Cell culture and drug treatment
The mouse normal brain cell line BV2 was purchased from the Cell Bank of the Chinese Academy of Sciences. All cell lines were maintained in RPMI 1640 medium containing 10% fetal bovine serum, 100 units/mL penicillin G, and 100 μg/ml streptomycin. The cell incubator was maintained at 37°C with a humidified 5% CO2 atmosphere. BV2 cells were treated with 2mM concentration of AM for 24 hours as previously reported(Liu et al., 2015). Subsequently, cells were treated with different concentrations of SRT1720 (Hydrochloride) for 24 hours.
Proteomics
Protein extraction and quality inspection
Cells were collected after 24 hours of AM treatment, and the cells were immediately frozen in negative 80 refrigerator for future use, including the control group (without ACR treatment). All samples were taken out under frozen condition and placed on ice; appropriate amount of protein lysate (8m urea, 1% SDS, including protease inhibitor) was added; after ultrasonic lysis on ice, protein supernatant was extracted by centrifugation; BCA protein was quantified using standard protein provided by Thermo Scientific Pierce BCA kit, and finally SDS-PAGE (sodium dodecyl sulfate-polyacrylamide gel) electrophoresis was used to evaluate whether the quality of the sample met the requirements of follow-up experiments.
Protein pretreatment
Reductive alkylation and enzymatic hydrolysis of qualified protein samples were carried out. Triethyl ammonium bicarbonate buffer (TEAB) and tris-(2-carboxyethyl) phosphine (TCEP) were added to the 100 μg protein sample so that the final concentration was 100mm to react 60min at 37℃, then 40mM iodoacetamide (IAM) was added to avoid light for 40min at room temperature. Then precooled acetone (acetone: sample v/v=6:1) was added to precipitate 10000g centrifuge. Trypsin was added and hydrolyzed overnight at 37 ℃, the polypeptides were obtained. The peptides were labeled with TMT reagent (ThermoFisher) added with acetonitrile and hydroxylamine. And a tube of TMT reagent was added to every 100 μg polypeptides. Each group of medium amounts of labeled products was mixed in a tube and drained by a vacuum concentrator.
Separation and Analysis of Peptides
A reversed-phase C18 column was used for high pH liquid phase separation of polypeptide samples redissolved in UPLC sample buffer (2% acetonitrile). The fraction was collected according to peak shape and time, concentrated by vacuum centrifugation, dissolved with mass spectrometry sample buffer (2% acetonitrile and 0.1% formic acid), and analyzed by liquid phase tandem mass spectrometry (liquid chromatography coupled with tandem mass spectrometry, LC-MS/MS).
Database search and data statistical analysis
Submit the original raw file off the MS machine to the Proteome Discoverer server, and check the library using the software version of Proteome Discoverer TM Software 2.4. The protein sequences of specified species in NCBI and UniProt databases or other species databases were selected to search the database. The filtering parameters were Peptide FDR ≤ 0.01. The identification information of proteins and peptides after quality control was counted. According to the expression of protein in different samples, the samples were analyzed by correlation analysis and PCA analysis. Then, according to the identification of mass spectrometry, all proteins and protein sequences were compared with major databases (Uniprot, NR, GO, KEGG, String) and subcellular localization related databases, and the annotation information of proteins in each database was obtained. Then the expression abundance of the same protein in different samples was obtained through database search and peak analysis. Through the analysis of the differential expression of proteins among samples (n=3), the differentially expressed proteins among samples were excavated and screened. Fold Change (FC) and p-value were selected as the reference criteria for the screening of differential proteins between groups. Set FC≥1.5 or FC≤0.66, p < 0.05 as the filtering parameter for differential proteins. GO enrichment analysis of the protein concentration was carried out by the software Goatools, and KEGGPATHWAY protein concentration enrichment analysis using Megi database. All the methods were accurate Fisher test. Meiji mainly uses STRING database (http://string-db.org/) to analyze the protein interaction network, and also refers to the protein interaction network relationship in HPRD (http://www.hprd.org/), biogrid (http://thebiogrid.org), REACTOME (http://www.reactome.org) and other databases. For species with protein interactions in the database, a protein interaction network was constructed, and then networkX under Python was used to visualize the protein network.
Polymerase Chain Reaction (PCR) and Quantitative Real-time polymerase chain reaction(qRT-PCR)
Total RNA was isolated using the TRIzol reagent (ThermoFisher Scientific, USA) and quantified using a NanoDrop 2000 Spectrophotometer (Thermo Scientific Fisher). Reverse transcription of 2ug of total RNA was performed using Prime ScriptTM 1st Strand cDNA synthesis Kit (TaKaRa, Japan) according to the manufacturer’s instructions, then cDNA was subjected to PCR amplification and RT-PCR.
Table 1
Primer sequences of inflammatory factors
Gene
|
Direction
|
Primer sequences
|
IL-1
|
Forward Primer
|
TAGAAGGAAGTCAGACACCCACAGG
|
Reverse Primer
|
CACAGAAGGAAGATGGCACGACAG
|
IL-6
|
Forward Primer
|
AGTTGCCTTCTTGGGACTGA
|
Reverse Primer
|
TCCACGATTTCCCAGAGAAC
|
IL-18
|
Forward Primer
|
GGGTTCTCTGTGGTTCCATGC
|
Reverse Primer
|
CCTGATGCTGGAGGTTGCAG
|
TNF-α
|
Forward Primer
|
AGAAGTTCCCAAATGGCCTC
|
Reverse Primer
|
CCACTTGGTGGTTTGCTAGC
|
iNOS
|
Forward Primer
|
GTGTCAGTGGCTTCCAGCTC
|
Reverse Primer
|
CTCATGCGGCCTCCTTTGAG
|
β-actin
|
Forward Primer
|
AGAGGGAAATCGTGCGTGAC
|
Reverse Primer
|
CAATAGTGATGACCTGGCCGT
|
Total RNA was extracted with the RNeasy RNA isolation kit (Qiagen) and reverse transcribed to cDNA with the SuperScript First-strand Synthesis System (Thermo Fisher Scientific). The Real-time PCR reactions were performed with Hieff® qPCR SYBR Green Master Mix (Yeasen biotech) using ABI Prism 7500 system. The primer sequences were documented in the table 1.
Western blotting
Radio-immunoprecipitation assay (RIPA) lysis buffer was used to extract total proteins from BV2cells. The concentrations of protein lysates were quantified using BCA Protein Assay Reagent (Boster, Wuhan, China). The denatured proteins were separated by electrophoresis and transferred to a nitrocellulose membrane. After blocking in skim milk for 1 h, the membrane was incubated with rabbit anti-human GAPDH (Proteintech, 10494-1-AP, 1:5000), LARP7(Santa, sc-515209, 1:1000), SIRT1(Affinity, DF6033, 1:1000), P65 (Affinity, AF5006, 1:1000) and P-P65(Affinity, Catalog No:AF2006) antibodies overnight at 4°C. Subsequently, secondary antibody was incubated for 1 hour at room temperature, and the membrane was placed in a dual-color infrared laser scanning imaging system for band detection. Scan results were analyzed quantitatively using ImageJ and GraphPad Prism 8.
Immunofluorescence assay
Cells were seeded into 12-well plates pre-placed on treated coverslips, and drug treatments were administered 24 hours after seeding. Cells were subsequently fixed with 4% paraformaldehyde for 20 minutes, then permeabilized with ice-cold methanol and blocked in 3% BSA. Cells were then incubated with LARP7 antibody overnight at 4 °C followed by secondary antibody for one hour in the dark. Finally, cells are imaged on a fluorescence microscope.
Statistical analysis
Statistical analysis was performed using the GraphPad PRISM 8 software, and results from the experiment were expressed as means ± SD. Differences between groups were determined by one- way ANOVA test or student’s t-test. P value of < 0.05 was considered as statistically significant. Statistical analysis of proteomics has been introduced in Proteomics.