clarified by centrifugation at 16,000 xg for 10 minutes at 4°C. Each of the clarified supernatant was reacted with magnetic bead-conjugated antibody against SALL4 or nonspecific IgG at 4°C for 16 hours. The RNA thus precipitated was subjected to qRT-PCR to quantify hsa_cir-0021483 RNA.
Statistical analyses
Statistical analyses were performed using SPSS version 22.0 (IBM, Chicago, IL, USA). Student t test was used to compared data between two groups, and ANOVA was performed to analyze data from 3 or more groups. The Kaplan-Meier curve was used to determine survival rate of patients.