Clinical samples and data acquisition
Transcriptome RNA-sequencing (RNA-seq, FPKM) data of TNBC were downloaded from the TCGA data portal (https://cancergenome.nih.gov/), which contained data from 115 primary TNBC and 113 non-tumor tissues. RNA-seq data (RPKM) of 3 TNBC cell lines either treated with 2 μM GSK343, or stably transduced with shEHZ2, compared to untreated controls (GSE112378) were used for analysis by the R software Linear Models for Microarray and RNA-Seq Data (Limma) package (http://bioconductor.org/packages/Limma/). We performed differential gene analysis of all transcriptional data, setting a log2 |fold change| > 1 and a false discovery rate (FDR) < 0.05 as the cutoff values. The Wilcox-test was used for analyses. In 115 cases of TNBC RNA-Seq data (FPKM), FOSB was analyzed by GSEA 4.0.1 (with h.all.v7.0.symbols.gmt as the background gene set).
Cell lines and reagents
Breast cancer cell lines MDA-MB-231 and MDA-MB-436 cells were purchased from Cell lines Cell Bank of Chinese Academy of Sciences; HEK293T cells were kept in our lab for routine work.
Cells were cultured in Dulbecco's modified Eagle Medium (DMEM; Gibco BRL, Grand Island, NY, USA) with 10% FBS (Gibco, Gaithersburg, MD, USA), 100 U/ml penicillin and 100 μg/ml streptomycin, and maintained at 37°C in a humidified chamber (5% CO2). GSK343 was purchased from Medchemexpress (HY-13500). Cycloheximide (239764) was purchased from Calbiochem (San Diego, CA, USA). The proteasome inhibitor MG132 was purchased from Sigma-Aldrich (St. Louis, MO, USA).
RNA isolation, siRNAs and real-time PCR
Total RNAs from cells were extracted by using Trizol reagents (Invitrogen, Shanghai). The mRNAs were then reversed transcribed into complementary DNA (cDNA) using the Promega Reverse Transcription System (Madison, WI, USA). Oligo dT was used to prime cDNA synthesis. real-time PCR was performed using a SYBR Green Premix Ex Taq (Takara, Japan) on a Light Cycler 480 (Roche, Switzerland).The mRNA levels of GAPDH were used as internal control. Differences in gene expressionwere calculated using the 2-ΔΔCt method and expressed as fold-changes. PCR conditions included an initial holding period at 95°C for 5 min, followed by a two-step PCR program consisting of 95°C for 5 s and 60°C for 30 s for 50 cycles. Primers used for qPCR analysis were list as follows: FOSB forward, 5’-GCTGCAAGATCCCCTACGAAG-3’; reverse, 5’-ACGAAGAAGTGTACGAAGGGTT3’;EZH2 forward,5’-AATCAGAGTACATGCGACTGAGA-3’;reverse,5’-GCTGTATCCTTCGCTGTTTCC’; TP53 forward,5’- CAGCACATGACGGAGGTTGT-3’;reverse,5’-TCATCCAAATACTCCACACGC-3’; CDKN1(p21CIP1)forward, 5’- TGTCCGTCAGAACCCATGC-3’; reverse,5’- AAAGTCGAAGTTCCATCGCTC-3’; GAPDH forward, 5’- GGAGCGAGATCCCTCCAAAAT-3’; reverse, 5’-GGCTGTTGTCATACTTCTCATGG-3’. For knockdown experiments, cells were transiently transfected by siRNA pools with TransIT-X2 transfection reagent (Mirus, Madison, WI). Control-siRNAs were from Santa Cruz (sc-37007). EZH2-siRNAs were from Cell Signaling Technology (6509) and CEBPB-siRNAs were from Santa Cruz (sc-29229).
Western blotting
Cells were lysed in RIPA buffer and boiled for 10 min. Protein samples were separated by 10% SDS–PAGE and transferred to PVDF membranes. Following protein transfer, the membranes were blocked with 5% milk and incubated with different primary antibodies overnight at 4℃, followed by incubation with secondary antibodies. The primary antibodies used in western blotting included anti-Fos B(F-7) (sc-398595, Santa Cruz; 1:1000 dilution ) and anti-GAPDH (sc-47724; Santa Cruz; 1:5000).
Luciferase reporter and Chromatin immunoprecipitation (ChIP)
The promoter region of FOSB gene was amplified from the genomic DNA of 293T cells and inserted into pGL4.15 vector (Promega, Madison, Wisconsin, USA). For the luciferase reporter assays, HEK293T cells were seeded in 24-well plates and transfected with the indicated plasmids using Lipo2000 for 36 hours. Luciferase activity was measured using the Dual Luciferase Reporter Assay System (Promega). The firefly luciferase luminescence data were normalized by the Renilla luciferase luminescence data. A chromatin immunoprecipitation assay kit was used (Millipore, USA). In brief, cells fixed with 1% formaldehyde (Sigma, USA) and harvested in SDS lysis buffer. DNA was sheared to fragments of 200-1000 bp by sonications. Lysates containing soluble chromatin were incubated and precipitated overnight with 2 ug of anti- histone H3K27me3 (ab6002, Abcam), histone H3K27ac (#8173, Cell Signaling), anti-EZH2 (E7031,Sigma-Aldrich); anti-C/EBPβ (sc-7962, Santa Cruz) or rabbit IgG (#ab172730, Abcam). Protein G agarose was then added for four hours. Protein-DNA crosslinks were reversed by treatment with proteinase K for 2 hours at 45°C. The DNA was subsequently purified, diluted and subjected in the quantitative real-time PCR reactions.
Construction of Stable Cell Line
HEK293T cells were co-transfected with the vector control or pBabe-FOSB plasmids and packaging vectors for 48 hours. Filtered viral supernatants were then collected and added to MDA-MB-436 cells with 10 μg/mL Ploybrane for 48 hours and selected with puromycin (2μg/mL) for two weeks.
CRISPR/Cas9 knock out (KO) cell lines.
Single clones were then selected and the knockout efficiency was verified by western blot assay. The FOSB knock-out MDA-MB-231 cells were generated by CRISPR/Cas9 technology. Single-stranded DNA oligonucleotides targeted to the coding sites of the gene was designed according to the Crisprgold website (https://crisprgold.mdc-berlin.de/index.php). Annealed primers were cloned into the vector PX459. Primers used for FOSB were list: Forward primer: CACCGTCGTAGGGGTCGACGACCGG). Reverse primer: AAACCCGGTCGTCGACCCCTACGAC). MDA-MB-231 cells were transfected with PX459-FOSB plasmid using Lipo2000 following the manufacturer’s instructions. Cells were selected with 2µg/ml puromycin for about two weeks.
Cell colony formation assay
Cells were counted, plated in triplicate at a density of 1000 per well in 6-well plates, and cultured in complete medium for about 10 days. Then, the cells were washed with PBS and fixed in methanol and stained with crystal violet. The numbers of colonies were then counted.
Xenograft assays
Animal study was approved by the Animal Care and Use Committee of Liaoning Cancer Hospital and Institute. Four-week-old male BALB/cA nude mice were purchased from National Rodent Laboratory Animal Resources (Shanghai, China). All mice were kept in a specific pathogen-free facility. 1 × 107 FOSB WT or KO MDA-MB-231 cells were suspended in 50 µl of DMEM medium, mixed 1:1 with matrigel and injected into the flanks of male nude mice. Tumor sizes were measured by a caliper and calculated using the formula length × width 2 × 1/2. Tumor weights were measured after mice were sacrificed.
Statistical analyses
All experiments were at least repeated three times. Data are presented as mean ± standard deviation (SD). Results were analyzed using either two-tailed Student’s t test or two-way analysis of variance (ANOVA) in Graphpad Prism 7.0 software to assess statistical significance. P<0.05 were considered statistically significant. Statistical significance is displayed as * P < 0.05, ** P < 0.01, or *** P < 0.001.